Use of a rice endosperm starch content gene

Editing the OsAFB3 gene using the CRISPR/Cas9 system to regulate the starch content in rice endosperm solves the problem of insufficient key gene discovery in rice quality improvement, and improves the taste and softness of rice.

CN120485203BActive Publication Date: 2026-07-21INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
Filing Date
2025-05-06
Publication Date
2026-07-21

Smart Images

  • Figure CN120485203B_ABST
    Figure CN120485203B_ABST
Patent Text Reader

Abstract

The application discloses a rice endosperm starch content gene and application thereof, and belongs to the technical field of biotechnology.The application comprises the following steps: using an OsAFB3 gene to regulate the content of rice endosperm starch.The application of the rice endosperm starch content gene is provided, the OsAFB3 gene is used to regulate the content of rice endosperm starch, and the effect is remarkable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, and in particular to the application of a gene for rice endosperm starch content. Background Technology

[0002] As the staple food for more than half of the world's population, rice production security and quality improvement are crucial to human survival and development. Traditional breeding techniques, through the utilization of dwarfing genes and the development of hybrid vigor, have successfully achieved a leap in yield, effectively alleviating the food crisis brought about by population growth. However, as consumer demand shifts from "high yield for supply" to "high-quality nutrition," improving rice quality has become the core goal of modern breeding. Developing new rice varieties that combine high yield potential with excellent quality has become a strategic direction for ensuring food security and meeting the dual demands of consumption upgrading.

[0003] Rice quality traits include appearance, processing, cooking taste, and nutritional quality, all of which are closely related to the synthesis and accumulation of starch in the endosperm. Existing research indicates that starch content in the endosperm exceeds 80% of its dry weight. The ratio of amylose to amylopectin, its crystal structure, and molecular weight distribution directly determine key quality indicators such as rice transparency, viscoelasticity, and gelatinization characteristics. For example, excessively high amylose content can lead to increased rice grain hardness and decreased taste, while the structure of amylopectin affects the softness of cooked rice.

[0004] Currently, the discovery of key genes regulating starch synthesis is lagging behind. The number of cloned quality-related genes is limited, and most are concentrated on starch synthase-encoding genes. Upstream signaling factors regulating starch granule assembly, endosperm cell development, and metabolic flux allocation still need to be explored. Therefore, systematically discovering novel key genes regulating endosperm starch synthesis has become an urgent problem to be solved.

[0005] Public content

[0006] To address the problems of existing technologies, this disclosure provides an application of a gene for rice endosperm starch content. The technical solution is as follows:

[0007] This disclosure provides an application of a rice endosperm starch gene, the application of which includes using the OsAFB3 gene to regulate the content of rice endosperm starch.

[0008] Specifically, the application includes modifying the amino acid sequence of the OsAFB3 gene to reduce the amylose content and increase the amylopectin content in rice, while keeping the total starch content of the rice unchanged.

[0009] Specifically, the application includes: selecting OsAFB3-T as a gene knockout target in the sequence of the OsAFB3 gene, wherein the sequence of OsAFB3-T is shown as SEQ ID NO: 1 in the sequence listing;

[0010] An OsAFB3 gene knockout vector was constructed using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer based on the OsAFB3-T sequence. The sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing.

[0011] The OsAFB3 gene knockout vector was transformed into the recipient material Nipponbare to obtain a homozygous OsAFB3 gene knockout mutant.

[0012] Further, the application includes: using pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6a promoter of OsAFB3-T, and performing a second round of PCR amplification using the second forward primer and the second reverse primer to obtain a second amplification product containing the sgRNA fragment of OsAFB3-T;

[0013] The first amplification product and the second amplification product are purified and recovered to obtain purified first amplification product and purified second amplification product.

[0014] The purified first amplification product and the purified second amplification product were ligated using overlap extension PCR technology to obtain the ligation product.

[0015] The ligation product was ligated into the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0016] Further, each 50 μL reaction system for the first round of PCR amplification includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0017] Furthermore, each 50 μL reaction system for the second round of PCR amplification includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0018] Further, each 50 μL overlap extension PCR reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and ddH2O added to a total volume of 50 μL.

[0019] Further, when the ligation product is ligated into the pYLCRISPR / Cas9Pubi-H vector, each 15 μL reaction system includes: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of the ligation product at a concentration of 100 ng / μL; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

[0020] Furthermore, the receptor material is Nipponbare.

[0021] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides an application of a gene for rice endosperm starch content. This application utilizes a method of editing the OsAFB3 gene using the CRISPR / Cas9 system to knock out the OsAFB3 gene in order to regulate the content of rice endosperm starch, and the effect is significant. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1This is a statistical chart showing the total starch content in the endosperm of the control group Nip and the OsAFB3-KO-5 group and the OsAFB3-KO-6 group provided in the embodiments of this disclosure.

[0024] Figure 2 This is a statistical chart of amylose content in the endosperm of the control group Nip and OsAFB3-KO-5 group and the OsAFB3-KO-6 group provided in the embodiments of this disclosure. The asterisks on the error line indicate that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, *p < 0.05, **p < 0.01).

[0025] Figure 3 This is a statistical chart of amylopectin content in the endosperm of the control group Nip and OsAFB3-KO-5 group and the OsAFB3-KO-6 group provided in the embodiments of this disclosure. The asterisks on the error line indicate that there is a significant difference compared with the control group (p value calculated by one-way ANOVA, *p < 0.05, **p < 0.01). Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.

[0027] Example 1

[0028] This disclosure provides an application of a rice endosperm starch gene, which includes using the OsAFB3 gene to regulate the content of rice endosperm starch.

[0029] Specifically, the application includes modifying the amino acid sequence of the OsAFB3 (LOC_Os11g31620) gene to reduce the amylose content of rice, increase the amylopectin content, and keep the total starch content of rice unchanged.

[0030] In this embodiment, the sequence of the OsAFB3 gene can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0031] Specifically, the application includes designing a target sequence (OsAFB3-T) for knocking out the OsAFB3 gene using the CRISPR-P website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The sequence of the target OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing, and the specific sequence is: GTCCAGGTCGTCGTCGGTGACGG.

[0032] Construct an OsAFB3 gene knockout vector based on OsAFB3-T;

[0033] The OsAFB3 gene knockout vector was transformed into the recipient material to obtain the OsAFB3 gene homozygous knockout mutant, which is a mutant in which the OsAFB3 gene loses its function.

[0034] Further, the application includes: using pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using a first forward primer and a first reverse primer to obtain a first amplification product containing the OsAFB3-T U6a promoter; performing a second round of PCR amplification using a second forward primer and a second reverse primer to obtain a second amplification product containing the OsAFB3-T sgRNA fragment. The sequence of the first forward primer (UF) is shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG; the sequence of the first reverse primer (OsAFB3-U6aT) is shown in SEQ ID NO: 3 in the sequence listing, specifically: GCTGAAGCGGATGGTTGTCACGGCAGCCAAGCCAGCA; the sequence of the second forward primer (OsAFB3-gT) is shown in SEQ ID NO: 4 in the sequence listing, specifically: TGACAACCATCCGCTTCAGCGTTTTAGAGCTAGAAAT; and the sequence of the second reverse primer (gR-R) is shown in SEQ ID NO: 4 in the sequence listing. NO:5 shows the specific code: CGGAGGAAAATTCCATCCAC.

[0035] The first amplification product and the second amplification product were purified and recovered to obtain purified first amplification product and purified second amplification product.

[0036] The purified first amplification product and the purified second amplification product were ligated using overlap extension PCR technology to obtain the ligation product.

[0037] The ligation product was ligated into the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0038] Furthermore, each 50 μL reaction system for the first round of PCR amplification includes: 4 μL of 10 μM first forward primer; 4 μL of 10 μM first reverse primer; 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of 5 U / μL Pfu DNA high-fidelity polymerase; and 31.75 μL of ddH2O.

[0039] Furthermore, the first round of PCR amplification reaction program was as follows: pre-denaturation at 98℃ for 2 min; 32 cycles of reaction were performed, each cycle including the following steps: denaturation at 98℃ for 15 s, annealing at 57℃ for 20 s, extension at 72℃ for 30 s; final extension at 72℃ for 10 min.

[0040] Furthermore, each 50 μL reaction system for the second round of PCR amplification includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of 10 μM second forward primer; 4 μL of 10 μM second reverse primer; 1 μL of template DNA; 0.25 μL of 5 U / μL Pfu DNA high-fidelity polymerase; and 31.75 μL of ddH2O.

[0041] Furthermore, the second round of PCR amplification reaction program was as follows: pre-denaturation at 98℃ for 2 min; 32 cycles were performed, each cycle including the following steps: denaturation at 98℃ for 15 s, annealing at 57℃ for 20 s, extension at 72℃ for 30 s; final extension at 72℃ for 10 min.

[0042] Furthermore, each 50 μL overlap extension PCR reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of 10 μM first forward primer; 4 μL of 10 μM second reverse primer; 50 ng of U6a promoter; 50 ng of guide fragment sgRNA; 0.25 μL of 5 U / μL Pfu DNA high-fidelity polymerase; and ddH2O added to a total volume of 50 μL.

[0043] Furthermore, the overlap PCR reaction program is as follows: pre-denaturation at 98℃ for 4 min; 30 cycles of reaction are performed, each cycle including the following steps: denaturation at 98℃ for 20 s, annealing at 55℃ for 20 s, extension at 72℃ for 40 s; final extension at 72℃ for 10 min.

[0044] After the overlap extension PCR reaction was completed, the amplification product was recovered using a 1% (w / v) agarose gel. The target product (sgRNA expression cassette) fragment was approximately 700 bp in size. The sgRNA expression cassette was ligated to the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method. This vector was prepared and donated by Academician Liu Yaoguang's team.

[0045] Furthermore, in the ligation of the ligation product into the pYLCRISPR / Cas9Pubi-H vector, each 15 μL reaction system included: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

[0046] Furthermore, the ligation reaction procedure was as follows: 15 cycles were performed, each cycle consisting of: 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, and 37℃ for 5 min. After the ligation reaction was completed, the OsAFB3 gene knockout vector was obtained.

[0047] The OsAFB3 gene knockout vector was transformed into Agrobacterium competent cells EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. The specific method is as follows:

[0048] 1. Take one tube (100 μL) of EHa105 Agrobacterium competent cells from the -80℃ ultra-low temperature freezer and place it on ice to thaw slowly;

[0049] 2. Add 1 μg of the OsAFB3 gene knockout vector to the completely thawed EHa105 Agrobacterium competent cells and gently tap the bottom of the tube to mix.

[0050] 3. EHa105 Agrobacterium competent cells were sequentially subjected to an ice bath for 5 min, a liquid nitrogen bath for 5 min, a 37°C water bath for 5 min, and an ice bath for 5 min.

[0051] 4. Add 700 μL of antibiotic-free liquid LB medium to EHa105 Agrobacterium competent cells and incubate at 28℃ with shaking at 150 rpm for about 2 h.

[0052] 5. After centrifuging at 6000 rpm for 1 min, discard the supernatant, collect the precipitated bacterial cells, add 100 μL of antibiotic-free LB liquid medium to resuspend the bacterial cells, spread the resuspended solution onto LB solid medium containing 50 μg / mL kanamycin and 10 μg / mL rifampin, and incubate in the dark at 28℃ for 3 days.

[0053] 6. After picking single clones, colony PCR was performed using primers UF and gR-R to detect positive clones, and then the clones were streaked onto new LB solid medium for further culture.

[0054] The OsAFB3 gene knockout vector was transformed into the recipient material, Nipponbare rice, using an Agrobacterium-mediated transformation method. The specific method is as follows:

[0055] 1. Inducing callus tissue

[0056] The glumes of mature Nipponbare rice seeds were removed using a brown rice milling machine, and 16 g of plump seeds were manually selected and placed in 50 mL centrifuge tubes. The seeds were then washed sequentially with tap water and distilled water, immersed in 70% ethanol and shaken for 5 min on a shaker, rinsed three times with sterile water, and sterilized with 1% sodium hypochlorite solution at 100 rpm for 15-20 min. After sterilization, the seeds were rinsed four times with sterile water in a laminar flow hood, transferred to sterile filter paper and dried for 1.5 h, and then inoculated individually onto N6 solid induction medium and incubated in the dark at 28°C for 28 days.

[0057] 2. Subgeneration

[0058] Select pale yellow and dense callus tissue, transfer it to fresh N6 solid induction medium, and incubate it in the dark at 28°C for about 10 days.

[0059] 3. Agrobacterium-mediated transformation

[0060] Agrobacterium EHa105 transformed with the RSM gene knockout vector was screened on YEB solid medium containing rifampin and kanamycin.

[0061] Add 10 mL of 1 / 2 N6 liquid culture medium (containing 1 / 1000 volume of AS) to a 50 mL centrifuge tube. Transfer the Agrobacterium cells that have been transferred into the target vector to the liquid culture medium, shake to mix, and then adjust the bacterial concentration to OD600=0.8.

[0062] The subcultured fresh callus was transferred to Agrobacterium tumefaciens culture, mixed evenly for 15 min, and then the culture was poured out. The callus was transferred to a new sterile filter paper and dried on a clean bench for two hours. Subsequently, the callus was transferred to 1 / 2 N6 solid medium (containing 1 / 1000 volume of AS) and incubated in the dark at 20°C for about two days.

[0063] 4. Sterilization

[0064] Transfer the infected callus tissue to a sterile 250mL Erlenmeyer flask, add 150mL of sterile water, gently shake to clean the callus tissue, then pour out the sterile water. Repeat several times until the liquid is clear.

[0065] After cleaning, the callus tissue was transferred to N6 liquid culture medium containing 500 mg / L cephalosporin and placed on a shaker for 15-20 min at low speed to wash three times.

[0066] After sterilization, the callus tissue is transferred to sterile filter paper and placed on a clean bench to dry thoroughly.

[0067] 5. Resistance screening

[0068] Completely dried callus tissue was transferred to N6 solid medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin, and incubated in the dark at 28°C for one month.

[0069] 6. Differentiation

[0070] The selected active callus tissues were transferred to MS medium and cultured in the dark for 10 days in a constant temperature incubator at 28℃, followed by culture under light for 20 days.

[0071] 7. Rooting and Transplanting

[0072] The differentiated green seedlings were transferred to 1 / 2 MS medium and placed in a 28℃ constant temperature incubator for two weeks under light. Then, the seedlings in the 1 / 2 MS medium were removed, and the roots were cleaned to avoid medium residue. Subsequently, they were cultured in centrifuge tubes containing sterile water, with the sterile water being changed as needed. After one week of culture, the seedlings were transplanted to the field. After the seedlings matured, they were self-pollinated for two generations to obtain T2 generation seeds.

[0073] The phenotypes of homozygous knockout mutants of the OsAFB3 gene were observed. Specifically, in this embodiment, two homozygous knockout mutants of the OsAFB3 gene were selected, namely the OsAFB3-KO-5 group and the OsAFB3-KO-6 group, which were used as experimental groups. At the same time, the recipient material Nipponbare was used as the control group Nip.

[0074] The seeds of the control group, OsAFB3-KO-5 group, and OsAFB3-KO-6 group were sown and raised normally. When the seedlings reached 4 weeks of age, they were transplanted to the field at a plant spacing of 16.7 cm and a row spacing of 26.7 cm, with 60 plants per material. Normal field management was carried out. After the seeds matured, samples were taken, and the seed husks were removed using a brown rice machine. The rice was then milled into polished rice and further ground into rice flour for the determination of starch content in the endosperm.

[0075] The total starch content in the endosperm was determined and statistically analyzed using a plant starch content kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234027). The results are as follows: Figure 1 As shown. By Figure 1 It was found that there was no significant difference in total starch content in the endosperm of the control group Nip, the OsAFB3-KO-5 group, and the OsAFB3-KO-6 group. The amylose content in the endosperm was determined using an amylose content kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234044), and the results are as follows.Figure 2 As shown. By Figure 2 It was found that the amylose content in the endosperm of the control group Nip was significantly higher than that in the OsAFB3-KO-5 and OsAFB3-KO-6 groups. The amylopectin content in the endosperm was determined using a kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234046), and the results are as follows. Figure 3 As shown. By Figure 3 It can be seen that the amylopectin content in the endosperm of the control group Nip was significantly lower than that in the endosperm of the OsAFB3-KO-5 and OsAFB3-KO-6 groups.

[0076] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. The application of a rice endosperm starch gene, characterized in that, Knockout OsAFB3 The gene is used to reduce the amylose content and increase the amylopectin content in rice endosperm, while maintaining the total starch content in the rice endosperm unchanged. OsAFB3 The coding sequence of the gene is shown in SEQ ID NO: 6 in the sequence listing.

2. The application according to claim 1, characterized in that, In the OsAFB3 OsAFB3-T was selected as the gene knockout target from the gene sequence, and the sequence of OsAFB3-T is shown as SEQ ID NO: 1 in the sequence listing; Constructed using the first forward primer, the first reverse primer, the second forward primer, and the second reverse primer according to the OsAFB3-T. OsAFB3 The gene knockout vector has the sequence of the first forward primer as shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer as shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer as shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer as shown in SEQ ID NO: 5 in the sequence listing. The OsAFB3 Gene knockout vectors were transformed into recipient materials to obtain OsAFB3 Homozygous knockout mutant.

3. The application according to claim 2, characterized in that, Using pYLsgRNA-OsU6a plasmid as a template, the first round of PCR amplification was performed using the first forward primer and the first reverse primer to obtain the first amplification product containing the OsAFB3-T U6a promoter. The second round of PCR amplification was performed using the second forward primer and the second reverse primer to obtain the second amplification product containing the OsAFB3-T sgRNA fragment. The first amplification product and the second amplification product are purified and recovered to obtain purified first amplification product and purified second amplification product. The purified first amplification product and the purified second amplification product were ligated using overlap extension PCR technology to obtain the ligation product. The ligation product was ligated to the pYLCRISPR / Cas9Pubi-H vector to obtain the... OsAFB3 Gene knockout vector.

4. The application according to claim 3, characterized in that, Each 50 μL reaction system for the first round of PCR amplification includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10×PfuBuffer; 4 μL of 2 mM dNTPs; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

5. The application according to claim 3, characterized in that, The reaction system for each 50 μL second round PCR amplification includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

6. The application according to claim 3, characterized in that, Each 50 μL overlap extension PCR reaction system includes: 5 μL 10×Pfu Buffer; 4 μL 2 mM dNTP; 4 μL 10 μM of the first forward primer; 4 μL 10 μM of the second reverse primer; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of 5 U / μL Pfu DNA high-fidelity polymerase; and ddH2O to a total volume of 50 μL.

7. The application according to claim 3, characterized in that, The ligation product was ligated into the pYLCRISPR / Cas9Pubi-H vector. Each 15 μL reaction system contained: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of the ligation product at a concentration of 100 ng / μL; 0.5 μL of 20 U / μL LBsaI-HF restriction enzyme; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

8. The application according to claim 3, characterized in that, The receptor material is Nipponbare.