Antibacterial peptide aquiluscidin-1, encoding gene and application thereof

Abstract

The application relates to the field of biotechnology, in particular to an antibacterial peptide Aquiluscidin-1, a coding gene and application thereof. The antibacterial peptide Aquiluscidin-1 provided by the application has good thermal stability, acid-base stability and endogenous protease degradation resistance, can obviously inhibit the growth of escherichia coli, salmonella and staphylococcus aureus, and has wide application prospects in the fields of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives and the like.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the antimicrobial peptide Aquiluscidin-1, its encoding gene, and its applications. Background Technology

[0002] Antimicrobial peptides (AMPs) are a class of small molecule polypeptides encoded by host genes and possessing broad-spectrum bactericidal activity. They are essential components of the non-specific immunity of almost all organisms. Antimicrobial peptides are diverse and can be classified according to their biological activity into different types, such as antibacterial, antifungal, antiviral, antiparasitic, and antitumor. Antimicrobial peptides generally possess a positive charge and are amphiphilic, allowing them to interact with hydrophobic surfaces and membrane structures, disrupting membrane integrity and inhibiting the activity of intracellular nucleic acids and proteins. They exert antibacterial effects at cell walls, cell membranes, intracellular sites, and viral targets. Due to their unique bactericidal mechanisms, antimicrobial peptides have broad application prospects. In livestock and poultry farming, as green feed additives, they can increase livestock and poultry weight, improve the number of beneficial intestinal bacteria, increase immunoglobulin content, and reduce the concentration of inflammatory factors. They play an important role in livestock and poultry production performance, intestinal flora, immunity, and disease prevention, making them a good choice for "antibiotic alternatives" in feed preparation and feed additive applications.

[0003] Aquiluscidin, a defensin derived from rattlesnakes, is an antimicrobial peptide composed of 34 amino acid residues. It exhibits antimicrobial activity against *Escherichia coli* and *Staphylococcus aureus*. Currently, aquiluscidin is only obtained through chemical synthesis. While chemical synthesis of antimicrobial peptides is quick, requires minimal engineering effort, and allows for arbitrary combination of amino acid residues, it suffers from racemization issues and is expensive. Genetic engineering technology, primarily through prokaryotic and eukaryotic expression pathways, offers advantages such as ease of operation, simple separation and purification, and low production costs, making it a potential candidate for large-scale, industrialized production and a research hotspot in recent years. Therefore, obtaining a novel antimicrobial peptide, Aquiluscidin-1, with good thermal stability, acid-base stability, and strong antimicrobial activity using bioengineering technology is of great significance. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides the antimicrobial peptide Aquiluscidin-1, its encoding gene, and its applications, and demonstrates that it has inhibitory effects on Escherichia coli, Salmonella, and Staphylococcus aureus, and exhibits good thermal stability, acid-base stability, and resistance to endogenous protease degradation.

[0005] To achieve the above objectives, the present invention provides an antimicrobial peptide, Aquiluscidin-1, characterized in that it is a protein composed of the amino acids shown in SEQ ID NO. 1;

[0006] The protein of the antimicrobial peptide Aquiluscidin-1 can withstand pH 3-11, high temperature environment of 95℃ and degradation by endogenous proteases, and can be applied in the fields of food, hygiene products, cosmetics, biopesticides, biofeed additives or natural food preservatives.

[0007] Secondly, the present invention also provides a gene encoding the antimicrobial peptide Aquiluscidin-1, wherein the nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO.2;

[0008] Those skilled in the art will fully understand that, since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to one type. It can be obtained by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO.2 to form a synonymous mutation, resulting in a nucleotide sequence that can also encode the mutant amino acid sequence of the present invention. Alternatively, a nucleotide sequence that can encode the mutant amino acid sequence of the present invention can be designed based on codon optimization.

[0009] Thirdly, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above-mentioned genes also fall within the scope of protection of this invention.

[0010] Fourthly, a method for preparing the antimicrobial peptide Aquiluscidin-1 also falls within the scope of protection of this invention, comprising the following steps: amplifying the coding gene fragment shown in SEQ ID NO.2 by a fusion PCR reaction and fusing it with a SUMO fragment to construct a recombinant expression vector for the antimicrobial peptide Aquiluscidin-1; introducing the recombinant expression vector into a host cell to obtain the recombinantly expressed antimicrobial peptide Aquiluscidin-1.

[0011] Furthermore, the primer set for amplifying the coding gene fragment shown in SEQ ID NO.2 is as follows: the upstream primer is shown in SEQ ID NO.4, and the downstream primer is shown in SEQ ID NO.5.

[0012] Furthermore, the recombinant expression vector is selected from one or more of the following: Escherichia coli expression vector, yeast expression vector, Bacillus subtilis expression vector, lactic acid bacteria expression vector, Streptomyces expression vector, bacteriophage vector, filamentous fungal expression vector, plant expression vector, insect expression vector, or mammalian cell expression vector; preferably, it is selected from pET-28a(+).

[0013] Furthermore, the recombinant bacteria or transgenic line used for recombinant expression of the antimicrobial peptide Aquiluscidin-1 is selected from one of the following host cells: Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells, and mammalian cells; preferably, it is selected from BL21(DE3).

[0014] Fifthly, the present invention also provides the application of the antimicrobial peptide Aquiluscidin-1 in the preparation of food, hygiene products, cosmetics, biopesticides, biofeed additives or natural food preservatives.

[0015] Furthermore, the antimicrobial peptide Aquiluscidin-1 is used to inhibit the growth of one or more bacteria, including Escherichia coli, Salmonella, and Staphylococcus aureus.

[0016] Furthermore, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Escherichia coli is 13.5 μg / mL;

[0017] The minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Salmonella is 13.5 μg / mL;

[0018] The minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus is 6.75 μg / mL.

[0019] Sixthly, an antimicrobial drug comprising the antimicrobial peptide Aquiluscidin-1 also falls within the scope of protection of this invention.

[0020] Beneficial effects: This invention provides an antimicrobial peptide, Aquiluscidin-1, with good thermal stability, acid and alkali stability, and resistance to endogenous protease degradation. It can significantly inhibit the growth of Enterobacteriaceae, Salmonella, and Staphylococcus aureus, and has broad application prospects in the fields of food, hygiene products, cosmetics, biopesticides, biofeed additives, or natural food preservatives. Attached Figure Description

[0021] Figure 1 This is an electrophoresis diagram verifying the PCR amplification of the antimicrobial peptide Aquiluscidin-1 in this invention;

[0022] Figure 2 This is a diagram showing the antibacterial activity of Aquiluscidin-1 in this invention;

[0023] Figure 3 This is a pH stability diagram of the antimicrobial peptide Aquiluscidin-1 in this invention;

[0024] Figure 4 This is a thermal stability diagram of the antimicrobial peptide Aquiluscidin-1 in this invention;

[0025] Figure 5 This is a graph showing the endogenous protease stability of the antimicrobial peptide Aquiluscidin-1 in this invention. Detailed Implementation

[0026] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, the test materials used in the following embodiments were purchased from conventional biochemical reagent stores. Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0027] Some of the experimental materials and reagents used in this invention:

[0028] Strains and vectors: Escherichia coli BL21(DE3) was purchased from Beijing TransGen Biotech Co., Ltd.; pET-28a(+) expression vector was obtained from Wuhan Miaoling Biotechnology Co., Ltd.

[0029] Enzymes and other biochemical reagents: ClonExpress II One Step Cloning Kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Ex Taq enzyme was purchased from Takara Biotechnology Co., Ltd.; porcine pepsin, trypsin and chymotrypsin were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; all other reagents were domestically produced (all of which can be purchased from ordinary biochemical reagent companies).

[0030] Culture medium: LB medium: Peptone 10g, Yeast extract 5g, NaCl 10g, add distilled water to 1000mL, pH natural (approximately 7.0). For solid culture medium, add 2.0% (w / v) agar.

[0031] Example 1: Obtaining the gene encoding the antimicrobial peptide Aquiluscidin-1

[0032] The amino acid sequence of the antimicrobial peptide Aquiluscidin (number AP03818), as shown in SEQ ID NO.3, was downloaded from the antimicrobial peptide database (https: / / aps.unmc.edu / AP / ). The amino acid sequence was analyzed, and the net charge and hydrophobicity of the antimicrobial peptide Aquiluscidin were optimized. Mutations were performed on S13K, R17L, K24L, G29K, and S31K of the antimicrobial peptide Aquiluscidin to obtain the antimicrobial peptide Aquiluscidin-1 (amino acid sequence shown in SEQ ID NO.1). Codon optimization was performed on the amino acids of the antimicrobial peptide Aquiluscidin-1 to obtain the encoding amino acid sequence of the antimicrobial peptide Aquiluscidin-1 (nucleotide sequence shown in SEQ ID NO.2). The sequence encoding Aquiluscidin-1 was synthesized and ligated into the pMD-19-T cloning vector.

[0033] Example 2: Construction and transformation of the recombinant antimicrobial peptide Aquiluscidin-1 expression vector

[0034] 2.1 Using Aquiluscidin-1-pMD-19-T as a template, PCR amplification was performed. The amplification reaction system consisted of: 3.0 μL dNTP mixture, 5.0 μL 10×PCR Buffer, 1.0 μL each of forward and reverse primers, 1.0 μL plasmid, 0.5 μL Ex Taq enzyme, and double-distilled water to a total volume of 50.0 μL. The amplification reaction conditions were: denaturation at 95℃ for 30 sec; followed by denaturation at 95℃ for 30 sec, annealing at 52℃ for 30 sec, extension at 72℃ for 1 min, for 30 cycles; incubation at 72℃ for 10 min. The PCR product was purified after gel extraction and stored at -20℃ for later use.

[0035] Upstream primer Aquiluscidin-1-F3 (sequence shown in SEQ ID NO.4):

[0036] AGATTGGCGGCGCCACATATAAGCGCTTCAAAAAATTTCTTAAG

[0037] Downstream primer Aquiluscidin-1-R4 (sequence shown in SEQ ID NO.5):

[0038] TGGTGGTGGTGGTGGTGCTCGAGTTAGAACGGAAACTTCACCTTGATG

[0039] 2.2 The SUMO family protein SMT3 (amino acid sequence as shown in SEQ ID NO.6) was downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and its amino acid sequence was codon optimized. The sequence of the encoding gene was synthesized and ligated into the pMD-19-T cloning vector. The obtained target fragment was named SUMO (nucleotide sequence as shown in SEQ ID NO.7), with a length of 303 bp.

[0040] 2.3 Using SUMO-pMD-19-T as a template, PCR amplification was performed. The amplification reaction system consisted of: 3.0 μL dNTP mixture, 5.0 μL 10×PCR Buffer, 1.0 μL each of forward and reverse primers, 1.0 μL plasmid, 0.5 μL Ex Taq enzyme, and double-distilled water to a total volume of 50.0 μL. The amplification reaction conditions were: denaturation at 95℃ for 30 sec; followed by denaturation at 95℃ for 30 sec, annealing at 55℃ for 30 sec, extension at 72℃ for 1 min 30 sec, for 30 cycles; incubation at 72℃ for 10 min. The PCR product was purified after gel extraction and stored at -20℃ for later use.

[0041] Upstream primer SUMO-F1 (sequence shown in SEQ ID NO.8):

[0042] TGGTGCCGCGCGGCAGCCATATGATGAGTGATTCTGAAGTTAATCAA

[0043] Downstream primer SUMO-R2 (sequence shown in SEQ ID NO.9):

[0044] CTTAAAGAATTTTTTGAAGCGCTTATATGTGGCGCCGCCAATCTGTTC

[0045] 2.4 Using the target fragments recovered in 2.1 and 2.3 as templates, PCR fusion of the target fragment SUMO-Aquiluscidin-1 was performed using primers SUMO-F1 and Aquiluscidin-1-R4. The amplification reaction system consisted of: 3.0 μL dNTP mixture, 5.0 μL 10×PCR Buffer, 1.0 μL each of forward and reverse primers, 0.5 μL each of the antimicrobial peptide Aquiluscidin-1 gene and SUMO gene, 0.5 μL Ex Taq enzyme, and double-distilled water to a total volume of 50.0 μL. The amplification reaction conditions were as follows: 94℃ for 5 min; 94℃ for 30 sec, 63℃~49℃ for 30 sec, 72℃ for 1 min 30 sec, for a total of 28 cycles, with the annealing temperature decreasing by 0.5℃ in each cycle; 94℃ for 30 sec, 49℃ for 30 sec, 72℃ for 1 min 30 sec, for a total of 7 cycles; finally, 72℃ for 10 min; 4℃ for 10 min. The PCR product was purified after gel recovery and stored at -20℃ for later use.

[0046] 2.5 The expression vector pET-28a(+) was digested with restriction endonucleases (NdeI and XhoI). The digestion products of SUMO-Aquiluscidin-1 and pET-28a(+) after gel recovery and purification were ligated using the ClonExpress II One Step Cloning Kit recombinase to obtain the recombinant plasmid SUMO-Aquiluscidin-1-pET-28a(+) containing SUMO-Aquiluscidin-1. The nucleotide sequence of the recombinant SUMO-Aquiluscidin-1 is shown in SEQ ID NO.10.

[0047] 2.6 The recombinant plasmid SUMO-Aquiluscidin-1-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / SUMO-Aquiluscidin-1 containing SUMO-Aquiluscidin-1.

[0048] Example 3: Preparation of recombinant antimicrobial peptide Aquiluscidin-1

[0049] 3.1 The recombinant strain BL21(DE3) / SUMO-Aquiluscidin-1 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at an inoculation rate of 2.0% and activated by shaking in a shaker at 37°C and 200 rpm / min for 12-16 h.

[0050] 3.2 Inoculate the activated bacterial culture from 3.1 into fresh LB broth (containing 50 μg / mL kanamycin) at a 2.0% inoculation rate, and incubate at 37°C and 200 rpm / min on a shaker for approximately 3-4 hours (OD). 600nm After approximately 0.7%, IPTG at a final concentration of 0.6 mM was added for induction, and the mixture was cultured in a shaker at 16°C and 150 rpm / min for approximately 20 h to induce the production of recombinant protein.

[0051] 3.3 Centrifuge at 8000 rpm / min for 10 min at 4℃ and collect the bacterial cells. Resuspend the bacterial cells in an appropriate amount of pH 7.0 citrate-phosphate buffer, and then sonicate them in a low-temperature water bath. Centrifuge the concentrated intracellular enzyme solution at 13000 rpm / min for 15 min, collect the supernatant, and purify the target protein using Nickel-NTA agarose and 0-500 mM imidazole affinity.

[0052] The SDS-PAGE results of the purified protein are as follows: Figure 1 As shown, M is the protein marker, and SA-1 is the recombinant fusion antimicrobial peptide Aquiluscidin-1. The results indicate that the recombinant fusion antimicrobial peptide Aquiluscidin-1 was expressed and purified, with the product appearing as a single band.

[0053] Experiment 4 investigated the antibacterial activity of the recombinant antimicrobial peptide Aquiluscidin-1.

[0054] The antibacterial activity of recombinant antimicrobial peptide Aquiluscidin-1 was determined using the inhibition zone method. The specific method is as follows: (1) Inoculate Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis, and Staphylococcus aureus into 20 mL of liquid culture medium and culture overnight at 37°C and 200 rpm / min on a shaker; (2) Take 200 μL of the overnight cultured bacteria and inoculate them into 20 mL of sterile culture medium and culture at 37°C and 200 rpm / min for 0.5-1 h to allow the OD600 to reach 600. nm At around 0.1, the bacterial cell concentration reaches approximately 1 × 10⁻⁶. 8 CFU / mL, which is the logarithmic growth phase or early logarithmic growth phase; (3) Use a sterile cotton swab to take a small amount of bacterial solution and spread it on LB solid medium; (4) Use tweezers to pick up a sterile Oxford cup and place it evenly on the plate with the indicator bacteria. Take 50 μL of recombinant antimicrobial peptide Aquiluscidin-1 sample into the Oxford cup and use sterile water as a control; (5) After loading the sample, place the plate horizontally in a 37℃ incubator for 12 h and observe whether an inhibition zone is formed.

[0055] The results showed that the recombinant antimicrobial peptide Aquiluscidin-1 had inhibitory effects on Escherichia coli, Staphylococcus aureus, and Salmonella. Figure 2 In contrast, the control group of sterile water did not exhibit any inhibition zones. The 40 μg / mL recombinant antimicrobial peptide Aquiluscidin-1 showed inhibition zones of 11.00 mm, 13.00 mm, 14.00 mm, 12.00 mm, and 16.00 mm against Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis, and Staphylococcus aureus, respectively.

[0056] Determination of the minimum inhibitory concentration (MIC) of the recombinant antimicrobial peptide Aquiluscidin-1: The specific method for determining the MIC is the micro-dilution method: the indicator bacteria are cultured in LB liquid medium to the logarithmic growth phase, and each bacterial cell is collected and diluted to a concentration of 1×10⁻⁶. 8 CFU / mL was reserved for later use; this step is for the preparation of bacterial suspension. The purified antimicrobial peptide Aquiluscidin-1 solution was mixed with an equal volume of LB liquid medium in the first column of a 96-well plate to an initial concentration of 200 μg / mL. Subsequent columns were then serially diluted twofold to create a concentration gradient. Equal volumes of the diluted bacterial suspension were added to each well in the 96-well plate concentration gradient, and the plates were incubated at 37°C for 16 h. After incubation, the turbidity of each well was visually observed. The minimum concentration that clarified the wells was defined as the MIC of Aquiluscidin-1 against each bacterium. The results are shown in Table 1. The recombinant antimicrobial peptide Aquiluscidin-1 showed good inhibitory activity against all three bacteria, with stronger inhibitory activity against Gram-positive bacteria. The MIC against Staphylococcus aureus was 6.75 μg / mL.

[0057] Table 1. Minimum inhibitory concentrations of recombinant antimicrobial peptide Aquiluscidin-1 for different bacteria.

[0058] Bacterial species MIC (μg / mL) Escherichia coli K88 13.5 Escherichia coli K99 13.5 Salmonella choleraesuis 13.5 Salmonella enteritis in chickens 13.5 Staphylococcus aureus 6.75

[0059] Example 4: Stability determination of recombinant antimicrobial peptide Aquiluscidin-1 at different pH values

[0060] Recombinant antimicrobial peptide Aquiluscidin-1 samples were treated for 2 hours in different buffer solutions at pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0. Samples treated at different pH values ​​were used as test samples, and untreated samples were used as controls. The bactericidal rate against Staphylococcus aureus was determined (see...). Figure 3The specific method for determining the bactericidal rate of Staphylococcus aureus is as follows: After culturing Staphylococcus aureus to the logarithmic growth phase, centrifuge at 10,000 rpm for 3 minutes to collect the bacterial cells. Resuspend the bacterial cells in an equal volume of 0.1M PBS buffer, centrifuge, discard the supernatant, and repeat the above steps 3 times. Finally, dilute the bacterial cells with PBS buffer to a concentration of 1×10⁻⁶. 8 CFU / mL bacterial suspensions were prepared for use; antimicrobial peptide samples treated with different pH values ​​were mixed with diluted Staphylococcus aureus bacterial suspensions and lysed at 37°C for 1 hour. The viable count of the lysed bacterial suspensions was determined using the dilution plating method; using untreated samples as controls, the bactericidal rate of the samples against Staphylococcus aureus after 2 hours of treatment at different pH values ​​was calculated; bactericidal rate (%) = viable count of treated group / total colony count of control group * 100%.

[0061] like Figure 3 As shown, the bactericidal rate of recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus showed almost no significant change after treatment with different pH values. After 2 hours of treatment at each pH value, the bactericidal rate against Staphylococcus aureus could still reach more than 88.7%, indicating that recombinant antimicrobial peptide Aquiluscidin-1 has good acid and alkali tolerance.

[0062] Example 5 investigated the thermal stability of the recombinant antimicrobial peptide Aquiluscidin-1.

[0063] The recombinant antimicrobial peptide Aquiluscidin-1 samples were heated at 25℃, 37℃, 50℃, 70℃, 90℃, and 95℃ for 30 min, respectively. The heat-treated samples were used as test samples, and the untreated samples were used as controls. The bactericidal rate against Staphylococcus aureus was determined (see...). Figure 4 ).

[0064] like Figure 4 As shown, the bactericidal rate of recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus showed almost no significant change after treatment at different temperatures. After treatment at a high temperature of 95℃ for 30 minutes, the bactericidal rate against Staphylococcus aureus remained at 88.37%, indicating that recombinant antimicrobial peptide Aquiluscidin-1 has good thermal stability and can withstand the high-temperature treatment process of industrial processing.

[0065] Example 6 investigated the endogenous protease stability of the recombinant antimicrobial peptide Aquiluscidin-1.

[0066] Samples of the recombinant antimicrobial peptide Aquiluscidin-1 were treated for 4 hours in buffers containing 737.5 U / mL porcine pepsin, 760.0 U / mL trypsin, and 95.6 U / mL chymotrypsin, respectively. Samples treated with the proteases were used as test samples, and untreated samples were used as controls. The bactericidal rate against Staphylococcus aureus was determined (see...). Figure 5 ).

[0067] like Figure 5 As shown, after treatment with 737.5 U / mL porcine pepsin, 760.0 U / mL trypsin, and 95.6 U / mL chymotrypsin for 4 hours, the bactericidal rate of recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus remained above 88.8%; indicating that endogenous proteases in the porcine gastrointestinal tract have no effect on the bactericidal rate of recombinant antimicrobial peptide Aquiluscidin-1.

[0068] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art, under the guidance of the present invention, can make various similar representations without departing from the spirit and claims of the present invention, and such modifications all fall within the protection scope of the present invention.

Claims

1. An antibacterial peptide Aquiluscidin-1, characterized in that, The protein is composed of the amino acids shown in SEQ ID NO.

1.

2. The gene encoding the antimicrobial peptide Aquiluscidin-1 according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A recombinant vector, expression cassette, or recombinant bacterium containing the gene of claim 2.

4. A method for preparing the antimicrobial peptide Aquiluscidin-1, characterized in that, A recombinant expression vector for the antimicrobial peptide Aquiluscidin-1 was constructed by amplifying the gene fragment encoded by sequence as described in SEQ ID NO. 2 through fusion PCR and fusing it with the SUMO fragment. The recombinant expression vector was introduced into host cells to obtain the recombinantly expressed antimicrobial peptide Aquiluscidin-1.

5. The method according to claim 4, characterized in that, The primer set for amplifying the gene fragment encoding the sequence described in SEQ ID NO. 2 is as follows: the upstream primer is shown in SEQ ID NO. 4, and the downstream primer is shown in SEQ ID NO.

5.

6. The method according to claim 4, characterized in that, The recombinant expression vector is selected from Escherichia coli expression vectors; and / or, the host cell is selected from Escherichia coli host cells.

7. The method according to claim 4 or 6, characterized in that, The recombinant expression vector is selected from pET-28a(+), and / or The host cells were selected from BL21(DE3).

8. The application of the antimicrobial peptide Aquiluscidin-1 according to claim 1 in the preparation of food, hygiene products, and biological feed additives.

9. The application according to claim 8, characterized in that, It is used to inhibit the growth of one or more bacteria, including Escherichia coli, Salmonella, and Staphylococcus aureus. And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Escherichia coli is 13.5 μg / mL; And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Salmonella is 13.5 μg / mL; And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus is 6.75 μg / mL.

10. An antibacterial drug, characterized in that, Includes the antimicrobial peptide Aquiluscidin-1 as described in claim 1.

Images