Compositions and methods of making capped mrna

This in vitro transcription method using a cap analogue with a specific structure to bind to a promoter solves the problem of low efficiency of capped mRNA in existing technologies, improves mRNA yield and purity, and achieves time and cost benefits. It is suitable for basic scientific research, pharmacology and therapeutics development.

CN120456815BActive Publication Date: 2026-07-31GENSCRIPT USA INC +1
View PDF 9 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GENSCRIPT USA INC
Filing Date
2023-08-09
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing technologies are inefficient and costly in synthesizing capped mRNAs in vitro, making it difficult to produce mRNAs with high expression levels and stability.

Method used

A method for in vitro transcription of DNA templates is provided, comprising binding a cap analogue of a specific structure to a promoter, incubating the reaction mixture with appropriate buffer substances, magnesium salts, RNA polymerase, etc., within a specific temperature and time range to prepare capped mRNA.

Benefits of technology

It improves the yield, purity, and capping efficiency of mRNA, achieving time and cost benefits, and is applicable to the synthesis of mRNA of different sizes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure BDA0005348691950000031
    Figure BDA0005348691950000031
  • Figure BDA0005348691950000241
    Figure BDA0005348691950000241
Patent Text Reader

Abstract

Methods for in vitro transcription of a DNA template into RNA include providing a mixture containing a buffer, ribonucleoside triphosphates (NTPs), one or more magnesium salts at a concentration from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at a temperature from about 25°C to about 40°C for about 1 hour to about 12 hours to produce the RNA. Methods for in vitro transcription include providing a DNA template and a cap analog that binds to -1 and / or +1 nucleotides of a promoter for in vitro transcription, thereby producing a more complete mRNA length, allowing for more flexible selection of the first mRNA base, and providing a +2 position open to a custom sequence.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related applications

[0002] This application claims priority to U.S. Application No. 18 / 069,123, filed December 20, 2022; U.S. Provisional Application No. 63 / 371,132, filed August 11, 2022; and U.S. Provisional Application No. 63 / 396,904, filed August 10, 2022. Each of these applications is incorporated herein by reference in its entirety for all purposes.

[0003] References to sequence lists submitted in XML-compatible files (.xml)

[0004] In accordance with the EFS-Web legal framework and 37 C.FR §1.821-825 (see MPEP §2442.03(a)), a sequence list in the form of a compatible XML file (titled “3000076-005977_Supp-SL_ST26.xml”, created on September 29, 2023, and of size 73,234 bytes) is filed concurrently with this application, and the entire contents of the sequence list are incorporated herein by reference. Background Technology

[0005] This disclosure generally relates to methods and compositions for in vitro transcription.

[0006] mRNA is a well-defined molecule with a structure containing a 5' cap, a 5' untranslated region (UTR), an open reading frame sequence encoding one or more target genes, a 3' UTR, and a poly-A tail. The in vitro synthesis of capped mRNAs may have significant implications for basic scientific research and the development of new therapeutics. Several factors contribute to the production of mRNAs with high expression levels, stability, and functionality.

[0007] The flanks of mRNA molecules can have 5' and 3' untranslated regions (UTRs). The 5'-UTR serves as the entry site for ribosome-induced translation, while the 3'-UTR plays an important role in translation termination and post-translational modifications (which may affect mRNA expression and half-life). Poly(A)tails of mRNA can make RNA molecules more stable and prevent mRNA degradation. In addition, poly(A)tails can allow mature messenger RNA to be exported from the nucleus and translated into proteins by ribosomes in the cytoplasm. See, for example, Sachs A and Wahle E, “Poly(A)tail metabolism and function in eucaryotes”, J Biol Chem, (November 5, 1993); 268(31):22955-8, which is incorporated herein by reference in its entirety.

[0008] The mRNA cap is a highly methylated modification at the 5' end of mRNA. It protects mRNA from degradation, recruits complexes involved in mRNA processing, and tags cellular mRNA to avoid recognition by the immune system. In mammals, the predominant 5' cap structure is an inverse 7-methylguanosine nucleotide linked to the first transcribed nucleotide via a 5'-5' triphosphate bond. 7-methylguanosine is methylated at its 7th carbon position and can be called... m7 G or 7m G. This cap structure can be represented as 5' m7 GpppN1(pN) x Where N is any nucleotide and x is 0 or any number. In the cap 0 structure, the first nucleotide has a 2' hydroxyl group in its ribose, while in the cap 1 structure, the first nucleotide has a 2'-o-methyl modification in its ribose, and the structure may contain from the 5' end to the 3' end. m7 G 5' pppN1 2'-OMe (pN) x , where N is any nucleotide and x can be any integer. Furthermore, in the cap 2 structure, with m7 The 2' hydroxyl groups of the first and second ribose linked by G are methylated. The structure may contain [missing information - likely related to methylation or methylation] from the 5' to the 3' end. m7 G 5' pppN1 2'-OMe pN2 2'-OMe (pN) x , where N is any nucleotide and x can be any integer. See, for example, Perry RP, “RNA processing comes of age”, J Cell Biol. (December 1981); 91(3Pt2):28s-38s, incorporated herein by reference in its entirety.

[0009] Capping can improve the properties of mRNA, such as, but not limited to, its stability and translation efficiency. See, for example, Banerjee AK, “5'-terminal cap structure in eucaryotic messenger ribonucleicacids”, Microbiol Rev. (June 1980); 44(2):175-205, which is incorporated herein by reference in its entirety. In vivo, each capping process can be carried out by an enzyme. See, for example, Perry. These processes can be time-consuming, inefficient, and expensive when performed in vitro.

[0010] The in vitro synthesis of capped mRNAs could have significant implications for basic scientific research, pharmacological development, and therapeutics. Several factors may contribute to the production of mRNAs with high expression levels, stability, and functionality. An efficient in vitro transcription method is needed that would allow for the more efficient production of capped mRNAs with high expression levels, stability, functionality, or combinations thereof. Summary of the Invention

[0011] In one aspect, this disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing (1) a DNA template containing a promoter operatively linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a polyA region, and (2) a cap analog comprising the following structure:

[0012]

[0013] R1 and R2 can each be CH3 or H; and B1 and B2 can each be A, U, G, or C.

[0014] The promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO:16).

[0015] In this context, A at position 17 is a -1 nucleotide and X1 at position 18 is a +1 nucleotide.

[0016] When X1 is G, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is G. When X1 is A, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is A.

[0017] When X1 is C, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is C, and

[0018] When X1 is T, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is U.

[0019] The cap analog binds to the -1 and +1 nucleotides of the promoter, and the DNA template and the cap analog are incubated in a reaction mixture, wherein the incubation may include incubating the reaction mixture from about 15°C to about 35°C for about 1 hour to about 12 hours to produce RNA.

[0020] On the other hand, the promoter may contain a sequence selected from SEQ ID NO:10, 11, 13 and 14.

[0021] On the other hand, the 5'UTR and the 3'UTR can be SEQ ID NO: 1 and 2, 1 and 4, 1 and 6, 3 and 2, 3 and 4, 3 and 6, 3 and 8, 5 and 2, 5 and 4, 5 and 6, 7 and 2, 7 and 4, 7 and 6, 7 and 8, 9 and 2, 9 and 4, 9 and 6, or 9 and 8.

[0022] On the other hand, the 5'UTR and the 3'UTR can be SEQ ID NO:1 and 2, 1 and 4, 3 and 2, 1 and 6, 7 and 4, 9 and 2, or 3 and 6, respectively.

[0023] On the other hand, the polyaluminum region may contain approximately 60 to 200 a atoms, approximately 60 to 190 a atoms, approximately 60 to 180 a atoms, approximately 60 to 170 a atoms, approximately 60 to 160 a atoms, approximately 60 to 150 a atoms, approximately 60 to 140 a atoms, approximately 60 to 130 a atoms, approximately 60 to 120 a atoms, approximately 60 to 110 a atoms, or approximately 60 to 100 a atoms. From about 70 to about 190 A's, from about 80 to about 180 A's, from about 90 to about 170 A's, from about 100 to about 160 A's, from about 100 to about 150 A's, from about 100 to about 140 A's, from about 100 to about 130 A's, from about 100 to about 120 A's, about 100 A's, about 110 A's, about 120 A's, about 130 A's, about 140 A's, or about 150 A's.

[0024] On the other hand, the cap analogue can be selected from the group consisting of: m 7 GpppApA, m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 G 3'Ome pppApA、m 7 G 3'Ome pppApC, m 7 G 3'Ome pppApG, m 7 G 3'Ome pppApU, m 7 G 3' Ome pppA 2'Ome pA, m 7 G 3'Ome pppA 2'Ome pC, m 7 G 3'Ome pppA 2'Ome pG, m 7 G 3'Ome pppA 2'Ome pU, m7 GpppA 2'Ome pA, m 7 GpppA 2'Ome pC, m 7 GpppA 2'Ome pG and m 7 GpppA 2'Ome pU.

[0025] On the other hand, the reaction mixture may contain a buffer substance at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl.

[0026] On the other hand, the RNA polymerase can be selected from wild-type T7 RNA polymerase or its variants.

[0027] On the other hand, the incubation may include incubating the reaction mixture at a temperature ranging from about 18°C ​​to about 31°C.

[0028] Alternatively, the incubation may include incubating the reaction mixture at approximately 30°C for approximately 4 hours.

[0029] On the other hand, the DNA template may further contain at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).

[0030] In one aspect, this disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising ribonucleoside triphosphates (NTPs), a DNA template, and an RNA polymerase (e.g., recombinant RNA polymerase), and incubating the reaction mixture at a temperature ranging from about 15°C to about 35°C, optionally from about 18°C ​​to about 31°C, for an appropriate time, preferably from about 1 hour to about 12 hours, thereby producing RNA. Preferably, the mixture further comprises a buffer substance and one or more magnesium salts. The mixture may optionally further comprise a cap analogue.

[0031] In one aspect, this disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising a buffer substance, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at a temperature from about 15°C to about 35°C, optionally from about 18°C ​​to about 31°C, for about 1 hour to about 12 hours, thereby producing RNA.

[0032] On the other hand, the buffering substance can be a Tris base, HEPES, or Tris-HCl.

[0033] On the other hand, the concentration of the buffer substance can be from about 1 mM to about 100 mM, from about 1 mM to about 90 mM, from about 1 mM to about 80 mM, from about 1 mM to about 70 mM, from about 1 mM to about 60 mM, from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 10 mM to about 20 mM. mM, from about 10mM to about 30mM, from about 10mM to about 40mM, from about 10mM to about 50mM, from about 20mM to about 50mM, from about 30mM to about 50mM, from about 40mM to about 50mM, from about 45mM to about 50mM, from about 45mM to about 55mM, from about 15mM to about 45mM, from about 15mM to about 35mM, from about 15mM to about 30mM, or from about 15mM to about 25mM.

[0034] On the other hand, the concentrations of these NTPs can range from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to about 8 mM, from about 3 mM to about 7 mM, from about 3 mM to about 6 mM, from about 3 mM to about 5 mM, from about 3 mM to about 4 mM, from about 4 mM to about 10 mM, from about 5 mM to about 10 mM, from about 6 mM to about 10 mM, from about 7 mM to about 10 mM, from about 8 mM to about 10 mM, or from about 9 mM to about 10 mM.

[0035] On the other hand, the concentration of the one or more magnesium salts may be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.

[0036] On the other hand, the concentration of the DNA template can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 2 μg / μl, from about 0.01 μg / μl to about 1.5 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to about 0.05 μg / μl. μg / μl, from about 0.02 μg / μl to about 0.04 μg / μl, from about 0.02 μg / μl to about 0.1 μg / μl, from about 0.03 μg / μl to about 0.1 μg / μl, from about 0.04 μg / μl to about 0.1 μg / μl, from about 0.05 μg / μl to about 0.1 μg / μl, from about 0.06 μg / μl to about 0.1 μg / μl, from about 0.07 μg / μl to about 0.1 μg / μl, from about 0.08 μg / μl to about 0.1 μg / μl, or from about 0.09 μg / μl to about 0.1 μg / μl.

[0037] On the other hand, the concentration of the recombinant RNA polymerase can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.3 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, or from about 0.01 μg / μl to about 0.05 μg / μl. / μl, from about 0.1μg / μl to about 1μg / μl, from about 0.1μg / μl to about 0.9μg / μl, from about 0.1μg / μl to about 0.8μg / μl, from about 0.1μg / μl to about 0.7μg / μl, from about 0.1μg / μl to about 0.6μg / μl, from about 0.1μg / μl to about 0.5μg / μl, from about 0.1μg / μl to about 0.4μg / μl, from about 0.1μg / μl to about 0.3μg / μl, or from about 0.1μg / μl to about 0.2μg / μl.

[0038] On the other hand, the mixture may further contain antioxidants.

[0039] On the other hand, the antioxidant may be dithiothreitol (DTT) at a concentration of about 1 mM to about 50 mM, about 2 mM to about 50 mM, about 3 mM to about 50 mM, about 4 mM to about 50 mM, about 5 mM to about 50 mM, about 6 mM to about 50 mM, about 7 mM to about 50 mM, about 8 mM to about 50 mM, about 9 mM to about 50 mM, about 10 mM to about 50 mM, about 10 mM to about 40 mM, about 15 mM to about 30 mM, about 15 mM to about 25 mM, about 15 mM to about 20 mM, about 20 mM to about 50 mM, about 30 mM to about 50 mM, or about 40 mM to about 50 mM.

[0040] On the other hand, the mixture may further contain an RNase inhibitor at a concentration of about 0.001 U / μl to about 5 U / μl, about 0.001 U / μl to about 4 U / μl, about 0.001 U / μl to about 3 U / μl, about 0.001 U / μl to about 2 U / μl, about 0.001 U / μl to about 1 U / μl, or about 0.01 U / μl to about 5 U / μl. 5 U / μl, from about 0.01 U / μl to about 4 U / μl, from about 0.01 U / μl to about 3 U / μl, from about 0.01 U / μl to about 2 U / μl, from about 0.01 U / μl to about 1 U / μl, from about 0.01 U / μl to about 0.5 U / μl, from about 0.01 U / μl to about 0.1 U / μl, from about 0.01 U / μl to about 0.05 U / μl, from about 0.0 From 1 U / μl to about 0.04 U / μl, from about 0.01 U / μl to about 0.03 U / μl, from about 0.01 U / μl to about 0.02 U / μl, from about 0.1 U / μl to about 5 U / μl, from about 0.1 U / μl to about 4 U / μl, from about 0.1 U / μl to about 3 U / μl, from about 0.1 U / μl to about 2 U / μl, from about 0.1 U / μl to about 1 U / μl, from From about 0.5 U / μl to about 5 U / μl, from about 0.5 U / μl to about 4 U / μl, from about 0.5 U / μl to about 3 U / μl, from about 0.5 U / μl to about 2 U / μl, from about 0.5 U / μl to about 1 U / μl, from about 1 U / μl to about 5 U / μl, from about 2 U / μl to about 5 U / μl, from about 3 U / μl to about 5 U / μl, or from about 4 U / μl to about 5 U / μl.

[0041] On the other hand, the mixture may further contain a capping analogue at a concentration ranging from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, and from about 3 mM to about 9 mM. From about 3mM to about 8mM, from about 3mM to about 7mM, from about 3mM to about 6mM, from about 3mM to about 5mM, from about 3mM to about 4mM, from about 4mM to about 10mM, from about 5mM to about 10mM, from about 6mM to about 10mM, from about 6mM to about 9mM, from about 6mM to about 8mM, from about 6mM to about 7mM, from about 7mM to about 10mM, from about 8mM to about 10mM, or from about 9mM to about 10mM.

[0042] On the other hand, the mixture may further contain polyamines.

[0043] On the other hand, the polyamine can be spermine, spermidine, or a combination thereof.

[0044] On the other hand, the concentration of the polyamine can be from about 0.1 mM to about 5 mM, from about 0.2 mM to about 4.9 mM, from about 0.2 mM to about 4.8 mM, from about 0.2 mM to about 4.7 mM, from about 0.2 mM to about 4.6 mM, from about 0.2 mM to about 4.5 mM, from about 0.2 mM to about 4.4 mM, from about 0.2 mM to about 4.3 mM, from about 0.2 mM to about 4.2 mM, from about 0.2 mM to about 4.1 mM, from about 0.2 mM to about 4 mM, from about 0.2 mM to about 3.5 mM, from about 0.2 mM to about 3 mM, from... From about 0.2 mM to about 2.5 mM, from about 0.5 mM to about 2.5 mM, from about 1.0 mM to about 2.5 mM, from about 1.5 mM to about 2.5 mM, from about 0.2 mM to about 2 mM, from about 0.2 mM to about 1.5 mM, from about 0.2 mM to about 1 mM, from about 0.2 mM to about 0.9 mM, from about 0.2 mM to about 0.8 mM, from about 0.2 mM to about 0.7 mM, from about 0.2 mM to about 0.6 mM, from about 0.2 mM to about 0.5 mM, from about 0.2 mM to about 0.4 mM, or from about 0.2 mM to about 0.3 mM.

[0045] On the other hand, the mixture may further contain pyrophosphatase at a concentration ranging from about 0.01 mU / μl to about 2 mU / μl, from about 0.01 mU / μl to about 1.5 mU / μl, from about 0.01 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about 2 mU / μl, from about 0.1 mU / μl to about 1.5 mU / μl, from about 0.1 mU / μl to about 1 mU / μl, and from about 0.1 mU / μl to about 2 mU / μl. μl to about 0.9 mU / μl, from about 0.1 mU / μl to about 0.8 mU / μl, from about 0.1 mU / μl to about 0.7 mU / μl, from about 0.1 mU / μl to about 0.6 mU / μl, from about 0.1 mU / μl to about 0.5 mU / μl, from about 0.1 mU / μl to about 0.4 mU / μl, from about 0.1 mU / μl to about 0.3 mU / μl, or from about 0.1 mU / μl to about 0.2 mU / μl.

[0046] On the other hand, the reaction mixture is incubated at the following temperatures: from about 15°C to about 35°C, from about 16°C to about 35°C, from about 17°C to about 35°C, from about 18°C ​​to about 35°C, from about 18°C ​​to about 34°C, from about 18°C ​​to about 33°C, from about 18°C ​​to about 32°C, from about 18°C ​​to about 31°C, from about 18°C ​​to about 30°C, from about 18°C ​​to about 29°C, from about 18°C ​​to about 28°C, from about 18°C ​​to about 27°C, from about 18°C ​​to about 26°C, from about 18°C ​​to about 25°C. From about 18°C ​​to about 24°C, from about 18°C ​​to about 23°C, from about 18°C ​​to about 22°C, from about 18°C ​​to about 21°C, from about 18°C ​​to about 20°C, from about 18°C ​​to about 19°C, from about 25°C to about 26°C, from about 25°C to about 27°C, from about 25°C to about 28°C, from about 25°C to about 29°C, from about 25°C to about 30°C, from about 25°C to about 31°C, from about 21°C to about 22°C, from about 21°C to about 23°C, from about 21°C to about 24°C, or from about 21°C to about 25°C.

[0047] On the other hand, the reaction mixture can be incubated for the following durations: from about 1 hour to about 12 hours, from about 1 hour to about 11 hours, from about 1 hour to about 10 hours, from about 1 hour to about 9 hours, from about 1 hour to about 8 hours, from about 1 hour to about 7 hours, from about 1 hour to about 6 hours, from about 1 hour to about 5 hours, from about 1 hour to about 4 hours, from about 1 hour to about 3 hours, from about 1 hour to about 2 hours, from about 2 hours to about 12 hours, from about 3 hours to about 12 hours, from about 4 hours to about 12 hours, from about 5 hours to about 12 hours, from about 6 hours to about 12 hours, from about 7 hours to about 12 hours, from about 8 hours to about 12 hours, from about 9 hours to about 12 hours, from about 10 hours to about 12 hours, or from about 11 hours to about 12 hours.

[0048] On the other hand, the reaction mixture can be incubated at about 25°C for about 1 hour to about 5 hours, from about 1.5 hours to about 4.5 hours, from about 2 hours to about 4 hours, from about 2.5 hours to about 3.5 hours, or from about 2.5 hours to about 3 hours.

[0049] On the other hand, the reaction mixture can be incubated at about 31°C for a period of about 1 hour to about 5 hours, from about 1 hour to about 4.5 hours, from about 1 hour to about 4 hours, from about 1 hour to about 3.5 hours, from about 1 hour to about 3 hours, from about 1 hour to about 2.5 hours, from about 1 hour to about 2 hours, from about 1 hour to about 1.5 hours, from about 0.5 hours to about 1 hour, or from about 0.5 hours to about 1.5 hours.

[0050] On the other hand, the DNA template may include a promoter operatively linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding the target RNA, a 3'UTR, and a poly-A region, wherein the promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO:16), wherein X1 is A or G, X2 is A or G, and X3 is A, T, G, or C, wherein the 5'UTR may be selected from SEQ ID NO:1, 3, 5, or 9, and the 3'UTR may be selected from SEQ ID NO:2, 4, 6, or 8, wherein the poly-A region comprises at least 60 adenine bases (A).

[0051] On the other hand, the promoter may contain a sequence selected from SEQ ID NO:10-15.

[0052] On the other hand, the cap analog can bind to the -1 and / or +1 nucleotides of the promoter.

[0053] In one aspect, this disclosure relates to a reaction mixture for in vitro transcription of a DNA template into RNA, the reaction mixture containing a buffer at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl.

[0054] On the other hand, the one or more magnesium salts may be MgCl2 and / or magnesium acetate (Mg(C2H3O2)2)(MgOAc).

[0055] In one aspect, this disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a reaction mixture of the present disclosure and incubating the reaction mixture at a temperature from about 15°C to about 35°C for about 1 hour to about 12 hours to produce RNA.

[0056] On one hand, the 5'UTR can be selected from SEQ ID NO:23-69.

[0057] On the other hand, the 5'UTR can be selected from SEQ ID NO:23-52.

[0058] In one respect, this disclosure relates to a nucleic acid containing a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding RNA, and a 3'UTR in the 5' to 3' direction, wherein the 5'UTR is selected from SEQ ID NO:23-69.

[0059] In one respect, this disclosure relates to nucleic acids containing nucleotide sequences selected from SEQ ID NO:23-52.

[0060] On the other hand, any one of SEQ ID NO:23-52 can be a 5'UTR or a 3'UTR. Attached Figure Description

[0061] Figure 1A This illustrates an embodiment of the present disclosure in which poly-A tails of different lengths are added to a DNA template.

[0062] Figure 1B The PCR products of over 90% of the eGFP templates showed a 100A tail added by the PCR method disclosed in Example 1, with an average length of 1086 bp.

[0063] Figure 2A This shows the quality of mRNA prepared by a method according to one embodiment of this disclosure.

[0064] Figure 2B This illustrates the expression of mRNA prepared by a method according to an embodiment of this disclosure.

[0065] Figure 3 This illustrates a polyA fragment length analysis according to an embodiment of this disclosure.

[0066] Figure 4 This illustrates the effect of poly-A tail length on mRNA expression according to one embodiment of this disclosure.

[0067] Figure 5A The comparison of expression levels of eGFP mRNA prepared by various methods according to one embodiment of this disclosure is shown by measuring the relative intensity of eGFP expression using a fluorescence plate reader.

[0068] Figure 5B The relative eGFP expression intensity in cells is shown, as measured by confocal microscopy.

[0069] Figure 6 This shows the expression level of luciferase mRNA prepared by a method according to one embodiment of this disclosure.

[0070] Figure 7 This shows a comparison of the expression levels of espCas9 mRNA prepared by various methods according to one embodiment of this disclosure.

[0071] Figures 8A-8C This shows the purity of mRNA prepared by various methods according to one embodiment of this disclosure.

[0072] Figure 9A The eGFP mRNA expression efficiency was shown by a fluorescence plate reader. The mRNA was prepared by in vitro transcription at different reaction temperatures of 31°C or 37°C.

[0073] Figure 9B The purity of eGFP mRNA obtained from the 31℃ IVT reaction is shown, as measured by a bioanalyzer.

[0074] Figure 9C The purity of eGFP mRNA obtained from the 37°C IVT reaction is shown, as measured by a bioanalyzer.

[0075] Figure 10A This illustrates an embodiment of the present disclosure in which in vitro transcription is initiated at the -1 position using a cap analogue.

[0076] Figure 10B This illustrates an embodiment of the present disclosure in which in vitro transcription is initiated at the +1 position using a cap analogue.

[0077] Figure 10C This demonstrates the capping efficiency of mRNA prepared by a method according to one embodiment of this disclosure.

[0078] Figure 10D The expression level of eGFP mRNA prepared by a method according to one embodiment of this disclosure is shown. IVT reactions initiated with the T7GGG promoter via co-transcription with a cap 1 analog at the -1 position have similar mRNA expression intensity compared to IVT initiated with T7AGG using a cap 1 analog at the +1 position.

[0079] Figure 11A This shows the purity of 10kb mRNA prepared by a method according to one embodiment of this disclosure.

[0080] Figure 11B This shows the purity of 10kb mRNA prepared by a method according to another embodiment of this disclosure.

[0081] Figure 11C This demonstrates the integrity of a 10kb mRNA prepared by a method according to one embodiment of this disclosure.

[0082] Figure 11D This shows the yield of 10kb mRNA prepared by a method according to one embodiment of this disclosure.

[0083] Figure 12A This illustrates the effect of magnesium on 1kb mRNA production according to one embodiment of this disclosure.

[0084] Figure 12B This illustrates the effect of magnesium on the integrity of 1kb mRNA according to one embodiment of this disclosure.

[0085] Figure 13 This shows the variation in the length of the poly-A tail generated by in vitro transcription according to one embodiment of this disclosure.

[0086] Figure 14 This shows the 5' end sequence of an RNA product prepared by IVT starting from the -1 position of a DNA template according to one embodiment of this disclosure.

[0087] Figure 15 This shows the 5' end sequence of an RNA product prepared by IVT starting from the +1 position of a DNA template according to one embodiment of this disclosure.

[0088] Figure 16A This illustrates the effect of the 5'UTR sequence on gene expression according to one embodiment of this disclosure.

[0089] Figure 16B This illustrates the effect of the 5'UTR sequence on gene expression according to another embodiment of this disclosure.

[0090] Figure 16C This illustrates the effect of the 5'UTR sequence on gene expression according to another embodiment of this disclosure.

[0091] Figure 17A This illustrates the effect of the 5'UTR sequence on gene expression according to another embodiment of this disclosure.

[0092] Figure 17B This illustrates the effect of the 5'UTR sequence on gene expression according to another embodiment of this disclosure. Detailed Implementation

[0093] This document provides methods and compositions for the in vitro synthesis of mRNA. The mRNA may also contain one or more caps, and methods and compositions for the in vitro synthesis of capped mRNA are provided. The mRNA may also contain a poly-A tail, and methods and compositions for the in vitro synthesis of mRNA with a poly-A tail are provided. Aspects of the disclosed methods and compositions can be used alone or in any combination. The disclosed methods and compositions can improve the efficiency of mRNA synthesis and can provide mRNA with improved properties.

[0094] The advantages disclosed herein may include, for example, improved mRNA yield, improved mRNA purity, improved capping efficiency, and improved uniformity of the length and / or distribution of poly-A tails. Improvements in time efficiency and / or cost efficiency may also be achieved.

[0095] The disclosed methods and compositions can be used alone or in any combination to perform in vitro synthesis of mRNAs of different sizes, such as, but not limited to, the following ranges: from about 100b to about 20Kb, from about 200b to about 19Kb, from about 300b to about 18Kb, from about 400b to about 17Kb, from about 500b to about 16Kb, from about 600b to about 15Kb, from about 700b to about 14Kb, from about 800b to about 13Kb, from about 900b to about 12Kb, from about 1Kb to about 11Kb, from about 1Kb to about 10Kb, from about 1Kb to about 9Kb, from about 1Kb to about 8Kb, from about 1Kb to about 7Kb, from about 1Kb to about 6Kb, from about 1Kb to about 5Kb, from about 1Kb to about 4Kb, from about 1Kb to about 3Kb, from about 1Kb to about 2Kb, from about 50b to about 200b, from about 60b to about 190b, from about 70b to about 180b, from about 80b to about 160b, from about 90b to about 100b, from about 90b to about 110b, from about 90b to about 120b, from about 90b to about 130b, from about 90b to about 140b, from about 90b to about 150b, from about 100b to about 140b, from about 110b to about 130b, or from about 110b to about 120b.

[0096] mRNA synthesized using the disclosed compositions and / or methods may have applications including, but not limited to, use in basic scientific research, use in pharmacological development, use in diagnostic development, use in therapeutic development, use as a pharmacological agent, use as a diagnostic agent, use as a therapeutic agent, or any combination thereof.

[0097] Methods for in vitro transcription of RNA are known in the art (see, for example, Geall et al. (2013) Semin. Immunol. 25(2):152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14). Reagents used in these methods may include: a linear DNA template having a promoter sequence with high binding affinity to its corresponding RNA polymerase; ribonucleoside triphosphates (NTPs) of four bases (adenine, cytosine, guanine, and uracil); cap analogs (e.g., m7G(5')ppp(5')G(m7G)); other modified nucleotides; DNA-dependent RNA polymerases (e.g., T7, T3, or SP6 RNA polymerases); ribonuclease (RNase) inhibitors to inactivate any contaminating RNases; pyrophosphatases to degrade pyrophosphate that inhibits transcription; and MgCl2 and / or MgOAc, which provide Mg 2+ As a cofactor for RNA polymerase; an antioxidant (e.g., DTT); a polyamine, such as spermidine; and a buffer to maintain the appropriate pH.

[0098] Common buffer systems used for in vitro RNA transcription may include 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris). The pH of the buffer is typically adjusted to between 6 and 8.5. Some commonly used transcription buffers contain 80 mM HEPES / KOH (pH 7.5) and 40 mM Tris / HCl (pH 7.5).

[0099] Transcription buffers may also contain magnesium salts, such as MgCl2 and / or MgOAc, typically in the range of 5-50 mM. Magnesium ions (Mg...) 2+ ) can be an essential component of the RNA in vitro transcription buffer system because free Mg 2+ It can act as a cofactor at the catalytic center of RNA polymerase and may be crucial for RNA polymerization. In diffusion binding, fully hydrated Mg ions can also interact with RNA products via nonspecific long-range electrostatic interactions.

[0100] RNA in vitro transcription can be performed in batch reactions, where all components are combined and then incubated to allow RNA molecule synthesis until the reaction terminates. Additionally, fed-batch reactions have been developed to increase the efficiency of RNA in vitro transcription (Kern et al. (1997) Biotechnol. Prog. 13:747-756; Kern et al. (1999) Biotechnol. Prog. 15:174-184). In fed-batch systems, all components are combined, but then additional amounts of reagents (e.g., NTP, MgCl2, and / or MgOAc) are added over time to maintain constant reaction conditions.

[0101] For clarity and readability, the following definitions are provided. Any technical features mentioned in these definitions can be found in every embodiment of the invention. Further definitions and interpretations may be provided specifically within the context of these embodiments.

[0102] In vitro transcription: The term "in vitro transcription" or "RNA in vitro transcription" can refer to a process in which RNA is synthesized in a cell-free system (in vitro). DNA, particularly plasmid DNA, is used as a template for producing RNA transcripts. RNA can be obtained through DNA-dependent in vitro transcription of a suitable DNA template, which, according to this disclosure, can preferably be a linearized plasmid DNA template. The promoter used to control in vitro transcription can be any promoter targeting any DNA-dependent RNA polymerase. Specific non-limiting examples of DNA-dependent RNA polymerases are T7, T3, and SP6 RNA polymerases. The DNA template for in vitro RNA transcription can be obtained, for example, by cloning nucleic acids (particularly cDNA corresponding to the corresponding RNA to be transcribed in vitro) and introducing them into a suitable vector for in vitro transcription, such as plasmid DNA. In a preferred embodiment of this disclosure, the DNA template can be linearized with a suitable restriction enzyme prior to its in vitro transcription. cDNA can be obtained by reverse transcription of mRNA or by chemical synthesis. Furthermore, the DNA template for in vitro RNA synthesis can also be obtained by gene synthesis.

[0103] For example, reagents used in in vitro transcription may include:

[0104] 1) A linearized DNA template with a promoter sequence that has a high binding affinity for its corresponding RNA polymerase (such as a bacteriophage-encoded RNA polymerase);

[0105] 2) Ribonucleotide triphosphates (NTPs) of four bases (adenine, cytosine, guanine, and uracil);

[0106] 3) Optionally, a cap analogue as defined below (e.g., m7G(5')ppp(5')A(m7G));

[0107] 4) DNA-dependent RNA polymerases (e.g., T7, T3, or SP6 RNA polymerases) that can bind to promoter sequences within linearized DNA templates;

[0108] 5) Optional ribonuclease (RNase) inhibitors to inactivate any contaminating RNases;

[0109] 6) Optional pyrophosphatase to degrade pyrophosphate that can inhibit transcription;

[0110] 7) MgCl2 and / or magnesium acetate (Mg(C2H3O2)2)(MgOAc), which provide Mg 2+ Ions act as cofactors for polymerases;

[0111] 8) A buffer solution to maintain a suitable pH value, which may also contain optimal concentrations of antioxidants (e.g., DTT), amines (e.g., betaine) and / or polyamines (e.g., spermidine).

[0112] In the embodiments, in the method for in vitro transcription of RNA according to this disclosure, the following reagents are not used, which are only required for the in vitro translation of transcribed RNA into proteins, but not for in vitro transcription of RNA. Specifically, the mixture used for in vitro transcription of RNA may be free of any protein-derived amino acids or tRNA. Furthermore, the mixture may be free of any protein-derived amino acids, tRNA, or ribosome-containing cell extracts.

[0113] As used herein, the term "co-transcription" refers to the preparation of mRNA with a cap structure via a one-step in vitro transcription reaction using an RNA polymerase (e.g., T7 RNA polymerase). In contrast, one or more conventional post-transcriptional capping methods may require preparing uncapped RNA by in vitro transcription (IVT) in the presence of RNA polymerase, followed by capping with a capping enzyme (e.g., vaccinia capping enzyme) using the aid of a 2'-O-methyltransferase for adding methylation at the +1 base of the mRNA.

[0114] Nucleic acids: The term “nucleic acid” means any DNA or RNA molecule and is used synonymously with polynucleotides. Furthermore, modifications or derivatives of nucleic acids as defined herein are explicitly included in the general term “nucleic acid.” For example, peptide nucleic acids (PNAs) are also included in the term “nucleic acid.”

[0115] Nucleic acid template: The nucleic acid template provides the following nucleic acid sequence, which is transcribed into RNA through an in vitro transcription process and therefore contains a nucleic acid sequence complementary to the RNA sequence transcribed from it. In addition to the nucleic acid sequence transcribed into RNA, the nucleic acid template also contains a promoter, which the RNA polymerase used in the in vitro transcription process binds to with high affinity.

[0116] Preferably, the nucleic acid template can be a linearized plasmid DNA template. The linear template DNA can be obtained by contacting the plasmid DNA with a restriction enzyme under suitable conditions, causing the restriction enzyme to cleave the plasmid DNA at one or more recognition sites and disrupt the circular plasmid structure. Preferably, the plasmid DNA is cleaved immediately after the ends of the sequence to be transcribed into RNA. Therefore, the linear template DNA contains free 5' ends and free 3' ends that are not connected to each other. If the plasmid DNA contains only one recognition site of the restriction enzyme, the linear template DNA has the same number of nucleotides as the plasmid DNA. If the plasmid DNA contains more than one recognition site of the restriction enzyme, the linear template DNA has fewer nucleotides than the plasmid DNA. The linear template DNA is then a fragment of plasmid DNA containing the elements required for in vitro transcription, namely promoter elements and template DNA elements for RNA transcription. The open reading frame (ORF) of the linear template DNA determines the sequence of the transcribed RNA by base pairing rules.

[0117] In other embodiments, the nucleic acid template may be selected from a synthetic double-stranded DNA construct, a single-stranded DNA template having a double-stranded DNA region containing an RNA polymerase-binding promoter, a circular double-stranded DNA template having promoter and terminator sequences, or a linear DNA template amplified by PCR or isothermal amplification.

[0118] According to preferred embodiments of this disclosure, the concentration of the nucleic acid template contained in the in vitro transcription mixture described herein can be in the following ranges: from about 1 to about 200 nM, from about 10 nM to about 150 nM, from about 20 nM to about 140 nM, from about 30 nM to about 130 nM, from about 40 nM to about 120 nM, from about 50 nM to about 110 nM, from about 60 nM to about 100 nM, from about 65 nM to about 90 nM, from about 65 nM to about 80 nM, from about 65 nM to about 75 nM, from about 65 nM to about 70 nM, from about 70 nM to about 75 nM, from about 1 to about 40 nM, from about 1 to about 30 nM, from about 1 to about 20 nM, or from about 1 to about 10 nM. Even more preferably, the concentration of the nucleic acid template can be from about 10 to about 30 nM. Most preferably, the concentration of the nucleic acid template can be about 40, 50, 60, 70, 80, 90 or 100 nM.

[0119] RNA, mRNA: RNA is the common abbreviation for ribonucleic acid. It is a nucleic acid molecule, that is, a polymer composed of nucleotide monomers. These nucleotides are typically monomers of adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP), and cytidine monophosphate (CMP), or analogues, linked together along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar (i.e., ribose) of the first monomer and the phosphate moiety of the second adjacent monomer. The specific sequence of the monomers (i.e., the sequence of bases linked to the sugar / phosphate backbone) is called the RNA sequence. RNA is typically acquired through transcription of a DNA sequence (e.g., within a cell). In eukaryotic cells, transcription usually takes place in the nucleus or mitochondria. In vivo, transcription of DNA typically produces so-called premature RNA, which must be processed into so-called messenger RNA (usually abbreviated as mRNA). For example, the processing of premature RNA in eukaryotes involves a variety of different post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The sum of these processes is also called RNA maturation. Mature messenger RNA typically provides a nucleotide sequence that can be translated into an amino acid sequence of a specific peptide or protein. Typically, mature mRNA contains a 5' cap, optionally a 5' UTR, an open reading frame, optionally a 3' UTR, and a poly(A) sequence.

[0120] In addition to messenger RNA, several non-coding RNA types exist that may be involved in the regulation of transcription and / or translation, as well as immune stimulation. The term "RNA" further encompasses RNA molecules such as viral RNA, retroviral RNA and replicon RNA, small interfering RNA (siRNA), antisense RNA, CRISPR / Cas9 guide RNA, ribozymes, aptamers, riboswitch RNA, immunostimulatory RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and Piwi-interacting RNA (piRNA).

[0121] Dicarboxylic acids or their salts: Dicarboxylic acids are organic acids having two carboxyl groups (-COOH). This term includes those with the general formula HO₂C—(CH₂). n Linear saturated dicarboxylic acids with a -CO2H group, such as oxalic acid, malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, octanoic acid, azelaic acid, and sebacic acid. It also includes unsaturated dicarboxylic acids with at least one double bond (such as maleic acid and fumaric acid), and substituted dicarboxylic acids with at least one additional functional group (such as malic acid, tartaric acid, chicoric acid, and dimercaptosuccinic acid). Salts of dicarboxylic acids contain a dicarboxylic acid anion and a suitable cation, such as Na+. + K + Ca 2+or Mg 2+ .

[0122] Tricarboxylic acids or their salts: Tricarboxylic acids are organic acids having three carboxyl groups (-COOH). Examples of tricarboxylic acids include citric acid, isocitric acid, aconitic acid, trimesic acid, hypozinotriacetic acid, and propane-1,2,3-tricarboxylic acid. In the buffer systems and methods of the present invention, citric acid (3-carboxy-3-hydroxypentane-1,5-diacid) is preferably used. Salts of tricarboxylic acids comprise a tricarboxylic acid anion and a suitable cation, such as Na+. + K + Ca 2+ or Mg 2+ Preferably, sodium citrate or magnesium citrate is used. If magnesium citrate is added to the in vitro RNA transcription reaction, it may not be necessary to add magnesium salts to the reaction, because the magnesium ions in magnesium citrate can act as a cofactor for RNA polymerase. Therefore, in this case, the reaction mixture for in vitro RNA transcription contains magnesium citrate, a buffer, ribonucleoside triphosphate, a nucleic acid template, and RNA polymerase.

[0123] Buffering agents: A buffering agent is a weak acid or base used to maintain the acidity (pH) of a solution near a selected value after the addition of another acid or base. Therefore, the function of a buffering agent is to prevent rapid pH changes when an acid or base is added to the solution. Suitable buffering agents used in this invention include tris(2-amino-2-hydroxymethyl-propane-1,3-diol) and HEPES (2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid). The buffering agent may further include an acid or base for adjusting the pH, such as HCl in the Tris case (Tris-HCl) and KOH in the HEPES case (HEPES-KOH). In a preferred embodiment of the invention, citric acid is used to adjust the pH of the buffering agent (preferably a Tris base), thus eliminating the need to add other acids. In alternative embodiments, the pH of the buffering agent is adjusted with an acid or base (such as HCl and KOH), and in addition to the pH-adjusted buffering agent, a salt of a dicarboxylic acid or tricarboxylic acid (preferably a citrate) is also present in the reaction mixture.

[0124] The concentration of the buffer substance in the mixture used for in vitro transcription as described herein may be about 10 to about 100 mM, about 10 to about 80 mM, about 10 to about 50 mM, about 10 to about 40 mM, about 10 to about 30 mM, or about 10 to about 20 mM. Preferably, the concentration of the buffer substance is 80 mM.

[0125] Preferably, the buffer solution has a pH value from about 6 to about 8.5, from about 6.5 to about 8.0, from about 7.0 to about 7.5, or even more preferably about 7.5 or about 8.0.

[0126] Ribonucleotide triphosphates: Ribonucleotide triphosphates (NTPs) (i.e., GTP, ATP, CTP, and UTP) are monomers polymerized during in vitro transcription. They can provide monovalent or divalent cations as counterions. Preferably, the monovalent cation is selected from the group consisting of: Li + Na + K + NH4 + Or tris(hydroxymethyl)aminomethane (Tris). Preferably, the divalent cation is selected from the group consisting of: Mg 2+ Ba 2+ and Mn 2+ More preferably, the monovalent cation is Na. + Or tris(hydroxymethyl)aminomethane (Tris).

[0127] According to a preferred embodiment of the invention, at least one ribonucleoside triphosphate in the in vitro transcription reaction mixture is partially or completely replaced by a modified ribonucleoside triphosphate as defined below.

[0128] Modified nucleoside triphosphates: As used herein, the term "modified nucleoside triphosphates" refers to chemical modifications that include skeletal modifications as well as sugar or base modifications. These modified nucleoside triphosphates are also referred to herein as (nucleotide) analogs.

[0129] In this context, modified nucleoside triphosphates, as defined herein, are nucleotide analogs / modifications, such as backbone modifications, sugar modifications, or base modifications. Backbone modifications relevant to this invention are modifications in which the phosphate group in the backbone of the nucleotide is chemically modified. Sugar modifications relevant to this invention are chemical modifications of the sugar group in the nucleotide. Furthermore, base modifications relevant to this invention are chemical modifications of the base portion of the nucleotide. In this context, nucleotide analogs or modifications are preferably selected from nucleotide analogs suitable for transcription and / or translation.

[0130] Sugar modification

[0131] Modified nucleosides and nucleotides that can be used in the context of this invention can be modified at the sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or replaced by several different "oxygen" or "deoxy" substituents. Examples of "oxygen"-2' hydroxyl group modifications include, but are not limited to, alkoxy or aryloxy groups (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG); -O (CH2CH2O). nCH2CH2OR; "locked" nucleic acid (LNA), wherein the 2' hydroxyl group is connected to the 4' carbon of the same ribose, for example, via a methylene bridge; and an amino group (-O-amino, wherein the amino group (e.g., NRR) can be alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy.

[0132] "Deoxy" modification includes hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or an amino group that can be attached to a sugar via a linker containing one or more of C, N, and O atoms.

[0133] The sugar group may also contain one or more carbons having a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, modified nucleotides may include nucleotides containing, for example, arabinose as a sugar.

[0134] Skeletal modification

[0135] The phosphate backbone can be further modified in the modified nucleosides and nucleotides. The phosphate group of the backbone can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, the modified nucleosides and nucleotides can include complete replacement of the unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphate, selenophosphate, boroalkylphosphate, boroalkyl phosphate esters, hydrophosphonates, phosphoramides, alkylphosphonic acids or arylphosphonic acids and phosphate triesters. Dithiophosphate has two unlinked oxygen atoms replaced by sulfur. The phosphate linker can also be modified by replacing the linked oxygen atoms with nitrogen (bridged phosphoramide), sulfur (bridged thiophosphate), and carbon (bridged methylene-phosphonic acid).

[0136] Base modification

[0137] The modified nucleosides and nucleotides that can be used in this disclosure may be further modified at the nucleobase moiety. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein may be chemically modified at the major groove. In some embodiments, major groove chemical modifications may include amino groups, thiol groups, alkyl groups, or halogen groups.

[0138] In a particularly preferred embodiment of the invention, the nucleotide analog / modification may be selected from base modifications, which are preferably selected from 2-amino-6-chloropurine nucleoside-5'-triphosphate, 2-aminopurine-nucleoside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2' -O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate Acid, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine nucleoside-5'-triphosphate, 7-deazoadenosine-5 5'-triphosphate, 7-deazoguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-nucleoside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate or puromycin-5'-triphosphate, flavin-5'-triphosphate. Particularly preferred nucleotides for base modification are given, selected from the group of nucleotides with the following base modifications: 5-methylcytidine-5'-triphosphate, 7-deazoguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate.

[0139] In some embodiments, the modified nucleoside may include pyridine-4-ketoribonucleotide, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-tauronic acid methyluridine, 1-tauronic acid methyl-2-thio-uridine, 1-tauronic acid methyl-2-thio-uridine, etc. 4-thiouridine, 5-methyluridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine.

[0140] In some embodiments, the modified nucleosides may include 5-aza-cytidine, pseudocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrolo-cytidine, pyrrolo-pseudocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thio-pseudocytidine, 4-thio-1-methyl-pseudocytidine, 4 -Thio-1-methyl-1-denitro-pseudoisocytidine, 1-methyl-1-denitro-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine.

[0141] In other embodiments, the modified nucleosides may include 2-aminopurine, 2,6-diaminopurine, 7-deadenine, 7-deadenine-8-aza-adenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, 7-deadenine-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6 -Isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyl adenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyl adenosine, 2-methylthio-adenosine, and 2-methoxy-adenosine.

[0142] In other embodiments, the modified nucleosides may include inosine, 1-methyl-inosine, wyoside, wyoside, 7-deazoguanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0143] In some embodiments, the nucleotide may be modified on the major groove face and may include replacing the hydrogen on C-5 of uracil with a methyl group or a halogen group.

[0144] In specific embodiments, the modified nucleosides are 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseuuridine.

[0145] In another specific embodiment, the modified nucleotide may include nucleoside modifications selected from the following: 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-isocytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudo-uridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-Methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deazo-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudoisocytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, 7-deazo-adenosine.

[0146] Magnesium salts: Magnesium salts contain magnesium cations and suitable anions (such as chloride anions or acetate anions). Preferably, the magnesium salt is magnesium chloride. In one or more in vitro transcription mixtures described herein, preferably, initially free Mg... 2+ The concentration can be from about 1 to about 100 mM, about 1 to about 75 mM, about 1 to about 50 mM, about 1 to about 25 mM, or about 1 to about 10 mM. Even more preferably, the initially free Mg 2+Concentrations range from about 5 to about 50 mM, about 10 to about 45 mM, about 15 to about 40 mM, or about 16 to about 37 mM, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 mM. Those skilled in the art will understand that Mg... 2+ The choice of concentration may be influenced by the initial total NTP concentration, meaning that if a higher total NTP concentration is used in the in vitro transcription mixture, a higher Mg concentration may be required. 2+ Concentration. In some embodiments, the concentration of the magnesium salt may be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.

[0147] RNA polymerase: RNA polymerase is an enzyme that catalyzes the transcription of a DNA template into RNA. Suitable RNA polymerases used in this disclosure may include T7, T3, SP6, and E. coli RNA polymerase. Preferably, T7 RNA polymerase may be used. It is also preferred that the RNA polymerase used in this disclosure may be a recombinant RNA polymerase, meaning that it is added as a single component to the in vitro RNA transcription reaction, rather than as part of a cell extract containing other components besides the RNA polymerase. Those skilled in the art will understand that the choice of RNA polymerase depends on the promoter present in the DNA template, which must be bound by a suitable RNA polymerase. Preferably, the concentration of RNA polymerase in one or more in vitro transcription mixtures described herein can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to... Approximately 0.05 μg / μl, from about 0.1 μg / μl to about 1 μg / μl, from about 0.1 μg / μl to about 0.9 μg / μl, from about 0.1 μg / μl to about 0.8 μg / μl, from about 0.1 μg / μl to about 0.7 μg / μl, from about 0.1 μg / μl to about 0.6 μg / μl, from about 0.1 μg / μl to about 0.5 μg / μl, from about 0.1 μg / μl to about 0.4 μg / μl, from about 0.1 μg / μl to about 0.3 μg / μl, or from about 0.1 μg / μl to about 0.2 μg / μl. Those skilled in the art will understand that the choice of RNA polymerase concentration may be influenced by the concentration of the DNA template.

[0148] Pyrophosphatase: Pyrophosphatase is an anhydride hydrolase that hydrolyzes diphosphate bonds. In in vitro transcription reactions, it can be used to hydrolyze the bonds in diphosphates released after ribonucleoside triphosphates are incorporated into the nascent RNA chain. Preferably, the concentration of pyrophosphatase in one or more in vitro transcription mixtures described herein can be from about 1 to about 100 units / ml, from about 10 units / ml to about 90 units / ml, from about 20 units / ml to about 80 units / ml, from about 30 units / ml to about 70 units / ml, from about 40 units / ml to about 60 units / ml, from about 45 units / ml to about 55 units / ml, from about 45 units / ml to about 50 units / ml, from about 50 units / ml to about 55 units / ml, from about 10 units / ml to about 50 units / ml, from about 15 units / ml to about 40 units / ml, from about 20 units / ml to about 30 units / ml, from about 20 units / ml to about 25 units / ml, from about 25 units / ml to about 30 units / ml, from about 1 to about 15 units / ml, from about 1 to about 10 units / ml, from about 1 to about 5 units / ml, or from about 1 to about 2.5 units / ml. Even more preferably, the concentration of pyrophosphatase may be about 50 units / ml or about 25 units / ml.

[0149] 5'-Cap Structure: A 5' cap is typically a modified nucleotide, particularly a guanine nucleotide, added to the 5' end of an RNA molecule. Preferably, a 5' cap can be added using a 5'-5'-triphosphate linker. The 5' cap can be methylated, for example, as m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap, typically at the 5' end of RNA. Naturally occurring 5' caps can include m7GpppN.

[0150] Other examples of 5' cap structures may include a glycerol group, a reverse deoxygenated debase residue (partial), a 4',5' methylene nucleotide, a 1-(β-D-erythrofuranosyl) nucleotide, a 4'-thionucleotide, a carbocyclic nucleotide, a 1,5-dehydrated hexitol nucleotide, an L-nucleotide, an α-nucleotide, a modified base nucleotide, a threo-pentafuranosyl nucleotide, an acyclic 3',4'-open nucleotide, an acyclic 3,4-dihydroxybutyl nucleotide, an acyclic 3,5-dihydroxypentayl nucleotide, a 3'-3'-reverse nucleotide moiety', a 3'-3'-reverse debase moiety', a 3'-2'-reverse nucleotide moiety, a 3'-2'-reverse debase moiety, 1,4-butanediol phosphate, 3'-phosphoramide, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-thiophosphate, dithiophosphate, or a bridged or non-bridged methylphosphonic acid moiety.

[0151] Particularly preferably, the 5' cap structure can be methylation of the ribose of the adjacent nucleotide of cap 1 (m7G).

[0152] The 5' cap structure can be formed from cap analogues.

[0153] Cap analogs: Cap analogs are non-elongating dinucleotides or trinucleotides with a cap function, meaning that when incorporated into the 5' end of an RNA molecule, they promote translation or localization and / or prevent RNA degradation. Capped mRNAs without a 5' triphosphate structure have reduced immunogenic side effects. Non-elongating means that the cap analog will only be incorporated at the 5' end because it does not have a 5' triphosphate and therefore cannot be elongated in the 3' direction by template-dependent RNA polymerase.

[0154] Cap analogues include, but are not limited to, chemical structures selected from the group consisting of: m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogues (e.g., GpppG); dimethylated cap analogues (e.g., m2,7GpppG), trimethylated cap analogues (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogues (e.g., m7Gpppm7G), or anti-reverse cap analogues (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (Stepinski et al., 2001. RNA 7(10):1486-95, the contents of which are hereby incorporated by reference in their entirety).

[0155] Other cap analogs have been previously described (US Patent Nos. 7,074,596, 8,304,529, 8,153,773, 8,519,110, 9,295,717, and 9,388,420, the contents of which are incorporated herein by reference in their entirety). The synthesis of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs has recently been described (Kore et al., 2013. Bioorg. Med. Chem. 21(15):4570-4).

[0156] Particularly preferred, the cap analogue may be G[5']ppp[5']G, m 7 G[5']ppp[5']G、m3 2,2,7 G[5']ppp[5']G、m2 7,3'-O G[5']ppp[5']G(3'-ARCA),m2 7,2'-O GpppG(2'-ARCA), m2 7,2'-O GppspG D1(β-S-ARCAD1), m2 7,2'-O GppspG D2(β-S-ARCAD2), m 7GpppmAG, m 7 GpppmAmG, m 7 GpppmAmGG, m 7 GpppmA, m 7 mGpppmA, m 7 Gpppm 7 mAG and m 7 mGpppm 7 mAG.

[0157] In some embodiments, the cap analogue may be a cap 0, cap 1, or cap 2 analogue.

[0158] In some embodiments, the cap analogue may include a cap having the following structure [I]:

[0159]

[0160] Preferably, the capping analogue can be added at an initial concentration ranging from about 1 to about 20 mM, about 1 to about 17.5 mM, about 1 to about 15 mM, about 1 to about 12.5 mM, about 1 to about 10 mM, about 1 to about 7.5 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM. Even more preferably, the capping analogue can be added at an initial concentration of about 5 to about 20 mM, about 7.5 to about 20 mM, about 10 to about 20 mM, or about 12.5 to about 20 mM. In some embodiments, the concentration of the cap analogue can be from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to... About 8mM, from about 3mM to about 7mM, from about 3mM to about 6mM, from about 3mM to about 5mM, from about 3mM to about 4mM, from about 4mM to about 10mM, from about 5mM to about 10mM, from about 6mM to about 10mM, from about 6mM to about 9mM, from about 6mM to about 8mM, from about 6mM to about 7mM, from about 7mM to about 10mM, from about 8mM to about 10mM, or from about 9mM to about 10mM.

[0161] In some embodiments, cap analogs can be chemically synthesized using known methods, such as, but not limited to, phosphorylation, oxidation with amidite and nucleosides as starting materials to form dimer fragments, followed by chemical synthesis to prepare GDP imidazolide fragments, and then a final coupling reaction.

[0162] Ribonuclease inhibitors: Ribonuclease inhibitors inhibit the action of ribonucleases that degrade RNA. Preferably, the concentration of the ribonuclease inhibitor in one or more in vitro transcription mixtures described herein can be from about 1 to about 500 units / ml, about 1 to about 400 units / ml, about 1 to about 300 units / ml, about 1 to about 200 units / ml, or about 1 to about 100 units / ml. Even more preferably, the concentration of the ribonuclease inhibitor can be from about 100 to about 300 units / ml, for example, 100 units / ml, 150 units / ml, 200 units / ml, 250 units / ml, or 300 units / ml.

[0163] Antioxidants: Antioxidants inhibit the oxidation of other molecules. Suitable antioxidants used in this disclosure may include, but are not limited to, DTT (dithiothreitol), TCEP (tris(2-carboxyethyl)phosphine), NAC (N-acetylcysteine), β-mercaptoethanol, glutathione, cysteine, and cystine. Preferably, DTT can be used in in vitro transcription reactions.

[0164] In one or more in vitro transcription mixtures described herein, the concentration of the antioxidant (preferably DTT) can be from about 1 to about 50 mM, from about 5 to about 48 mM, from about 8 to about 47 mM, from about 10 to about 46 mM, from about 15 to about 45 mM, from about 18 to about 44 mM, from about 20 to about 43 mM, from about 23 to about 42 mM, from about 25 to about 41 mM, or from about 28 to about 40 mM. Preferably, the concentration can be about 40 mM.

[0165] Amine: Preferably, the amine to be used in this invention is betaine (trimethylglycine). The concentration of the amine (preferably betaine) can be from about 10 mM to about 2 M, preferably from about 0.7 M to about 1.3 M.

[0166] Polyamine: Preferably, the polyamine may be selected from the group consisting of spermine and spermidine. Preferably, the concentration of the polyamine may be from about 1 to about 25 mM, about 1 to about 20 mM, about 1 to about 15 mM, about 1 to about 10 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM. Even more preferably, the concentration of the polyamine may be about 2 mM. Most preferably, it may be spermidine at a concentration of about 2 mM.

[0167] DNase: A DNase is an enzyme that hydrolyzes DNA by catalyzing the hydrolytic cleavage of phosphodiester linkages in the DNA backbone. Suitable DNases can be isolated from bovine pancreas and are available from various suppliers such as Sigma-Aldrich, New England Biolabs, Qiagen, and Thermo Fisher. Preferably, the DNase may not have any RNase activity. In the method disclosed herein, DNase treatment can be performed after the in vitro transcription reaction of RNA by adding the DNase to the reaction mixture for in vitro transcription of RNA. Preferably, an appropriate amount of calcium chloride can be added to the in vitro transcription mixture of RNA together with the DNase. The appropriate amount of CaCl2 can be from about 1 to about 5 mM, preferably from about 2 to about 4 mM, and more preferably it can be about 3 mM. The DNA can be treated with the DNase for about 1 to about 5 hours, preferably from about 1.5 to about 3 hours, and more preferably about 2 hours. The DNase treatment can preferably be performed at a temperature of about 37°C. In one embodiment, about 3 mM CaCl2 and about 200 U / ml DNase I can be added to the in vitro transcription mixture of RNA, and the resulting mixture can be incubated at about 37°C for about two hours. In another embodiment, approximately 3 mM CaCl2 and approximately 400 U / ml DNase I can be added to the RNA in vitro transcription mixture, and the resulting mixture can be incubated at approximately 37°C for approximately two hours. DNase treatment can be stopped by adding EDTA or another chelating agent. Preferably, DNase treatment can be stopped by adding EDTA to a final concentration of approximately 25 mM.

[0168] The embodiments disclosed herein can provide, in a time-efficient manner, combinatorial solutions for the in vitro synthesis of mRNAs of varying sizes, with high capping efficiency, uniform poly-A tails, high yields, and integrity. The range of mRNA sizes is, for example, but not limited to, about 1 Kb–20 Kb, such as 1 Kb–15 Kb or 1 Kb–10 Kb. Embodiments of this disclosure may include designing the T7 promoter sequence in a DNA template to provide high affinity for cap analogs, thereby enabling in vitro transcription of capped mRNA using T7 RNA polymerase. Such DNA template promoter design may include a T7Ф6.5 promoter followed by the sequence GG. This design ensures efficient initiation of transcription to prepare capped mRNAs with high fidelity at the 5' end via a one-step process.

[0169] Capping the 5' end of mRNA

[0170] One of the key factors determining mRNA translation efficiency is its 5' capping. Typically, capping is performed using capping enzymes, and while the efficiency can be high, this process is time-consuming and expensive. Therefore, an efficient co-transcription method is needed that allows for the faster production of more efficient capped mRNAs. Ishikawa M., Ishikawa et al., “Preparation of eukaryotic mRNA having differently methylated adenosine at the 5'-terminus and the effect of the methyl group in translation”, Nucleic Acids Symposium Series, Vol. 53, No. 1, September-October 2009, pp. 129-130, partially addresses this need. Ishikawa demonstrated the use of trinucleotide cap analogs with the structure m7GpppA*pG (where A* is adenosine or a methylated adenosine derivative) for the preparation of capped mRNAs via one-step in vitro transcription. Using these molecules, Ishikawa obtained mRNAs with A, A... m , m6 A or m6 A m Report 5'-capped mRNAs (as the first transcribed nucleotide) were studied, and their translational properties in the rabbit reticulocyte system were investigated. Another study also confirmed co-transcriptional capping of mRNA using cap analogs. Sikorski, PJ et al., 2020, “The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5' cap modulates protein expression in living cells”, Nucleic acids research, 48(4), pp. 1607-1626. Although these methods showed higher transcriptional capping efficiency, the capping efficiency is still about 95%-96% or lower (depending on the cap molecule). Therefore, there is still a need for an efficient co-transcription method that would allow for the production of higher quality capped mRNAs in a more time- and / or cost-effective manner.

[0171] In the embodiments, methods and / or compositions for increasing capping efficiency may be provided. In the embodiments, methods and / or compositions for increasing capping efficiency to greater than about 96%, greater than about 96.5%, greater than about 97%, greater than about 97.5%, greater than about 98%, greater than about 98.5%, greater than about 99%, and greater than about 99.5% may be provided, such capping efficiency as measured by methods such as cutting mRNA with RNase H and subsequently measuring the capping efficiency with LC-MS.

[0172] In embodiments, the cap analogue can initiate in vitro transcription to synthesize capped mRNA in a one-pot reaction. In embodiments, the first methyl group (-A) following the inverted G cap can bind to the -1 position of the DNA template, and the second G base can bind to the +1 position of the DNA template, forming a complex with RNA polymerase to recruit the next ribonucleoside triphosphate (NTP), thereby elongating the RNA during transcription. For example, as... Figure 10A As shown, when using a cap [I] in IVT m7 G 5 pppA 2'-Ome At the G) stage, the first base methyl-A after the reverse G cap binds to the -1 position of the DNA template, and the second base G binds to the +1 position of the DNA template, forming a complex with T7 RNA polymerase to recruit the next NTP, thereby elongating the RNA during transcription.

[0173] In the embodiments, compositions comprising one or more cap analogues as described herein are provided. In the embodiments, methods of using one or more cap analogues as described herein are provided. In the embodiments, the cap analogues as described herein can be used in combination with the compositions and / or methods described herein and / or with conventional compositions and / or methods. In the embodiments, the methods and / or compositions described herein can increase mRNA capping efficiency to greater than about 96%, greater than about 96.5%, greater than about 97%, greater than about 97.5%, greater than about 98%, greater than about 98.5%, greater than about 99%, greater than about 99.5%, or up to about 100%.

[0174] promoter

[0175] The promoter design in the DNA template can be important for DNA-dependent RNA polymerase initiation of in vitro transcription. In embodiments where T7 RNA polymerase (a single-subunit polymerase derived from T7 bacteriophage) can be used, the DNA template promoter design may include a T7Ф6.5 promoter followed by the sequence GG, GA, or AGG. In these embodiments, this design enables efficient initiation of transcription to produce high-fidelity mRNA at the 5' end in a one-step process.

[0176] In an embodiment, the promoter may have the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein X1 is A or G, X2 is A or G, and X3 is A, T, G, or C.

[0177] In embodiments where T7 RNA polymerase can be used, at least one promoter sequence from Table 1 can be used to initiate in vitro transcription. The promoter can be added to the plasmid vector via gene synthesis or subcloning.

[0178] Table 1

[0179] <![CDATA[ SEQ ID NO ]]> <![CDATA[ sequence ]]> 10 TAATACGACTCACTATAGGG 11 TAATACGACTCACTATAGG 12 TAATACGACTCACTATAAGG 13 TAATACGACTCACTATAGAT 14 TAATACGACTCACTATAGA 15 TAATACGACTCACTATTAGG

[0180] In the embodiments, at least one of SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15 can be used to initiate in vitro transcription.

[0181] In embodiments, compositions comprising one or more promoters as described herein are provided. In embodiments, vectors comprising one or more promoters as described herein are provided. In embodiments, methods of using one or more promoters as described herein are provided. In embodiments, compositions comprising mRNA comprising one or more promoters as described herein are provided. In embodiments, vectors comprising mRNA comprising one or more promoters as described herein are provided. In embodiments, methods of using mRNA comprising one or more promoters as described herein are provided.

[0182] In some embodiments, in vitro transcription can begin at the -1 position, which can facilitate the formation of a more favorable complex with T7 RNA polymerase, resulting in RNA of greater length. The use of both the -1 and +1 positions of the start site for in vitro transcription allows for greater flexibility in selecting the first mRNA base (excluding the cap base) and keeps the +2 position open for custom sequences as described in Table 1 for mRNA production. Current common practice for incorporating cap molecules during in vitro transcription uses the +1 position to initiate mRNA synthesis, which requires the template to have an exact sequence of AG or AT following the T7 promoter TATA box sequence. Embodiments disclosed herein may include methods for co-transcriptionalizing cap 1 mRNA using a DNA template with a conventional T7 promoter sequence (which has GG following the T7 promoter TATA box) without requiring specific mutagenesis of the DNA template.

[0183] In some embodiments, a method for in vitro transcription of a DNA template into RNA may include providing (1) a DNA template containing a promoter operatively linked to a nucleic acid having a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a polyA region, and (2) a cap analog having the following structure:

[0184]

[0185] R1 and R2 can each be CH3 or H; and B1 and B2 can each be A, U, G, or C.

[0186] The promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO:16).

[0187] In this context, A at position 17 is a -1 nucleotide and X1 at position 18 is a +1 nucleotide.

[0188] When X1 is G, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is G. When X1 is A, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is A.

[0189] When X1 is C, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is C, and

[0190] When X1 is T, and X2 and X3 are A, T, G, or C respectively, then B1 is A and B2 is U.

[0191] The cap analog binds to the -1 and +1 nucleotides of the promoter, and the DNA template and the cap analog are incubated in a reaction mixture, wherein the incubation may include incubating the reaction mixture from about 15°C to about 35°C for about 1 hour to about 12 hours to produce RNA.

[0192] The promoter may contain a sequence selected from SEQ ID NO:10, 11, 13 and 14.

[0193] In some embodiments, a method for in vitro transcription of a DNA template into RNA may include providing (1) a DNA template comprising a promoter operatively linked to a nucleic acid containing a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a polyA region, and (2) a cap analogue, wherein the cap analogue binds to -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analogue in a reaction mixture, wherein the incubation may include incubating the reaction mixture at a temperature from about 15°C to about 35°C, preferably from about 18°C ​​to about 31°C, for an appropriate time, preferably from about 1 hour to about 12 hours, thereby producing RNA.

[0194] In some embodiments, a method for in vitro transcription of a DNA template into RNA may include providing (1) a DNA template containing a promoter operatively linked to a nucleic acid having a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a polyA region, and (2) a cap analogue, wherein the cap analogue binds to -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analogue in a reaction mixture to produce RNA.

[0195] In some embodiments, the reaction mixture comprises NTP and RNA polymerase. In some embodiments, the reaction mixture may further comprise one or more of the following: a buffer substance, an RNase inhibitor, a magnesium salt, a polyamine, and a pyrophosphatase.

[0196] In some embodiments, the reaction mixture comprises: a buffer substance at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl.

[0197] 5'UTR and 3'UTR

[0198] The flanking regions of an mRNA molecule can have 5' and 3' untranslated regions (UTRs). The 5' UTR can be recognized by ribosomes to allow the initiation of translation, and the 3' UTR can contain regulatory sequences that can affect mRNA expression and half-life. When mRNA is expressed in mammalian cells, several different combinations of 5' and 3' UTRs can achieve high mRNA expression efficiency.

[0199] Cao et al. (Cao et al., “High-throughput 5'UTR engineering for enhanced protein production in non-viral gene therapies”, Nature Communications, (2021) 12: 4138, pp. 1-10, incorporated herein by reference in its entirety) reported a method for generating artificial 5'UTRs through a high-throughput screening process.

[0200] In the embodiments, a combination of an artificially selected 5' UTR and a human hemoglobin or mouse hemoglobin 3' UTR can be used to generate constructs for efficient expression of mRNA sequences. This combination can be selected and used to construct vectors for in vitro transcription (IVT). This combination can be used to generate mRNA with high protein expression capabilities. In the embodiments, one or more UTRs listed in Table 5 are used (see Example 1 below). In the embodiments, one or more UTRs listed in Table 5 can be used in any combination. In the embodiments, UTRs can be used in pairs, as shown in Table 5, where paired members are in the same row. In the embodiments, SEQ ID NO:1 is paired with SEQ ID NO:2, SEQ ID NO:3 with SEQ ID NO:2, SEQ ID NO:1 with SEQ ID NO:4, SEQ ID NO:1 with SEQ ID NO:6, SEQ ID NO:3 with SEQ ID NO:6, and / or SEQ ID NO:9 with SEQ ID NO:2. In the embodiments, using one or more UTRs listed in Table 5 can achieve high expression efficiency of mRNA in mammalian cells. In the embodiments, using one or more pairs of UTRs listed in Table 5 can achieve high expression efficiency of mRNA in mammalian cells.

[0201] In embodiments, the natural 5'UTR (e.g., SEQ ID NO: 53-69 (Table 13)) can be modified to produce a mutant 5'UTR (e.g., SEQ ID NO: 23-52 (Table 14)). Combinations of mutant 5'UTRs and 3'UTRs (e.g., SEQ ID NO: 2, 4, 6, 8, and 71) can be used to generate constructs for efficient expression of mRNA sequences. Such combinations can be selected and used to construct vectors for in vitro transcription (IVT). This combination can be used to generate mRNAs with high protein expression capabilities.

[0202] In the embodiments, the nucleic acid disclosed herein may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO:1-71.

[0203] In the embodiments, the nucleic acid disclosed herein may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequences of SEQ ID NO:1-9.

[0204] In the embodiments, the nucleic acid disclosed herein may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO:23-52.

[0205] In the embodiments, the nucleic acid disclosed herein may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO:53-69.

[0206] In embodiments, the T7 promoter sequence and UTR can be added to an open reading frame coding sequence via gene synthesis, and then subcloned into a plasmid vector to generate large-scale plasmid DNA for in vitro transcription applications. Compositions comprising one or more UTRs as described herein are provided. In embodiments, vectors comprising one or more UTRs as described herein are provided. In embodiments, methods for using one or more UTRs as described herein are provided. In embodiments, compositions comprising mRNA containing one or more UTRs as described herein are provided. In embodiments, vectors comprising mRNA containing one or more UTRs as described herein are provided. In embodiments, methods for using mRNA containing one or more UTRs as described herein are provided.

[0207] A-tail

[0208] The quality of the poly(A) tail (such as its length and the uniformity of its length and distribution) can directly affect mRNA expression efficiency. Conventional methods for adding poly(A) tails to mRNA products in vitro use poly(A) polymerases. See, for example, Cao, GJ and Sarkar, N., “Identification of the gene for an Escherichia coli poly(A) polymerase”, Proc. Natl. Acad. Sci. USA, (1992) 89(21), 10380-10384, which is incorporated herein by reference in its entirety. However, such methods typically produce products with a wide distribution of poly(A) tail lengths, where only about 70% of the mRNA is tailed.

[0209] Besides capping and the length and distribution of poly-A tails, mRNA purity and integrity are likely important factors affecting mRNA properties (e.g., but not limited to its stability and / or expression efficiency). Purification, promoter sequence, one or more 5' and / or 3' UTR sequences, and / or transcription conditions can contribute to the production of high-quality mRNA.

[0210] Conventional methods for adding poly-A tails to mRNA products in vitro use poly-A polymerases, such as those described, for example, by Cao et al. (Proc. Natl. Acad. Sci. USA. 89, 10380-10384). However, this method can produce poly-A products with a wide distribution of poly-A tail lengths, for example, where only about 70% of the mRNA is polyadenylated. The embodiments disclosed herein include methods for efficiently adding poly-A tails to DNA templates via polymerase chain reaction (PCR). Therefore, these methods will provide the benefit of engineering template tails through a single-step PCR reaction, rather than undergoing the traditional lengthy cloning and plasmid purification steps, in order to produce more uniform poly-A tail products for efficient mRNA expression. The embodiments disclosed herein can also provide poly-A tails that are longer than those produced by some conventional methods.

[0211] In the embodiments, the methods and / or compositions may include methods for providing capping analogs, providing and / or improving the length and / or distribution of poly-A tails, providing an effective promoter, providing an effective UTR (such as UTR pairs), providing effective transcription conditions, providing an effective transcription system, providing effective purification, or any combination thereof.

[0212] In embodiments, methods and / or compositions may be provided to increase the uniformity of the length and / or distribution of poly-A tails in transcribed mRNA molecules. In embodiments, the methods and / or compositions may produce a population of mRNAs wherein greater than about 70% are polytailed, wherein at least about 71% are polytailed, wherein at least about 72% are polytailed, wherein at least about 73% are polytailed, wherein at least about 74% are polytailed, wherein at least about 75% are polytailed, wherein at least about 76% are polytailed, wherein at least about 77% are polytailed, wherein at least about 78% are polytailed, wherein at least about 79% are polytailed, wherein at least about 80% are polytailed, wherein at least about 85% are polytailed, wherein at least about 90% are polytailed, wherein at least about 95% are polytailed, and wherein at least about 99% are polytailed.

[0213] In the embodiments, the method and / or composition can generate a population of mRNAs wherein the length of the poly-A tail (number of adenines) varies among mRNA molecules by up to about 70 to about 130 adenines, among mRNA molecules by up to about 60 to about 120 adenines, among mRNA molecules by up to about 50 to about 100 adenines, among mRNA molecules by up to about 40 to about 90 adenines, among mRNA molecules by up to about 50 to about 80 adenines, among mRNA molecules by up to about 40 to about 70 adenines, among mRNA molecules by up to about 30 to about 50 adenines, or among mRNA molecules by up to about 20 to about 40 adenines. The poly-A tail length of the mRNA can be measured by digesting the mRNA with RNase T1, followed by purification and recovery of the poly-A fragment with oligodT magnetic beads, and then detection of the poly-A fragment length by capillary gel electrophoresis using a bioanalyzer.

[0214] In this embodiment, a poly-A tail is added to the DNA template prior to transcription. In this embodiment, a method for adding a poly-A tail to the DNA template prior to transcription can be provided. In this embodiment, adding the poly-A tail to the DNA template via polymerase chain reaction (PCR) is a novel method for adding a poly-A tail compared to conventional methods of insertion into plasmid vectors via gene synthesis. In this embodiment, adding a poly-A tail to the DNA template can result in a more uniform poly-A tail mRNA product, a product with a longer poly-A tail, or both, each or both of which can lead to more efficient mRNA expression.

[0215] In embodiments, compositions comprising mRNA containing a poly-A tail as described herein, added by PCR are provided. In embodiments, vectors containing a poly-A tail as described herein are provided, the poly-A tail being added to the vector by PCR. In embodiments, pVAX1 or pUC57 vectors are provided, comprising an ampicillin resistance gene, a T7 promoter sequence, 5'UTR and 3'UTR sequences, and mRNA containing a poly-A tail (e.g., 100A) as described herein, added by PCR are provided. In embodiments, methods of using mRNA containing a poly-A tail as described herein, added by PCR are provided.

[0216] In the embodiments, the disclosed methods and / or compositions can generate a population of mRNAs wherein more than about 70% are tailed, wherein at least about 71% are tailed, wherein at least about 72% are tailed, wherein at least about 73% are tailed, wherein at least about 74% are tailed, wherein at least about 75% are tailed, wherein at least about 76% are tailed, wherein at least about 77% are tailed, wherein at least about 78% are tailed, wherein at least about 79% are tailed, wherein at least about 80% are tailed, wherein at least about 85% are tailed, wherein at least about 90% are tailed, wherein at least about 95% are tailed, wherein at least about 99% are tailed, and wherein about 100% are tailed.

[0217] In the embodiments, the disclosed methods and / or compositions can generate a population of mRNAs wherein the length of the poly-A tail (number of adenines) varies among mRNA molecules by up to about 70 to about 130 adenines, up to about 60 to about 120 adenines, up to about 50 to about 100 adenines, up to about 40 to about 90 adenines, up to about 50 to about 80 adenines, up to about 40 to about 70 adenines, up to about 30 to about 50 adenines, or up to about 20 to about 40 adenines.

[0218] Bacterial studies have demonstrated that repetitive sequences (e.g., CTG, CAG) and the patterns and levels of plasmid replication and transcription can play a role in the amplification and deletion of repetitive sequences. Following induction of the lacZ promoter, the deletion frequency of cloned repetitive sequences can increase by up to 20-fold, and this lacZ promoter drives transcription of the inserted sequence in pUC19 (Bowater et al., 1997. Transcription increases the deletion frequency of long CTG·CAG tripletrepeats from plasmids in Escherichia coli. Nucleic Acids Res 25:2861-2868; its contents are hereby incorporated in their entirety by reference). Common vectors can typically maintain high copy numbers and can induce transcription and translation of antibiotic resistance genes, indicator genes (such as blue / white selection genes), and inserts, thus causing instability in certain classes of DNA sequences. As extremely repetitive sequences and sequences with very low GC ratios, poly-A sequences can be easily lost during plasmid cloning and replication. If such sequences are present, unintended transcription and translation influenced by the inductive activity of upstream and downstream promoters may further increase the instability of poly-A sequences. To avoid promoter-like initiation activity in vectors targeting the inserted sequence, common strategies may include fragmenting the inserted gene (if the inserted gene is significantly cytotoxic) or directional cloning the ORF relative to the “reverse” direction of transcription from the vector’s promoter. However, neither of these strategies may be suitable for cloning genes containing poly-A sequences. Fragmentation can eliminate genotoxicity of the cloned gene after expression, but this strategy may not address the instability of poly-A sequences because transcription has not been eliminated, and reverse insertion only eliminates the promoter’s influence in one direction. Therefore, embodiments disclosed herein may include modifying the vector by inserting transcription terminators upstream and downstream of the multiple cloning site, which effectively interrupts the influence of upstream and downstream promoters on the inserted gene. This strategy effectively improves the stability of poly-A sequences during plasmid cloning and replication, especially for some highly unstable poly-A-containing cassettes. The results showed that after adding transcription terminators upstream and downstream of the multiple cloning site, the positive rate of clones reached 25%-50% (almost 0 before the addition of terminators), and the number of A bases in the poly-A tail increased from 70-110 to about 120. In addition, the plasmid yield also increased by 32.5% after adding terminators upstream and downstream of the inserted cassette.Without being limited to any particular theory, this increase may be due to the insertion of transcription terminators restoring the activity of the replication origin (Stueber et al., 1982. Transcription from efficient promoters can interfere with plasmid replication and diminish expression of plasmid-specified genes. EMBO J 1:1399-1404; the contents of which are hereby incorporated in their entirety by reference). The use of transcription terminators upstream and downstream of multiple cloning sites to promote the cloning of cytotoxic or repetitive sequences (such as poly-A tails) has not been reported in the art.

[0219] Transcription termination sequences can be any nucleotide sequence that, when transcribed downstream of a nucleotide sequence encoding an open reading frame, causes transcriptional termination of the open reading frame. Such sequences are known in the art and can be of prokaryotic, eukaryotic, or phage origin. Examples of termination sequences include, but are not limited to, the PTH terminator, the pET-T7 terminator, etc. Termination sequences include pBR322-P4 terminator, vesicular stomatitis virus terminator, rrnB-T1 terminator, rrnB-T2 terminator, λt0 terminator, rrnC terminator, Ttadc transcription terminator, and yeast-recognized termination sequences (such as Matα (α factor) transcription terminator, natural α factor transcription termination sequence, ADR1 transcription termination sequence, ADH2 transcription termination sequence, and GAPD transcription termination sequence). A non-exhaustive list of transcription terminator sequences can be found in the iGEM registry at partsregistry.org / Terminators / Catalog. A series of 2, 3, 4, 5, 6, 7 or more first transcription terminator sequences may be placed directly at the 3' end of the final nucleotide of the target gene (or open reading frame), or at a distance of at least 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-1,000 or more nucleotides from the 3' end of the final nucleotide of the target gene (or open reading frame). The number of nucleotides between tandem transcription terminator sequences can vary; for example, transcription terminator sequences can be separated by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or more nucleotides.

[0220] carrier

[0221] In embodiments, vectors are provided that comprise one or more of the following: (i) a poly-A tail as described herein, (ii) one or more UTRs as described herein, (iii) one or more promoters as described herein, or (iv) combinations thereof. In embodiments, the vectors may have various uses, including but not limited to insertion of a target template nucleotide sequence. In embodiments, such vectors having a target template nucleotide sequence may be used (as a non-limiting example) to clone or transcribe the target template nucleotide sequence. In embodiments, transcription may include in vitro transcription. In embodiments, transcription may be performed using T7 RNA polymerase. In embodiments, the vector may be a plasmid or viral vector, such as, but not limited to, pVAX1 and / or pUC57.

[0222] mRNA purity

[0223] mRNA integrity can affect cellular expression; therefore, initiating translation with highly intact mRNA may be important. The conditions used for transcription can influence the quality of the resulting mRNA. Some transcriptional conditions can lead to higher truncation rates.

[0224] mRNA integrity is likely one of the key factors influencing cellular expression, so starting with highly intact mRNA may be crucial. mRNA integrity has two aspects. Typically, RNA tends to degrade faster than DNA due to its chemical instability, so storage conditions affect RNA quality. Additionally, transcription conditions can also lead to higher truncation, so optimal buffering conditions can be empirically determined to achieve higher integrity and also higher yield across a wide range of mRNA sizes.

[0225] The conditions used for purification can affect the quality of the resulting mRNA. For example, the presence of trinucleotide cap analogs in the final mRNA product. m7 GpppA * pG residues can compete with capped mRNA for ribosome recruitment, thereby inhibiting mRNA translation efficiency in cells. Purification after in vitro transcription is likely a crucial step in obtaining the final purified mRNA product.

[0226] This disclosure further provides a solution for obtaining pure mRNA products with minimal contaminant cap analogs, free NTPs, and other proteins that can interfere with and impair the performance of the mRNA product. mRNA purity refers to the ratio of full-length mRNA species in the crude transcribed mRNA product, which can be quantified by the ratio of full-length peaks in capillary gel electrophoresis.

[0227] In the embodiments, purification as described herein can produce high-purity mRNA products with minimal contaminant analogs, free NTPs, and / or other proteins that may interfere with and / or impair the stability and / or translation efficiency of the mRNA product. In the embodiments, the purification method includes binding nucleic acids using a silica membrane column, followed by washing with about 60% to about 80% ethanol in water, preferably about 70% to about 80% ethanol in water, and then eluting in water.

[0228] Other conventional purification methods, such as LiCl precipitation or affinity-based magnetic bead purification, can be applied to the same purpose. In the examples, the purification methods described herein can be used in combination with the compositions and / or methods described herein and / or with conventional compositions and / or methods.

[0229] In the embodiments, methods and / or compositions for increasing the purity of transcribed mRNA may be provided. In the embodiments, methods and / or compositions for producing mRNA with the following purity levels may be provided: mRNA obtained at approximately 79% or greater purity; mRNA with approximately 79.5% or greater purity; mRNA with approximately 80% or greater purity; mRNA with approximately 80.5% or greater purity; mRNA with approximately 81% or greater purity; mRNA with approximately 81.5% or greater purity; mRNA with approximately 82% or greater purity; mRNA with approximately 82.5% or greater purity; mRNA with approximately 83% or greater purity; mRNA with approximately 83.5% or greater purity; mRNA with approximately 84% or greater purity; mRNA with approximately 84.5% or greater purity; mRNA with approximately 85% or greater purity; mRNA with approximately 85.5% or greater purity; mRNA with approximately 86% or greater purity; mRNA with approximately 86% or greater purity; mRNA with approximately 86% or greater purity. mRNA with approximately 0.5% or greater purity; approximately 87% or greater purity; approximately 87.5% or greater purity; approximately 88% or greater purity; approximately 88.5% or greater purity; approximately 89% or greater purity; approximately 89.5% or greater purity; approximately 90% or greater purity; approximately 91% or greater purity; approximately 92% or greater purity; approximately 93% or greater purity; approximately 94% or greater purity; approximately 95% or greater purity; approximately 96% or greater purity; approximately 97% or greater purity; approximately 98% or greater purity; approximately 99% or greater purity; or approximately 100% purity. mRNA purity can be measured using capillary gel electrophoresis with a bioanalytical instrument, and the target peak area ratio (target length ± 15%) can be calculated based on its purity measurement.

[0230] In the embodiments, methods and / or compositions may be provided to increase the purity or integrity of transcribed mRNA. Obtaining high-quality long mRNA from in vitro transcription is a significant challenge because long mRNA tends to degrade more easily. This invention has found that temperature and the duration of the in vitro transcription reaction are key factors affecting the quality of the resulting long mRNA. Figure 11A As shown, in vitro transcription at 25°C for 2.5 hours produced a 10kb mRNA product with a purity of approximately 57%, as determined by a bioanalyzer, while the same IVT reaction at 31°C for 2.5 hours produced a 10kb mRNA product with a purity of approximately 2%, because most of the mRNA product was truncated. Figure 11B The yield and purity of mRNA produced by IVT reactions at temperatures of 18℃, 21℃, 25℃, and 31℃ were investigated, and the results for mRNA purity and yield are shown in [data missing]. Figure 11C and Figure 11D At temperatures as low as 18°C, long mRNAs can be transcribed using the disclosed method with T7 polymerase.

[0231] T7 RNA polymerase-mediated transcription

[0232] In eukaryotes, transcription of messenger RNA (mRNA) is accomplished by RNA polymerase II. This is a complex multi-subunit enzyme under complex regulation. For large-scale in vitro transcription, researchers typically use single-subunit phage polymerases derived from T7, T3, SP6, K1-5, K1E, K1F, or K11 phages. This family of polymerases uses a simple, minimal promoter sequence of about 17 nucleotides, which may not require accessory proteins and may have minimal restrictions on the starting nucleotide sequence. While this application focuses on T7 RNA polymerase (T7 RNAP), those skilled in the art will understand that this disclosure can be practiced with other RNA polymerases.

[0233] T7 RNA polymerase (RNAP) exists in at least two protein states. The first is called the "abortive complex" and is likely involved in transcription initiation. The second is in a very continuous conformation and is called the "elongation complex." In vitro transcription can be divided into six steps: 1) binding of RNA polymerase to the promoter sequence, 2) initiation of transcription, 3) non-continuous elongation called abortive transcription, during which the polymerase frequently releases the DNA template and short abortive transcripts, 4) conversion of the open complex to the closed complex, 5) continuous elongation, and 6) termination of transcription. The large amount of RNA produced during transcription may contain short, abortive fragments of about 2-8 nucleotides in length (Biochemistry 19:3245-3253 (1980); Nucleic Acids Res.9:31-45 (1981); Nucleic Acids Res.15:8783-8798 (1987); Biochemistry 27:3966-3974 (1988), each of which is incorporated herein by reference in its entirety). After synthesizing approximately 10-14 bases, the RNA polymerase may escape from the abortive cycle, losing sequence-specific contact with the promoter DNA and forming a continuous elongation complex in which the RNA chain can elongate in a sequence-independent manner (J.Mol.Biol.183:165-177(1985); Proc.Natl.Acad.Sci.USA83:3614-3618(1986); Mol.Cell Biol.7:3371-3379(1987), each of which is incorporated herein by reference in its entirety).

[0234] Table 2

[0235]

[0236] The common sequence of the most active class III T7 promoters can cover 17 bp upstream and 6 bp downstream of the transcription start site (Cell 16:815-25. (1979), incorporated herein by reference in its entirety). The position of the first transcribed nucleotide is generally referred to as the +1 transcript nucleotide of RNA, the second transcribed nucleotide as the +2 transcript nucleotide, and so on (Table 2). During transcription, the two strands can be melted to form a transcription bubble, and the bottom strand of the duplex (shown as 3' to 5' in Table 2) is the template for transcription. For transcript nucleotides +3 and above, the identity of the transcribed nucleotides can be defined primarily by Watson-Crick base pairing interactions. Here, the nucleotide encoding the first RNA transcript nucleotide is defined as the +1 template nucleotide. In the examples shown in Table 2, the +1 transcript nucleotide is G, and the +1 template nucleotide is C. Similarly, the +4 transcript nucleotide is A, and the +4 template nucleotide is T.

[0237] It is known that T7 RNAP can also be initiated with short oligonucleotide primers. For example, 13 promoters in the T7 genome are known to be initiated with pppGpG (J.Mol.Biol.370:256-268 (2007), incorporated herein by reference in its entirety). It has been shown that T7 RNAP can be initiated with dinucleotide primers (Biochemistry24:5716-5723 (1985), incorporated herein by reference in its entirety). Axelrod et al. showed that uncapped GpA dinucleotides can be initiated with +1 and +2 template nucleotides (“CT” templates) of 2'-deoxycytidine and 2'-deoxythymidine, respectively. The reaction conditions were 200 μM dimer and 100 μM ATP, CTP, GTP, and UTP. The reaction conditions also included 100 μM 3'dATP, 3'dCTP, 3'dUTP, or 50 μM 3'dGTP. Only GpA-initiated RNA was observed, and no mixture of GpA-initiated RNA and GTP-initiated 5' triphosphate RNA was observed. This is likely due to the reaction conditions used. 100 μM GTP is much lower than the 2 mM Kd T7 polymerase for the first initiating guanosine (J. Mol. Biol. (2007) 370, 256-268, incorporated herein by reference in its entirety). Since GTP competes with the initiating oligonucleotide for initiation, using a low GTP concentration favors GpA initiation but may result in low transcription yields (estimated maximum calculated yield <150 μg / mL reaction). When transcription was initiated on a "CT" template with ApG, CpG, UpG, or GpG, the formation of RNA transcripts with additional non-templated 5' nucleotides (A, C, U, or G, respectively) was observed.

[0238] Ishikawa et al. showed the structurem7 GpppApG, m7 Gppp m6 ApG, m7 GpppA 2'Ome pG or m7 Gppp m6 A 2'Ome The capped initiation oligonucleotide trimer of pG can initiate transcription on the template using 2'-deoxycytidine residues at positions +1 and +2 (“CC” template; Nucleic Acids Symposium Series 53:129 (2009), incorporated herein by reference in its entirety). The authors note that, “compared to using…” m7 The different results in the case of G5'pppG may be due to... m7 The additional adenosine (N1) in G5'pppN1pG is caused by the base pairing between the adenosine (N1) and the 2'-deoxythymidine at the -1 position in the T7 promoter. This method differs significantly from the method described in this disclosure, where the +1 and +2 nucleotides of the initiating capped oligonucleotide trimer pair with the +1 and +2 nucleotides of the template nucleotide. Ishikawa et al. used 6 mM of initiating oligonucleotide trimer, 0.9 mM GTP, and 7.5 mM each of ATP, CTP, and UTP. The authors used a six-fold excess of the capped initiating oligonucleotide primer (the most expensive nucleotide component in the transcription reaction) beyond the competitive GTP to drive the transcription reaction toward capped RNA instead of pppRNA, which increased the overall cost of RNA synthesis. On the other hand, the low concentration of GTP (0.9 mM) limited the total RNA yield in the transcription reaction (theoretically less than 1.4 mg / mL). In contrast, the method described herein may not require limiting the concentration of any NTP to achieve efficient RNA capping and higher RNA yields (approximately 2 to 10 mg / mL), thus allowing the production of high-quality mRNA at a commercially viable cost.

[0239] T7 RNA polymerase

[0240] In some embodiments, at least one modification of the T7 RNA polymerase may be selected from the group consisting of: P266L, P270L, P270S, P270A, P270Y, Q744L, Q744P, Q744R, Y639F, H784A, E593G, Y639V, V685A, H784G, S430P, N433T, S633P, F849I, and F880Y. In some embodiments, at least one modification includes Y639F and H784A. In some embodiments, at least one modification includes E593G, Y639V, V685A, and H784G. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, and F880Y. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, F880Y, and P266L. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, F880Y, Y639F, and H784A. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, F880Y, P266L, Y639F, and H784A. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, F880Y, E593G, Y639V, V685A, and H784G. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, F880Y, P266L, E593G, Y639V, V685A, and H784G.

[0241] In some embodiments, at least one modification of the T7 RNA polymerase promotes the initiation-elongation transition. In some embodiments, at least one modification increases promoter clearance. In some embodiments, at least one modification increases the stability and / or activity of the polymerase. In some embodiments, at least one modification increases the thermostability of the polymerase. In some embodiments, at least one modification produces 2'-Ome incorporation.

[0242] Magnesium ions in in vitro transcription

[0243] Magnesium ions (Mg 2+ Mg2+ is an essential component in RNA in vitro transcription buffer systems, used to initiate transcription using cap analogs instead of GTP. Conventional buffer systems for RNA in vitro transcription (e.g., HEPES buffer, Tris-HCl buffer) may contain high concentrations of free magnesium ions because free magnesium may be required. 2+ Ions are used to ensure high activity of RNA polymerase. 2+It recombines with NTPs during the reaction, maintaining a state of no additional free Mg. 2+ The presence of ions in the buffer system is important for ensuring high capping efficiency and high integrity of transcribed mRNA. Therefore, a higher concentration of Mg... 2+ This can cause problems, especially in high-yield / industrial-scale RNA production. In RNA production, it can be problematic with free Mg. 2 + Some ion-related issues may include magnesium-driven precipitates, which could lead to the release of free Mg. 2+ The decrease in Mg concentration leads to the consumption of magnesium ions from the RNA polymerase reaction center. The result will be lower efficiency of in vitro RNA transcription. To assess the effect of Mg concentration on mRNA IVT yield and integrity, IVT was performed in the presence of increased Mg concentrations. By maintaining the final Mg concentration in the IVT reaction at 16.5 mM, 21 mM, 29 mM, and 37 mM, respectively, the free Mg in the IVT reaction system after complexation with NTPs and cap analogues was reduced. 2+ The concentrations were -12 mM, -8 mM, 0 mM, and +8 mM, respectively. In the IVT system, when Mg... 2+ As concentration increases, mRNA production decreases. Figure 12A ), and when Mg 2+ As the concentration increases, mRNA integrity also decreases. Figure 12B ).

[0244] Example

[0245] Example 1

[0246] Construction of DNA template

[0247] Encoding poly-A tails in DNA templates

[0248] Poly-A tails can be encoded in a DNA template using appropriate tailed PCR primers. Forward primers and reverse primers comprising poly-T sequence oligonucleotides are synthesized using methods known in the art. The primers used herein are synthesized via solid-phase oligonucleotide synthesis (e.g., but not limited to solid-phase chemistry) and then assembled in a PCR reaction using reverse primers containing poly-T sequences.

[0249] Forward primer: GCTTAGGAAATTAATACGACTCACTATAAGG (SEQ ID NO:17)

[0250] Reverse primer: tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt ttttttgccgcccactcagactttattc(SEQ ID NO:18)

[0251] The reaction mixture is described in Table 3 below.

[0252] Table 3

[0253]

[0254]

[0255] DNA templates containing the T7 promoter (SEQ ID NO:10), 5'UTR (SEQ ID NO:9), Kozak sequence (GCCACC), eGFP coding sequence, and 5'UTR (SEQ ID NO:2) were subcloned into the pVAX vector. Poly-A tails were added to the DNA templates encoding enhanced green fluorescent protein (eGFP) using (i) reverse primers (SEQ ID NO:18) with different T lengths. The lengths of the resulting DNA templates with 100, 80, 60, and 40 A tails were confirmed by testing with a DNA bioanalyzer (Agilent DNA 7500 kit) (Figure 1).

[0256] Table 4

[0257]

[0258] KAPA = KAPAHiFi HotStart DNA Polymerase

[0259] Super Fi2 = Invitrogen Platinum SuperFi II DNA polymerase

[0260] NA = Unavailable

[0261] Reactions #1-#3 performed using conventional PCR methods (Table 4) failed to add a poly-A tail and produced a DNA product of 969 bp in length. In contrast, Figure 1A The method disclosed herein produces DNA with an average length of 1086 bp and a purity of approximately 90% with a 100A tail. Figure 1B The PCR products of over 90% of the eGFP templates showed a 100A tail with an average length of 1086 bp.

[0262] The 5'UTR and 3'UTR were cloned into the DNA template.

[0263] During gene synthesis, different UTRs were cloned into a vector containing an eGFP target DNA template. A gene fragment containing the T7 promoter (SEQ ID NO:10), 5' UTR (SEQ ID NO:9), Kozak sequence (GCCACC), eGFP coding sequence, and 3' UTR (SEQ ID NO:2) was prepared via gene synthesis and then subcloned into the vector pVAX to generate plasmids for mRNA preparation. The 5' UTR and 3' UTR pairs are shown in Table 5.

[0264] Table 5

[0265]

[0266]

[0267] The plasmid was linearized using restriction enzymes and then purified to prepare a linear plasmid for in vitro transcription, thereby preparing mRNA. mRNA was prepared using the aforementioned co-transcription method with a cap [I], followed by purification via silica membrane column. mRNA quality was tested using an Agilent RNA Nano 6000 bioanalyzer kit. Figure 2A ).

[0268] The expression efficiency of eGFP mRNA with different UTRs in A549 cells was tested. 1 μg of mRNA was transfected into each well of a 96-well plate of A549 cells using Lipofectamine 2000, in triplicate. eGFP expression levels were measured by fluorescence intensity using a plate reader, and the results were analyzed using CyQUANT. TM The cell count measured in the XTT cell viability assay is normalized. Figure 2B The expression levels of mRNAs with different UTR combinations were shown. The UTR combinations in mRNAs #4 (SEQ ID NO:3 and 2), #5 (SEQ ID NO:5 and 8), #6 (SEQ ID NO:1 and 6), and #8 (SEQ ID NO:9 and 2) produced higher EGFP expression levels than others (e.g., #1 (SEQ ID NO:1 and 2), #2 (SEQ ID NO:1 and 4), #3 (SEQ ID NO:1 and 8), and #7 (SEQ ID NO:7 and 4)).

[0269] Example 2

[0270] Construction of DNA template

[0271] Encoding poly-A tails in DNA templates

[0272] High-purity poly-A tails can be encoded in DNA templates by using appropriately chemically modified tailed PCR primers coupled with T7 exonuclease digestion. Phosphate-modified forward primers and reverse primers containing poly-T sequence oligonucleotides are synthesized via solid-phase chemistry using modified phosphorous acid. PCR reactions are assembled using the modified primers to generate DNA templates for in vitro transcription. The PCR products are further digested with T7 exonuclease (NEB) to remove any truncated DNA products, resulting in a high-purity template for downstream mRNA preparation.

[0273] Forward primer: C*A*C*TGCTTACTGGCTTATCGAAATTAATACGACT CACTATA*G*G*A(SEQ IDNO:19)

[0274] Reverse primer: T*mU*T*[T] 96 TGCCGCCCACTCAGACTTTATTCAAAGA*C*C*A(SEQ ID NO:20)

[0275] Note: * indicates modification of the thiophosphate skeleton, and mU represents 2'-O-methyl-uridine.

[0276] The reaction mixture is described in Table 6 below.

[0277] Table 6 (Reaction #4)

[0278]

[0279]

[0280] Reaction #4 (Table 6) using the touch-up PCR method produced a DNA template with uniform poly-A tails for downstream applications. Touch-up PCR was performed using KAPA HiFi DNA polymerase (Roche) for 5 cycles at 62°C followed by 20 cycles at 68°C. Following standard protocol, the resulting PCR products were purified using DNA-selective magnetic beads (Yeasen) and further digested in NEB buffer 4 with T7 exonuclease at 25°C for 30 minutes to remove all impurities.

[0281] Example 3

[0282] The effect of promoters on capping efficiency

[0283] To test the effect of promoters on capping efficiency, plasmids containing different promoters listed in Table 1, 5'UTR (SEQ ID NO:9), eGFP ORF, 3'UTR (SEQ ID NO:2), and 100 A's were prepared by mutagenesis using pVAX vector. These plasmids were purified with maxi-prep and then linearized with restriction enzymes after the poly-A sequence to produce templates for mRNA preparation.

[0284] mRNA was prepared using a linearized plasmid as a template, T7 polymerase, and capped [I]AG, N1-methyl-pseudoUTP, via the in vitro transcription method disclosed herein. The prepared mRNA was purified by silica membrane column chromatography. The capping efficiency of each mRNA was then tested. To test its capping efficiency, a 24-mer probe was synthesized from Integrate DNA Technologies (IDT). This 24-mer probe contained four DNA nucleotides at the 5' end, 20 nt of RNA reverse-complementary to the 5' end sequence of the mRNA, and a 3' biotinylation. The probe was used to hybridize with the prepared mRNA, which was then further digested with RNase H to cleave at the DNA / RNA hybridization site, thereby releasing the 24-mer of the 5' end mRNA. This was further purified with streptavidin magnetic beads and analyzed by LC-MS. UPLC conditions were: 5% B incubation for 0–0.5 min, followed by 5 min incubation with 6%–20% B, using a Clarity Oligo-XT 2.1 x 50 mm, 2.6 μm column at 60°C, B = 65 / 35 ACN / water, A = 1% HFIP buffer, and an incubation rate of 0.4 mL / min. Mass analysis was performed using an Orbitrap Velos Pro mass spectrometer.

[0285] Figure 10A This diagram illustrates an exemplary process of using a capped [I]3-mer nucleotide (e.g., 7mGpppmAG) to initiate in vitro transcription at the -1 position of the promoter to prepare capped mRNA (e.g., G at the +1 position of the promoter). For clarity, the TATA sequence upstream of the +1 position is boxed. Thus, 7mGpppmAG binds to both the -1 and +1 positions to initiate in vitro transcription. Figure 10B This diagram illustrates an exemplary process of using a capped [I]3-mer nucleotide (e.g., 7mGpppmAG) to initiate in vitro transcription at the +1 position to prepare capped mRNA (e.g., A at the +1 position and G at the +2 position). Thus, 7mGpppmAG binds to both the +1 and +2 positions to initiate in vitro transcription. Figure 10C LC-MS data showing the capping efficiency of exemplary mRNAs prepared using the cap analogue and the disclosed in vitro transcription method for testing. Figure 10DThe disclosed in vitro transcription method shows that the mRNA prepared using template 6.5GGG (SEQ ID NO:10) with IVT starting at position -1, or template 6.5AGG (SEQ ID NO:12) with IVT starting at position +1, or template 2.5AGG (SEQ ID NO:15) with IVT starting at position +1, produces capped eGFP mRNA with similar expression efficiency in A549 cells.

[0286] Capping efficiency was calculated by analyzing the ratio of fragments with the target capping molecular weight to the total number of fragments using LC-MS. The capping efficiency test results for promoters with caps [I]-AG are listed in Table 7 below:

[0287] Table 7

[0288] SEQ ID NO: promoter Hat-like objects Capping efficiency 10 TAATACGACTCACTATAGGG hat[I] 98.80% 11 TAATACGACTCACTATAGG hat[I] 93.47% 12 TAATACGACTCACTATAAGG hat[I] 92.18% 13 TAATACGACTCACTATAGAT hat[I] 97.73% 14 TAATACGACTCACTATAGA hat[I] 93.61% 15 TAATACGACTCACTATTAGG hat[I] 93.17%

[0289] Table 7 shows that the ORF driven by the promoter (SEQ ID NO:10) produces eGFP mRNA with higher capping efficiency than the ORF driven by other promoters [I].

[0290] Higher organisms typically possess more extensively methylated cap structures, while yeast mRNA primarily contains a cap-0 structure. The 2'-o-methylation of the second base following the triphosphate bond is termed the cap-2 structure. Approximately half of human poly-A-tailed mRNA molecules have been found to possess a cap-2 structure. Cap-1 and cap-2 methylation in U2 snRNAs are essential for spliceosome formation and related splicing activities (Werner Maria, Purta Elzbieta et al., Nucleic Acid Research, 2011, Vol. 30, No. 11, pp. 4756-4768; the contents of which are incorporated herein by reference in their entirety). The novel cap analogue was evaluated as a capping analogue for the preparation of capped mRNA via a one-step in vitro transcription reaction. Following the methods disclosed herein, the cap[II] was added to the IVT reaction system using the modified T7 polymerase P266L described above. The resulting mRNA was purified using a silica membrane column, and capping efficiency was tested using RNase H digestion coupled to LC-MS.

[0291] Example 4

[0292] Determining the length of the poly-A tail

[0293] The length of the poly-A tail can be determined by digesting the mRNA sample with RNase T1 (which can cleave RNA after the G base), purifying the digested fragment, recovering the poly-A tail fragment with oligo-dT magnetic beads, eluting the purified poly-A tail fragment after denaturation with hot water or a denaturing agent, and then analyzing the length of the poly-A tail by a bioanalyzer or other capillary electrophoresis or LC-MS.

[0294] mRNA tail length was determined using RNase T1 digestion coupled to a bioanalyzer for poly-A fragment length analysis. In short, mRNA was digested with RNase T1 (which cleaves mRNA after each rG base), and then the poly-A fragments were purified using oligo-dT magnetic beads. The purified poly-A fragments were analyzed using a small RNA kit with the bioanalyzer.

[0295] Poly-A tail length is a key quality attribute of mRNA. Figure 4 The results indicate that mRNAs with longer poly-A tails exhibit better mRNA translation / expression efficiency in cells. Generally, mRNAs longer than 80A are expected to have better protein translation. Figure 3 The results of poly-A tail length analysis of mRNA samples performed using a bioanalyzer are shown. Peak 3: Poly-A tails of mRNA obtained from Company A, which is a typical distribution of poly-A tails produced by poly-A polymerase, yielding a wide length distribution from 20 to 100 nt, with an average poly-A tail length of 63 nt; Peak 4: Poly-A tails of mRNA produced using the PCR-based method disclosed herein, yielding a characteristic and sharp distribution uniformly distributed around a size of 120 ± 20 nt; and Peak 5: Poly-A tails of mRNA produced using the method of Company T, yielding an average tail length of 140 nt but with a wider distribution. The results indicate that using poly-A tails produced by the PCR-based method described in Example 1 results in high-quality DNA templates with a uniform poly-A length distribution, which further contributes to high-quality mRNA with uniformly distributed poly-A tails. Figure 5A and Figure 5B The mRNA translation or expression efficiency shown indicates that the internal (IH)eGFP mRNA is expressed more strongly than the eGFP mRNA from company T (T), while the eGFP from company A (A) is expressed the lowest. Peak 1 is a noise peak. Peak 2 ( Figure 3 The small RNA bioanalyzer kit shows a lower marker in the small RNA bioanalyzer kit, which is an internal size control of 4 nt length added in each sample run for analysis comparison.

[0296] Effect of poly-A tail length on gene expression

[0297] eGFP mRNAs with poly-A tails of varying lengths were prepared using the co-transcriptional capping method described above [I], with 100% replacement of the UTP with N1-methyl-pseudo-UTP. The resulting mRNAs were purified using a silica membrane purification method for cell expression assays. One day prior to the experiment, A549 cells were plated in 96-well plates, and 0.5 μg of mRNA was transfected into each well using lipofectamine 2000. Cells served as an untreated background control. Triple assays were performed using EGFP-mRNA-100A, EGFP-mRNA-80A, EGFP-mRNA-60A, EGFP-mRNA-40A, or eGFP mRNA prepared internally using the methods disclosed herein. The next day, eGFP protein expression levels were measured using a plate reader and analyzed using CyQUANT. TM Normalization of the number of live cells in the XTT cell viability assay.

[0298] Figure 4 The expression level of eGFP in A549 cells increased with increasing poly-A tail length of the mRNA. mRNAs with at least 60 A's were readily expressed and translated.

[0299] Example 5

[0300] In vitro transcription

[0301] Linearized DNA plasmids and PCR products can both be used as DNA templates for the preparation of mRNA via in vitro transcription. To test in vitro transcription conditions, plasmid vectors containing the T7 promoter (SEQ ID NO:11), 5'-UTR (SEQ ID NO:9), eGFP coding sequence, 3'-UTR (SEQ ID NO:2), and poly-A tail (100A) were linearized using BspQ1 or Bbs1 restriction enzymes and purified by ethanol precipitation. The linearized plasmids were transcribed using T7 RNA polymerase (M3Q), a cap analog (cap[I]), 10x transcription buffer, NTPs, and an RNase inhibitor to prepare capped mRNA.

[0302] Table 8

[0303]

[0304]

[0305] *: eGFP DNA template, luciferase DNA template, or espCas9 DNA template.

[0306] Capped analogues can be any capped analogue described herein. HEPES buffer is 400 mM HEPES in water, pH 7.5; Tris buffer is 400 mM Tris-HCl buffer at pH 7.5. RNA polymerase can be wild-type T7 RNA polymerase or a mutant T7 RNA polymerase with enhanced stability and / or the ability to incorporate capped[II] analogues. In vitro transcription can be performed in 0.2 mL to 15 mL DNase-free, RNase-free plastic tubes at defined temperatures with or without shaking.

[0307] The in vitro transcription mixture and conditions are described in Table 8. More specifically, a 10x buffer containing HEPES or Tris buffer was prepared by adding magnesium acetate, spermidine, and DTT and stored at -20°C. In the in vitro transcription reaction, the buffer, DNase-free and RNase-free water, NTP, and cap analogue were added to the reaction tube, followed by the DNA template, T7 polymerase, RNase inhibitor, and inorganic pyrophosphatase. The reaction was maintained at the specified temperature range of 20°C–40°C for 1–6 hours for transcription. The DNA template was then removed by digestion with an enzyme free of DNase I and RNase.

[0308] The eGFP mRNA prepared using the promoter (SEQ ID NO:15) was used to determine its expression efficiency in A549 cells. Two batches of capped[I], modified 100% N1-methyl-pseudoUTP, 100A-tailed eGFP mRNA were prepared and named Internal (IH)1 and IH2. Cells only (indicator cells untreated with mRNA) were used as background controls. For comparison, eGFP mRNA was also obtained from Company T (T) and Company A (A), where Company T used co-transcriptional capping with the promoter of SEQ ID NO:12, and Company A used conventional enzymatic in vitro transcription to prepare uncapped mRNA, which was then capped with a cap analogue using vaccinia virus capping enzyme and 2′-O-methyltransferase, and polyA-tailed using polyA polymerase. The eGFP mRNA samples were transfected in triplicate into A549 cells in 96-well black-well clear plates, with each 1 μg of mRNA transfected into the cells with 0.5 μL of lipofectamine 2000 and OptiMEM. Cells were incubated with mRNA overnight, and expression efficiency was measured by relative fluorescence intensity of cells treated with eGFP mRNA using a plate reader, and normalized to relative cell number as tested by Cyquant XTT cell viability assay. Figure 5 shows that the expression of eGFP mRNA prepared by the method disclosed herein, namely IH1 and IH2, was higher than that of eGFP mRNA prepared by Company T (T) and Company A (A), where Company T used co-transcriptional capping with the promoter of SEQ ID NO:12, and Company A used conventional enzymatic in vitro transcription to prepare uncapped mRNA, then added a capping analog using vaccinia virus capping enzyme and 2′-O-methyltransferase, and added a poly-A tail using poly-A polymerase. eGFP mRNA samples were transfected in triplicate into A549 cells in 96-well black-well clear plates, with each 1 μg mRNA transfected into cells with 0.5 μL of lipofectamine 2000 and OptiMEM. Cells were incubated with mRNA overnight, and expression efficiency was measured by relative fluorescence intensity of cells treated with eGFP mRNA using a plate reader, and normalized to relative cell numbers as tested by Cyquant XTT cell viability assay. Figure 5 shows that the expression of eGFP mRNA prepared by the method disclosed herein, namely IH1 and IH2, is higher than that of eGFP mRNA prepared by Company T (T) and Company A (A) methods. Figure 9 shows that eGFP mRNA prepared by in vitro transcription reaction at 31°C has higher expression efficiency than eGFP mRNA prepared by reaction at 37°C.

[0309] To determine luciferase mRNA expression using the methods disclosed herein, in vitro transcription was performed using a plasmid vector (F-Luc) containing a T7 promoter (SEQ ID NO:15), a 5'-UTR (SEQ ID NO:10), a luciferase coding sequence, a 3'-UTR (SEQ ID NO:2), and a poly-A tail (100A), followed by lipofectamine (Lipo)-mediated transfection into A549 cells. Figure 6 The results show that luciferase mRNA is readily expressed and translated compared to controls (e.g., cells only, Lipo only, and cells transfected with eGFP as a negative control).

[0310] To determine espCas9 mRNA expression using the methods disclosed herein, a plasmid vector containing the coding sequences for the T7 promoter (SEQ ID NO:12), 5'-UTR (SEQ ID NO:9), espCas9 (espCas9-1), and espCas9-EGFP (espCas9-2), 3'-UTR (SEQ ID NO:2), and a poly-A tail (100A) was transcribed in vitro and then transfected into A549 cells. Figure 7 The expression levels of espCas9-1 and espCas9-2 mRNA were higher than those of mRNA prepared by the company's T(T) method and cell control only.

[0311] Integrity analysis of the mRNA prepared by the method disclosed herein was performed using a bioanalyzer to assess purity based on size. An Agilent RNA Nano 6000 kit was used. The X-axis indicates mRNA length, and the Y-axis indicates the fluorescence intensity of the mRNA tested in capillary electrophoresis. Purity of the analyzed mRNA was analyzed by smear analysis to calculate the ratio of the target length ± 10% mRNA population. Results showed that the purity of the mRNA prepared by the method disclosed herein was approximately 85% (…). Figure 8A (Internal), its purity is 68% higher than that of mRNA prepared by Company T's method ( Figure 8B The purity of the mRNA prepared by Company T was 79%. Figure 8C The purity of the IVT reaction is crucial. The temperature of the IVT reaction is a key factor affecting mRNA purity. For 1 kb mRNA eGFP, a reaction at 37°C produces mRNA with 80% purity. Figure 9C Compared to the reaction at 31°C, the reaction produced 90% higher purity mRNA. Figure 9B For 10kb mRNA, the reaction was carried out at 31°C ( Figure 11B Compared to the reaction at 25°C, the reaction produces higher purity mRNA. Figure 11A ).

[0312] The effect of temperature on mRNA integrity

[0313] Temperature can be a crucial factor in maintaining the high integrity of mRNA produced by in vitro transcription. For example, the integrity of 10kb mRNA prepared at 31°C or 25°C, generated by the aforementioned co-transcriptional capping method, can be tested using a bioanalyzer. Integrity is analyzed using the software's smear analysis function to obtain the main peak ratio. Figure 11C The results showed that for 10kb mRNA, IVT at 25°C for 3 hours produced mRNA with 57% integrity, while in vitro transcription at 31°C for 3 hours produced mRNA with 6% integrity, as analyzed by a bioanalyzer targeting the main peak smear. Figure 11D The results showed that although the mRNA yield was higher at 31°C for 3 hours than at 25°C for 3 hours, the mRNA yield was higher at 25°C for 4 hours than at 31°C for 4 hours. These results suggest that mRNA prepared at 25°C may have better integrity than mRNA prepared at 31°C.

[0314] Effect of reaction time on mRNA integrity

[0315] In vitro transcription reaction time may be another important factor affecting mRNA integrity. Table 9 shows that for 10kb mRNA, when the IVT reaction is performed at 25°C, the integrity of the transcribed mRNA decreases from 57% after 3 hours of transcription to 52% at 4 hours. When the IVT reaction is performed at 31°C, the mRNA integrity decreases from 90% after 1 hour of reaction to 6% after 1 hour of reaction.

[0316] Table 9. Effect of IVT reaction time on 10Kb mRNA integrity

[0317] 1 hour 2 hours 2.5 hours 3 hours 3.5 hours 4 hours 4.5 hours 25℃ 51% 53% 57% 57% 52% 52% 52% 31℃ 90% 6% 6% 6% 6% 6% 6%

[0318] Example 6

[0319] mRNA purification

[0320] The mRNA obtained from Example 5 was further purified using a silica membrane column or magnetic beads. Briefly, the mRNA from in vitro transcription was mixed with buffer and ethanol and added to a silica membrane column, followed by washing with 70% ethanol and eluting with water or other storage buffer. For the products from each purification method, residual trimer caps were detected using HPLC. Protein residues were tested using Nano Orange protein residue assays.

[0321] Example 7

[0322] Transcription terminators reduce poly-A tail length variation

[0323] The same GFP gene with different poly-A tails (70 nt, 100 nt, and 120 nt) was ligated into either a pUC57 (terminator-free) vector or a pUC57-terminator vector, where the rrnB-T1 and rrnB-T2 terminators were located upstream of the T7 promoter and the λt0 terminator was located downstream of the poly-A tail, and the vector was cleaved with NheI-XhoI. The resulting plasmids were then transformed into *E. coli* using standard methods and grown at 30°C. Ten clones were then randomly selected from LB plates and subjected to Sanger sequencing to verify the poly-A tail length. The lengths of the poly-A tails of these clones are shown in Table 10 and summarized below. Figure 13 middle.

[0324] Table 10

[0325]

[0326] Figure 13 The results showed that the variation in poly-A tail length generated by in vitro transcription using pUC57-terminator vectors was less than the variation in poly-A tail length generated by in vitro transcription using pUC57 (without terminator) vectors with different poly-A segments (70nt, 100nt, and 120nt).

[0327] Example 8

[0328] Initiating IVT at position -1 increases the homogeneity of the 5' end of the RNA product.

[0329] To investigate the effect of initiating IVT at the -1 or +1 position of the DNA template on the 5' end homogeneity of the RNA product, IVT reactions were performed in the presence of the cap [I] using DNA templates TAATACGACTCACTATAGGG (SEQ ID NO:10) (initiating IVT from the -1 position of this DNA template) or TAATACGACTCACTATAAGG (SEQ ID NO:12) (initiating IVT from the +1 position of this DNA template). The RNA product was then reverse transcribed into cDNA using Illumina's NEBNext Single Cell / Low Input RNA Library Preparation Kit. DNA libraries were prepared using the NEB 7805 (FSDNA Library Preparation Kit with UMI), and alignment plots were generated using Geneuous Prime software.

[0330] Sequence alignment showed that the error rate (e.g., 0.09%) of IVT starting at position -1 using the TAATACGACTCACTATAGGG (SEQ ID NO:10) (TATA-GGG) template at the 5' end guanine (G) (indicated by the arrow) was 0.09%. Figure 14 The error rate of IVT starting at position +1 using the TAATACGACTCACTATAAGG (SEQ ID NO:12) (TATA-AGG) template at the 5' end guanine (G) (indicated by the arrow) is 0.19% (e.g., 0.19%). Figure 15 The 5' end sequence alignment from next-generation sequencing (NGS) is lower. In other words, IVT starting at position -1 has a more uniform 5' end of RNA product than IVT starting at position +1.

[0331] Example 9

[0332] RNA yield, purity, and capping efficiency under different IVT conditions

[0333] Table 11

[0334]

[0335]

[0336] To identify IVT conditions that improve RNA yield, purity, and capping efficiency, IVT reactions were performed under conditions #1, #2, and #3 (Table 11). Condition #1 is also shown in Table 8 (Example 5).

[0337] Table 12

[0338] Condition #1 Condition #2 Condition #3 Production, ug / Ul IVT 9.9 3.7 4.4 purity,% 91% 67% 68% Capping efficiency 97.2% 88.0% 91.72%

[0339] Table 12 shows that the RNA yield, purity, and capping efficiency produced under condition #1 were better than those produced under conditions #2 and #3. In other words, using condition #1 significantly improved the in vitro transcription yield and final product purity of RNA. High purity may be key to improving mRNA expression efficiency, such as... Figure 5A , Figure 5B and Figure 6 As shown. Size-based purity of the final mRNA was measured by capillary electrophoresis using a bioanalyzer. Capping efficiency was determined using RNase H digestion followed by LC-MS.

[0340] Example 10

[0341] Assemble 5'UTR sequences for efficient mRNA expression

[0342] In eukaryotic cells, protein expression levels can be highly dependent on mRNA levels, which in turn may be controlled by transcription and translation mechanisms. In fact, the translation efficiency of transcripts can be particularly important for the efficiency and efficacy of mRNA therapeutics. In this context, mRNA payloads in gene therapies / vaccines can be optimized to enhance protein expression. mRNA typically contains elements including promoters (which may include enhancers), the 5' untranslated region (5'UTR), protein-coding regions, the 3'UTR, and polyadenylation (polyA) signals. Among these elements, the 5'UTR is likely an attractive target for optimization. The 5'UTR has been shown to be crucial for ribosome recruitment and can play a key role in regulating translation efficiency. Multiple regulatory elements within the 5'UTR sequence can modulate gene expression. 5'UTR sequences with less complex mRNA structures and lower predicted minimum free energy may be associated with higher expression levels.

[0343] Designing a suitable 5'UTR remains challenging due to difficulties in predicting RNA secondary structures and a lack of experimental data. Therefore, the power of engineered 5'UTR sequences may deviate significantly from predictions.

[0344] Embodiments disclosed herein may include a collection of natural and mutant 5'UTR sequences that exhibit enhanced protein translation efficiency compared to a reference sequence (e.g., 5'UTR-001 (SEQ ID NO: 70)) and can be used to generate high mRNA expression. Therefore, the natural or mutant 5'UTRs of this disclosure (producing mRNA expression comparable to or superior to that of a reference sequence (e.g., 5'UTR-001)) can be considered promising candidates. While the artificial design of 5'UTR sequences may yield promising candidates, modified 5'UTRs based on natural sequences found in human genes may result in elements that are better recognized by translational mechanisms in human cells.

[0345] For example, genes highly expressed in tissues and cells (such as hematopoietic cells and neuronal cells) can be selected. The 5'UTR sequences from the major transcript variants are then assembled into a DNA template for mRNA production, which is then expressed in cells for comparison with a reference 5'UTR sequence. Those native 5'UTR sequences (full-length or truncated) that lead to improved protein expression are then selected for further modifications (such as point mutations and / or deletions), and their effects on mRNA expression are subsequently tested.

[0346] method

[0347] 1. Sequence selection and criteria

[0348] 1-1. Initial screening of natural sequences

[0349] For subset A of the test sequences, a literature search identified genes known to be highly expressed in different tissues / cells, such as CD14 (primarily expressed by macrophages), CD19 (widely expressed in B cells), CD80 (primarily expressed in immune cells), MB (primarily expressed in skeletal and cardiac muscle), GMCSF (a cytokine secreted by immune cells and other cells), NeuN / RBFOX3 (a neuron-specific protein), and enolase 2 (expressed at very high levels in neurons and neural tissues). Genomic and transcript sequence information for these genes was retrieved from NCBI. For each gene in this subset, the following criteria were set: (1) only the most common variant / isotype sequences were considered; (2) for 5'UTR sequences <106 bp in length, the entire sequence was included for subsequent testing; and (3) for those sequences >106 bp in length, only the first 106 bp were further tested.

[0350] For subset B of the test sequences, a survey of publicly available RNA sequencing results identified genes highly expressed in neurons and astrocytes. Based on the survey, 5'UTR sequences from the top 50 genes were selected. For each gene in this group, each unique transcript was considered, and a final list of 5'UTR sequences for this study was assembled using similar criteria.

[0351] 1-2. Mutant Sequence

[0352] The sequences of promising 5'UTR candidates obtained from the initial screening (Table 13) were used to generate mutant 5'UTR sequences for subsequent testing. In all instances, the commercially available 5'UTR-001 (AAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA) (SEQ ID NO:70) was used as the reference sequence. For all experiments described below, the same KOZAK (e.g., GCCACC) and 3'UTR (HBA1) (TAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTT GGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTG AATAAAGTCTGAGTGGGCGGCA) (SEQ ID NO:71) sequences were used to assemble the DNA template.

[0353] 2. IVT template assembly

[0354] For subset A, in order to generate a DNA template for IVT, the following were used for PCR amplification: a plasmid encoding eGFP as a template (which also contains a 3'UTR sequence (HBA1) (SEQ ID NO:71)), a forward primer containing the T7 promoter (6.5), a separate 5'UTR sequence along with a strong KOZAK sequence, and a reverse primer containing polyA.

[0355] For subset B, gene fragments encoding the following elements were first obtained: the T7 promoter (6.5), a separate 5' UTR sequence, a strong KOZAK sequence, eGFP cDNA, and a 3' UTR sequence (HBA1) (SEQ ID NO:71). To generate the final DNA template for IVT, PCR amplification was performed using a forward primer with the T7 promoter sequence (6.5) and a reverse primer containing poly-A.

[0356] 3. IVT and mRNA expression

[0357] For IVT, the PCR product described above was used as a template. mRNA was produced, purified, and transfected into cells. eGFP expression was assessed using a plate reader or flow cytometry.

[0358] result

[0359] Table 13. Natural 5'UTR sequences

[0360]

[0361]

[0362] Table 14. Mutant 5'UTR sequences

[0363]

[0364]

[0365] Approximately 250 natural 5'UTR sequences were screened. Table 13 is a list of natural sequences showing comparable or higher eGFP expression compared to the reference sequence (5'UTR-001) (SEQ ID NO:70) in different cell lines. Table 14 is a list of mutant 5'UTR sequences (SEQ ID NO:23-52) derived from promising natural sequences, showing comparable or higher eGFP expression compared to the reference sequence (5'UTR-001) (SEQ ID NO:70) in different cell lines.

[0366] The mRNA encoding eGFP containing the native 5'UTR sequence (derived from a gene highly expressed in tissues / cells such as immune cells, brain, muscle, adipose tissue, etc.) was purified using silica columns and transfected at 200 ng / well into A549 cells seeded in 96-well plates. Figure 16A and Figure 16B ) or Jurkat cells ( Figure 16C ) in. 24 hours later, use a plate reader ( Figure 16A and Figure 16B ) or flow cytometer ( Figure 16C eGFP fluorescence was measured. The fold change in eGFP expression or mean fluorescence intensity is shown compared to cells expressing eGFP with a commercially available 5'UTR-001 reference sequence (SEQ ID NO:70). These results indicate that the 5'UTR disclosed herein performs better than the 5'UTR-001 reference sequence.

[0367] Figure 17A The illustration shows an example where purified mRNA encoding eGFP and containing a mutant 5'UTR sequence (Table 14) was transfected at 100 ng / well into A549 cells seeded in 96-well plates. eGFP fluorescence was measured using a plate reader after 24 hours. As shown, the fold change in eGFP expression compared to cells expressing eGFP with the 5'UTR-001 reference sequence is plotted. Figure 17B In this study, HeLa cells transfected with mRNA encoding eGFP (100 ng / well containing several mutant 5'UTR sequences, such as LIRF m3 (SEQ ID NO:41), ENO2 m2 (SEQ ID NO:32), and GMCSF m5 (SEQ ID NO:39)) showed higher expression than HeLa cells transfected with mRNA containing the reference sequence 5'UTR-001 (SEQ ID NO:70).

[0368] The advantages of this disclosure may include (1) in vitro transcription reaction mixtures and conditions that can increase the yield, integrity and purity of mRNA, (2) cap analogs of DNA templates and -1 and / or +1 nucleotides bound to promoters for in vitro transcription, resulting in longer mRNAs, allowing for more flexible selection of the first mRNA base and providing a +2 position open to custom sequences, and (3) 5'UTRs derived from natural and novel mutant 5'UTR sequences that exhibit high mRNA expression in specific tissues / cells can provide tissue-specific advantages over artificial sequences.

[0369] All references cited in this specification are incorporated herein by reference as if each reference were expressly and individually incorporated herein by reference. Any reference cited is for the purpose of disclosure prior to the filing date and should not be construed as an admission that this disclosure is not entitled to such prior reference by virtue of a prior invention.

[0370] It should be understood that each or both of the above-described elements may also find useful applications in other types of methods different from those described above. Without further analysis, the foregoing will fully reveal the essential points of this disclosure, enabling others to readily apply it to various applications using current knowledge, without omitting features that, from an art-first perspective, fairly constitute the essential characteristics of the general or specific aspects of this disclosure as shown in the appended claims. The above embodiments are presented by way of example only; the scope of this disclosure is limited only by the following claims.

Claims

1. A method for in vitro transcription of a DNA template into RNA, the method comprising: Provided is (1) a DNA template comprising a promoter operatively linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding a target RNA, a 3' UTR, and a poly-A region, and (2) A cap analogue, said cap analogue comprising the following structure , Where R1 and R2 are each CH3 or H; and B1 is A, and B2 is G. The promoter described herein contains the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16). In this context, A at position 17 is a -1 nucleotide and X1 at position 18 is a +1 nucleotide. Where X1 is G, X2 and X3 are A, T, G or C respectively, and B1 is A and B2 is G. The cap analogue binds to the -1 and +1 nucleotides of the promoter, and The DNA template and the cap analogue are incubated in a reaction mixture, wherein the incubation comprises incubating the reaction mixture at about 25°C to about 31°C for about 3 to about 4 hours to produce the RNA. in, The 5' UTR is composed of SEQ ID NO: 1 and the 3' UTR is composed of SEQ ID NO: 4, or The 5' UTR is composed of SEQ ID NO: 1 and the 3' UTR is composed of SEQ ID NO: 6, or The 5' UTR is composed of SEQ ID NO: 7 and the 3' UTR is composed of SEQ ID NO:

4.

2. The method of claim 1, wherein the promoter comprises a sequence selected from SEQ ID NO: 10, 11, 13 and 14.

3. The method of claim 1, wherein the 5' UTR is composed of SEQ ID NO: 1 and the 3' UTR is composed of SEQ ID NO:

4.

4. The method of claim 1, wherein the cap analog is selected from the group consisting of: m 7 GpppApG, m 7 G 3'Ome pppApG, m 7 G 3'Ome pppA 2'Ome pG, and m 7 GpppA 2'Ome pG.

5. The method of claim 1, wherein the reaction mixture comprises Buffer substances with concentrations of approximately 45 mM to approximately 55 mM. RNase inhibitors at concentrations of approximately 0.01 U / µl to approximately 0.03 U / µl. NTP concentrations of approximately 3 mM to approximately 5 mM The cap analogues are present at concentrations of about 6 mM to about 8 mM. One or more magnesium salts with a concentration of about 20 mM to about 30 mM. Polyamines with concentrations of approximately 1.5 mM to approximately 2.5 mM, The DNA template was prepared at a concentration of about 0.01 µg / µl to about 0.05 µg / µl. Pyrophosphatase at concentrations of approximately 0.1 mU / µl to approximately 0.5 mU / µl, and RNA polymerase at a concentration of about 0.01 µg / µl to about 0.05 µg / µl.

6. The method of claim 5, wherein the RNA polymerase is selected from wild-type T7 RNA polymerase or a variant thereof.

7. The method of claim 1, wherein the incubation comprises incubating the reaction mixture at about 18°C ​​to about 31°C.

8. The method of claim 7, wherein the incubation comprises incubating the reaction mixture at about 30°C for about 4 hours.

9. The method of claim 1, wherein the DNA template further comprises at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).

10. The method of claim 1, wherein the concentration of the cap analogue is from about 0.5 mM to about 50 mM.

11. The method of claim 1, wherein the reaction mixture is incubated at about 25°C for about 1 hour to about 5 hours.

12. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

10.

13. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

11.

14. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

13.

15. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

14.

16. The method of claim 1, wherein the 5' UTR is composed of SEQ ID NO: 1 and the 3' UTR is composed of SEQ ID NO:

6.

17. The method of claim 1, wherein the 5' UTR is composed of SEQ ID NO: 7 and the 3' UTR is composed of SEQ ID NO: 4.