SNP molecular marker for identifying soluble solid content of peach fruit and application thereof
By analyzing SNP molecular markers at 16,613,334 bp on chromosome 5 of the peach fruit genome, the problem of determining soluble solids content during the seedling stage was solved, enabling efficient and accurate fruit quality identification and improving breeding efficiency and fruit quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
- Filing Date
- 2025-05-27
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately determine the soluble solids content of peaches during the seedling stage, which affects the efficiency of the breeding process and the improvement of fruit quality.
A method based on SNP molecular markers was developed to identify the soluble solids content of fruit by using the A/G mutation site at 16,613,334 bp on chromosome 5 of the peach genome and genotyping analysis, classifying the fruit into two categories: low SSC and high SSC.
It enables early prediction and screening of soluble solids content in peach fruits with an accuracy rate of 83.23%, supporting fruit quality improvement and breeding optimization.
Smart Images

Figure CN120442850B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to an SNP molecular marker for identifying the soluble solids content of peach fruit and its application, belonging to the field of biotechnology. Background Technology
[0002] Peaches are sweet, juicy, and have a soft, chewy texture. Different peaches exhibit significant differences in shape, color, and taste. Among these, the soluble solids (SSC) content of peaches is a crucial fruit quality trait, closely related to fruit flavor and a key factor determining the overall taste quality. SSC levels not only reflect the physiological maturity of the fruit, helping to determine the optimal harvest window for best flavor, but also show a significant positive correlation with sweetness, making it a key target for improving the consumer's taste experience. From a postharvest perspective, higher SSC levels enhance cell osmotic pressure stability and delay fruit softening, thereby improving storage tolerance and reducing logistics losses, providing technical support for commercial promotion. Simultaneously, by addressing market preferences, increasing SSC content through genetic improvement can overcome the bottleneck of varietal homogenization, cultivating new germplasm with both high sugar content and good storage and transportation characteristics, thus strengthening brand competitiveness. Therefore, incorporating SSC into the breeding evaluation system can systematically optimize the edible and commercial value of peaches, promoting the industry towards high-quality and high-efficiency development. Recent statistics show that global peach consumption has generally declined, and the inconsistent taste and quality is one of the important reasons for this decline. Therefore, improving taste and quality has become an important goal of breeding work.
[0003] The peach is a diploid plant (2n=16), with a genome size of approximately 230 Mb, about twice the size of the model species Arabidopsis thaliana. Due to its small genome and short juvenile stage, it is often considered the model species for functional genomics research in the Rosaceae family. The peach is self-compatible, and compared to other fruit tree species, its genome heterozygosity is relatively low. In recent years, with the rapid development of sequencing technology and the continuous reduction in sequencing costs, peach genomics research based on resequencing has developed rapidly. More than a thousand resequencing materials have been completed, covering traditional molecular markers such as simple sequence repeats (SSRs), as well as next-generation molecular markers such as single nucleotide polymorphisms (SNPs), insertions / deletions (InDels), and structural variations (SVs). Combined with sequencing technology, relevant molecular markers can be developed to determine the soluble solids content of peach fruits at the seedling stage, preliminarily assess fruit sweetness, and accelerate the breeding process of high-sugar varieties. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the purpose of this invention is to provide an SNP molecular marker for identifying the soluble solids content of peach fruit and its application.
[0005] To achieve the above objectives, one aspect of the technical solution of the present invention is to provide an SNP molecular marker for identifying the soluble solids content of peach fruit, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] Furthermore, the SNP mutation site is position 201 of the sequence shown in SEQ ID NO.1, where an A / G mutation exists.
[0007] Furthermore, the SNP molecular marker is located at 16,613,334 bp on chromosome 5 of the peach genome.
[0008] On the other hand, the technical solution of the present invention is to provide an application of the SNP molecular marker in identifying the soluble solids content of peach fruit.
[0009] Furthermore, when the SNP molecular marker genotype is AA or AG, the soluble solids content of peach fruit is ≤12%; when the SNP molecular marker genotype is GG, the soluble solids content of peach fruit is >12%.
[0010] On the other hand, the technical solution of the present invention is to provide a method for identifying the soluble solids content of peach fruit using the SNP molecular marker, comprising the following steps:
[0011] (1) Extract genomic DNA from peach fruit samples to be tested;
[0012] (2) The genotypes of SNP molecular markers in peach fruit samples were obtained using the genomic DNA.
[0013] (3) Analyze the soluble solids content in peach fruit samples.
[0014] On the other hand, the technical solution of the present invention is to provide the application of the SNP molecular marker in the preparation of products for identifying the soluble solids content of peach fruit.
[0015] On the other hand, the technical solution of the present invention is to provide a product for identifying the soluble solids content of peach fruit prepared using the SNP molecular marker.
[0016] Beneficial effects:
[0017] This invention determined the soluble solids (SSC) content of 417 peach accessions matured in 2018, 2019, and 2020. The 417 accessions were sequenced using the Illumina sequencing platform, and the “LoveII” peach genome was used as a reference genome for comparative analysis. A non-synonymous mutation SNP (A / G) site significantly associated with peach SSC was detected at 16,613,334 bp on peach chromosome 5. Referring to the “Peach Germplasm Resource Description Specification and Data Standards,” this invention categorized SSC content into two types based on a 12% threshold: ≤12% for low SSC content and >12% for high SSC content, corresponding to genotypes AA / AG and GG, respectively. This invention utilizes the obtained SNP molecular markers to verify the soluble solids content of peach pulp. The results show that the accuracy rate for low SSC content (AA / AG) is 84.48%, the accuracy rate for high SSC content (GG) is 81.69%, and the overall accuracy rate is 83.23%. This indicates that the SNP molecular markers of this invention can be used for early prediction and screening of soluble solids content in peach fruit, and have good economic and practical value. Attached Figure Description
[0018] Figure 1 This is a distribution map of SSC content.
[0019] Figure 2 The Manhattan plot and QQ plot are the GWAS analysis results.
[0020] Figure 3 The phenotypic differences in SSC content among different genotypes in the population were statistically significant (P = 3.88e-15).
[0021] Figure 4 The phenotypic differences in SSC content among different genotypes in the tested hybrid population were statistically significant (P = 1.07e-27). Detailed Implementation
[0022] The specific embodiments of the present invention will be further described in detail below with reference to examples.
[0023] Example
[0024] 1. Obtaining phenotypic data:
[0025] This invention utilizes 417 polymorphic peach germplasm accessions from the National Peach Germplasm Repository of China (NPGRC) (Zhengzhou) (N 34.71°, E 113.70°). Soluble solids (SSC) content in the pulp of well-developed fruits was measured after maturity in 2018, 2019, and 2020, with three biological replicates. Phenotypic data were fitted and used for subsequent genome-wide association analysis (GWAS). The SSC distribution results of the associated populations showed a continuous and normally distributed SSC trait, demonstrating that this trait is a quantitative trait controlled by multiple genes with minor effects. Figure 1 ).
[0026] 2. Obtaining SNP molecular markers:
[0027] Using the aforementioned 417 peach germplasm materials as samples, 2g of fresh young leaves were collected from each sample, and DNA was extracted using the traditional CTAB method. Sequencing platforms included Illumina GAII or HiSeq 2500, with insert library sizes of 300 or 500 bp, and paired-end sequencing. Data quality control was performed using FastQC (v0.11.6), http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / . The “LoveII” peach genome (genome version: Prunus persica Genomev2.0.a1) was used as the basis for the DNA extraction.
[0028] Using https: / / www.rosaceae.org / species / prunus_persica / genome_v2.0.a1 as the reference genome, reads were aligned to the reference genome using BWA (v0.7.12) with the parameters: bwa mem-t 4-MR, generating a SAM file. Picard (version: 1.136) was used to sort the aligned reads, remove PCR duplicates, and convert the SAM file to a BAM file. The final alignment depth and coverage were calculated using GATK (version: 3.4-46)'s Depth of Coverage and BEDtools (version: 2.24.0)'s genomecov, respectively. SNP detection was performed using GATK. To reduce the impact of sequencing errors in gene identification and improve GWAS statistical power, SNPs were filtered to remove low-frequency variants (MAF < 0.05), resulting in a final SNP count of 342,387. GWAS was performed using a mixed linear model (MLM) and the software EMMAX (Version: beta). Using the Bonferroni test with a 5% threshold, non-synonymous mutant SNPs (A / G) significantly associated with peach SSCs were detected at 16,613,334 bp on chromosome 5 of the peach genome. Figure 2 The following is the nucleotide sequence of approximately 200 bp to the left and right of position 16613334 on chromosome 5 of the peach genome (where R represents A or G):
[0029] AGAGCTTGAAAGCTTTGAAGATGATTCATCTTCTCCTGAAAATAAATTTGGGGTAGCCATACTTGTTGTATTAGTACTTCTTTCACCATAAACCTTGCCACTCAATACATCTCTAATTGGATTATTTGAGAAATGTTTGCCCATCATTTCTGGAAAACCCAACTCCCCAAAACCCTGACTTTCAATAGCTTGCTGGCCTG RCACTAAAACATTGCTGCCAAAAGTACAGGGGATTTTCAATTCCCAACCCATCAAAGTATTTCTACTTCTAGAAAATGAATCAGTGTGTGAAATTGTTTCTTCGGAAACAAACCCCTTCCCTTCAGAAATACGGCTCCAAGACTCCATTACAAGTAAAAGGATCACAACTAAAGCCCACTTCAATTCATGGGGAAAACTAT(SEQ ID NO.1)
[0030] Referring to the "Description Specifications and Data Standards for Peach Germplasm Resources" (Table 1), and combining genotypes, SSC content is divided into two categories with 12% as the dividing line: ≤12% is low SSC content, corresponding to genotypes AA or AG; >12% is high SSC content, corresponding to genotype GG. Figure 3 ).
[0031] Table 1. Description Specifications for SSC in "Peach Germplasm Resource Description Specifications and Data Standards"
[0032]
[0033] 3. Verification
[0034] Using some conventional peach varieties from the China National Peach Germplasm Resource Bank as experimental materials, a total of 316 individual plants from 9 hybrid populations whose phenotypic traits had been investigated were selected, as detailed in Table 2:
[0035] Table 2. Names and sizes of the tested hybridization populations
[0036]
[0037] Based on the resequencing data from the research group (all listed individual plants have been resequencinged), genotype and phenotype were analyzed. Figure 4 The results showed that the allele at Chr5:16613334 was highly significantly associated with the SSC content in peach fruit. The results also showed that the accuracy rate for low SSC content (genotype AA / AG) was 84.48%, the accuracy rate for high SSC content (genotype GG) was 81.69%, and the overall accuracy rate was 83.23% (Table 3).
[0038] Table 3. Typing results of SSC traits
[0039]
Claims
1. The application of a product for detecting SNP molecular marker genotypes in identifying the soluble solids content of peach fruit, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1. The SNP mutation site is position 201 of the sequence shown in SEQ ID NO.1, where an A / G mutation exists. When the genotype at position 201 of the SNP molecular marker is AA or AG, the soluble solids content of the peach fruit is ≤12%; when the genotype at position 201 of the SNP molecular marker is GG, the soluble solids content of the peach fruit is >12%.
2. A method for identifying the soluble solids content of peach fruit using SNP molecular markers, characterized in that, Includes the following steps: (1) Extract genomic DNA from the peach fruit samples to be tested; (2) Using the genomic DNA, obtain the genotype of SNP molecular markers in peach fruit samples; (3) Analyze the soluble solids content in peach fruit samples; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1. The SNP mutation site is position 201 of the sequence shown in SEQ ID NO.1, where an A / G mutation exists. When the genotype at position 201 of the SNP molecular marker is AA or AG, the soluble solids content of the peach fruit is ≤12%; when the genotype at position 201 of the SNP molecular marker is GG, the soluble solids content of the peach fruit is >12%.
3. The application of a product for detecting SNP molecular marker genotypes in the preparation of a product for identifying the soluble solids content of peach fruit, characterized in that... The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1. The SNP mutation site is position 201 of the sequence shown in SEQ ID NO.1, where an A / G mutation exists. When the genotype at position 201 of the SNP molecular marker is AA or AG, the soluble solids content of the peach fruit is ≤12%; when the genotype at position 201 of the SNP molecular marker is GG, the soluble solids content of the peach fruit is >12%.