A method of making mesoporous silica with intervening dsrna to inhibit inflammation
By combining cerium-modified mesoporous silica nanomaterials with IMT1, the problems of concentration control and cell targeting of cerium ions in inhibiting inflammation induced by mt-dsRNA were solved, achieving stable release of drugs and cerium ions and effectively inhibiting the inflammatory response.
Patent Information
- Application Number
- CN202510438970.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2026-11-06
- Estimated Expiration
- 2045-04-09
AI Technical Summary
In existing technologies, cerium ions have limitations in clinical applications due to difficulties in controlling their concentration and their cytotoxicity when inhibiting inflammation induced by mt-dsRNA, as well as their inability to target inflammatory cells.
Cerium-modified mesoporous silica nanomaterials were used as drug carriers to deliver the nanomaterials to cells via endocytosis. The nanomaterials were combined with IMT1 as an inhibitor of mitochondrial RNA polymerase, which disrupted mtDNA transcription and hydrolyzed mt-dsRNA, thereby blocking the inflammatory signaling pathway.
It achieves stable release of drugs and cerium ions under inflammatory conditions, reduces mt-dsRNA production, effectively inhibits inflammatory responses, has good anti-inflammatory effects and no obvious cytotoxicity.
Smart Images
Figure CN120514731B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for preparing mesoporous silica with the ability to intervene in dsRNA to inhibit inflammation. Background Technology
[0002] Osteoarthritis (OA) is a degenerative disease of the synovial membrane, commonly occurring in the knee and hip joints. Although OA is traditionally considered a non-inflammatory joint disease or an age-related "wear and tear" disease, the complex interactions between inflammatory cytokines play a crucial role in its pathogenesis. Specifically, excessive secretion of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) can exacerbate synovial inflammation. Macrophages are the main cellular component of the synovial membrane and possess high plasticity, capable of differentiating into different phenotypes: a pro-inflammatory phenotype (M1) and an anti-inflammatory / tissue repair phenotype (M2). An imbalance in the M1 / M2 ratio is significantly correlated with the severity of OA. Therefore, regulating macrophage phenotype changes can, to some extent, alleviate the progression of OA.
[0003] In viral infections, due to bidirectional transcription of the circular genome, mtDNA produces long complementary RNAs, which can bind together to form intermolecular dsRNAs. Recent studies have shown that in inflammatory states such as osteoarthritis, mitochondrial dysfunction, elevated levels of reactive oxygen species (ROS), and DNA damage can all lead to a large accumulation of the produced mt-dsRNAs at the single-cell level. These mt-dsRNAs are then recognized by pattern recognition receptors (PRRs) MDA5 and RIG-1, thereby triggering a type I IFN response and inducing inflammation.
[0004] Cerium, as a rare earth element, exhibits excellent activity in hydrolyzing RNA and DNA. Cerium ions show significantly higher hydrolytic activity than other rare earth elements. Its nucleic acid hydrolysis primarily occurs through the hydrolysis of phosphodiester bonds, a process similar to the cleavage of natural nucleases and ribonucleases. IMT1, a mitochondrial transcription (IMT)-specific inhibitor targeting human mitochondrial RNA polymerase (POLRMT), effectively disrupts mtDNA transcription and induces dose-dependent inhibition of mtDNA expression and OXPHOS in cell lines, thereby reducing the disordered release of mt-dsRNA. The synergistic effect of both significantly reduces the pro-inflammatory effect of mt-dsRNA, blocks downstream protein pathways, and exerts an anti-inflammatory effect.
[0005] Although cerium and IMT1 have good nucleic acid hydrolysis and mt-dsRNA release inhibition functions, they also have cytotoxicity at certain concentrations and cannot target inflammatory cells. This makes it difficult to control the concentration to achieve anti-inflammatory effects, which limits their clinical application.
[0006] In recent years, mesoporous silica (MSN) nanomaterials have emerged as one of the most promising drug carriers in the innovative development of inorganic nanomaterials. The development of nanotechnology-based delivery systems offers advantages such as the excellent biocompatibility of silicon, the high Si-O bond energy maintaining chemical stability, the presence of modifiable silanol groups on the surface, and the rigid framework, favorable pore structure, easily controllable morphology, and tunable surface chemistry of MSN. Furthermore, mesoporous silica can deliver unique protein-drug combinations, which is crucial for personalized medicine, overcoming the drawbacks of poor protein solubility, instability, difficulty in crossing cell membranes, and lack of specificity. Due to its relatively high affinity for cell membrane phospholipids, it can be adsorbed onto the cell surface and taken up by various cells through endocytosis.
[0007] Cerium-modified mesoporous silica has a unique morphology and the ability to hydrolyze nucleic acids. After loading IMT1, it can maintain the properties that are more conducive to endocytosis, while hydrolyzing the generated mt-dsRNA and reducing the production of mt-dsRNA, thereby inhibiting downstream signaling proteins and suppressing inflammation. Summary of the Invention
[0008] The purpose of this invention is to provide a method for preparing drug-loaded dendritic mesoporous silica modified with cerium ions that can clear mt-dsRNA and inhibit mt-dsRNA release to suppress inflammation.
[0009] This invention provides a method for preparing mesoporous silica with the ability to intervene in dsRNA to inhibit inflammation, comprising the following steps:
[0010] Preparation of dendritic mesoporous silica (DMSN): Hexadecyltrimethylammonium chloride (CTAC) and triethanolamine were added to water, followed by the addition of a mixture of ethyl silicate and cyclohexane. The mixture was stirred in an oil bath to obtain monodisperse mesoporous silica particles. After removing excess CTAC ligand, anhydrous methanol and concentrated hydrochloric acid were added to remove the template. The mesoporous silica was obtained by high-speed centrifugation. The template removal step was repeated to completely remove residual surfactant.
[0011] Preparation of NTA-NH2: nε-benzyloxycarbonyl-l-lysine was dissolved in NaOH solution and added dropwise to bromoacetic acid solution. After adding NaOH, the mixture was stirred and heated. After cooling, HCl was added, and the mixture was filtered and dried to obtain a coarse white powder. The powder was further dissolved and purified to obtain compound 1. Compound 1 was dissolved in methanol / water, and a Pd / C catalyst was added. The mixture was stirred in hydrogen gas, filtered, and freeze-dried to obtain a white powder. After dissolving the powder, it was allowed to stand with seeds to obtain NTA. NTA was reacted with propyltriethoxysilane isocyanate to obtain NTA-NH2.
[0012] Synthesis of Ce@DMSN: After centrifugation, DMSN was redissolved in anhydrous ethanol, NTA-NH2 was added and stirred; after centrifugation, it was redispersed in water, cerium ammonium nitrate was added and stirred, and then centrifuged at high speed to redisperse in water to obtain the product Ce@DMSN;
[0013] Drug loading of Ce@DMSN: Ce@DMSN and IMT1 were dissolved in anhydrous ethanol and diluted to a certain volume; rotary evaporation was performed, followed by washing with water and diluting to a certain volume with water.
[0014] Furthermore, in the preparation of the dendritic mesoporous silicon, the surfactant is a quaternary ammonium salt compound, the catalyst is an alkanolamine compound, the silicon source is a silicate ester compound, and the organic solvent is cyclohexane.
[0015] Furthermore, in the preparation of NTA-NH2, the amino acid derivative is a benzyloxycarbonyl-protected amino acid, the base is sodium hydroxide, and the haloacid is bromoacetic acid.
[0016] Furthermore, in the synthesis of Ce@DMSN, the ligand is a compound containing an iminodiacetic acid group, and the cerium source is cerium ammonium nitrate.
[0017] Furthermore, the drug loaded in the Ce@DMSN is a transcriptional inhibitor targeting mitochondrial RNA polymerase.
[0018] This invention provides a mesoporous silica that inhibits inflammation, prepared using the method described above. The dendritic mesoporous silica has an overall diameter between 100 and 200 nm, which is conducive to endocytosis by cells. After endocytosis, the release of cerium ions can clear free mt-dsRNA. At the same time, IMT1, as a mitochondrial transcription-specific inhibitor against mitochondrial RNA polymerase, disrupts mtDNA transcription and reduces the production of mt-dsRNA.
[0019] The present invention provides a pharmaceutical composition comprising the aforementioned mesoporous silica, the pharmaceutical composition further comprising a pharmaceutically acceptable carrier.
[0020] The beneficial effects of this invention are as follows: Cerium-modified mesoporous silica has a specific morphology and suitable particle size, which is conducive to endocytosis and has the dual function of stably releasing drugs and cerium ions. Under inflammatory conditions, the stable release of drugs and cerium ions antagonizes the RIG-1 / MDA5-MAVS inflammatory pathway by reducing the generation of mt-dsRNA and hydrolyzing the already generated mt-dsRNA, thereby achieving a better anti-inflammatory effect. Attached Figure Description
[0021] Figure 1 This is a transmission electron microscope image of cerium-modified drug-loaded mesoporous silicon.
[0022] Figure 2 This relates to the relationship between the molecular weight of Ce@DMSN and the amount of IMT1 added.
[0023] Figure 3 The particle size (left) and potential (right) of dendritic mesoporous silicon before and after cerium modification and drug loading treatment are shown.
[0024] Figure 4 The difference lies in the expression of inflammatory factors and pathway proteins RNA after Ce@DMSN-IMT1 was co-cultured with inflammatory cells for 24 hours.
[0025] Figure 5 This is the release curve of cerium ions from Ce@DMSN-IMT1 particles and IMT1 drug.
[0026] Figure 6 This is a blood test result after Ce@DMSN-IMT1 particles were injected into the joint cavity of rats.
[0027] Figure 7 This is an imaging analysis of the rat knee joint after Ce@DMSN-IMT1 particles were injected into the joint cavity of rats. Detailed Implementation
[0028] The present invention will be further illustrated below with reference to examples, but these examples are not intended to limit the present invention.
[0029] Preparation of dendritic mesoporous silicon (DMSN):
[0030] Step (1): Add 6g of hexadecyltrimethylammonium chloride (CTAC) and 0.18g of triethanolamine to 24ml of water, then add 36ml of water and stir vigorously in a 60°C oil bath for half an hour to fully dissolve.
[0031] Step (2): Take 2 ml of ethyl silicate and 18 ml of cyclohexane and slowly add them dropwise to the mixture. Stir slowly in a 60°C oil bath for 8-10 hours to obtain monodisperse mesoporous silica particles. After removing excess CTAC ligand by low-speed centrifugation, add a small amount of anhydrous ethanol to reduce the solubility of mesoporous silica in the solvent, and then separate the mesoporous silica by high-speed centrifugation.
[0032] Step (3): Redisperse the mesoporous silica in 40 ml of anhydrous methanol and add 1 ml of concentrated hydrochloric acid. Stir in a 60°C oil bath for 1-2 hours to remove the template, then centrifuge at high speed to obtain the mesoporous silica. Repeat this step 2-3 times to completely remove the template. Redissolve the dendritic mesoporous silica obtained by high-speed centrifugation in water until no foam is produced to confirm complete removal of residual surfactant.
[0033] Preparation of NTA-NH2:
[0034] Step (1): Dissolve nε-benzyloxycarbonyl-l-lysine (8.41 g, 30 mmol) in 45 mL of 2 M NaOH (8 g NaOH granules dissolved in 100 mL of water), and stir the solution. Then add dropwise to bromoacetic acid (8.34 g, 60 mmol) solution at 0°C. Then add 2 M NaOH (30 mL). Stir the solution at 25°C overnight, and then heat at 70°C for 2 hours. Add 1 M HCl (90 mL) to the cooled solution. Filter and dry the precipitate to obtain a coarse white powder, which is further dissolved and purified with 1 M NaOH (100 mL) (4 g NaOH granules dissolved in 100 mL of water), and precipitated with 1 M HCl (100 mL) to obtain pure (1S)-n-(5-carbobenzyloxyamine-1-carboxypentyl)iminodiacetic acid (compound 1).
[0035] Step (2): Compound 1 (6.83 g, 17.2 mmol) was dissolved in methanol (108 mL) / water (5.7 mL) and 10% Pd / C catalyst (0.68 g). The mixture was stirred overnight at 25 °C and 760 mmHg in hydrogen. The solution was filtered, and the residue was dispersed in water (50 mL). The suspension was then filtered, and the filtrate was lyophilized to obtain a white powder. The powder was dissolved in water (20 mL), and ethanol (15 mL) was added until turbidity was reached. After heating to a clear solution, the solution was allowed to stand at -20 °C with the seeds. The white crystals were filtered and dried to obtain (1S)-n-(5-amino-1-carboxypentyl)iminodiacetic acid (NTA, 4.37 g, yield 96.7%).
[0036] Step (3): Dissolve 0.2g NTA in 2ml DMSO, add 250ul propyltriethoxysilane isocyanate in argon gas, then add 93mg 4-dimethylaminopyridine, stir in argon gas for 24h to obtain the product NTA-NH2.
[0037] Synthesis of Ce@DMSN:
[0038] Step (1): After centrifuging DMSN (12000r, 30min), redissolve it in anhydrous ethanol, add NTA-NH2 at a mass ratio of DMSN:NTA-NH2=1:2, and stir overnight.
[0039] Step (2): After centrifugation at 12000r for 30min, redisperse in water, add cerium nitrate at a mass ratio of DMSN-NTA: cerium ammonium nitrate = 1:3, stir for 1h, centrifuge at high speed, redisperse in water, and obtain the product Ce@DMSN.
[0040] Drug delivery in Ce@DMSN:
[0041] Step (1): Dissolve Ce@DMSN and IMT1 in anhydrous ethanol and dilute to 5 ml with anhydrous ethanol.
[0042] Step (2): Rotary evaporation at 150 MPa, 70 rpm, and 36 degrees Celsius, followed by washing twice with water and bringing the volume to 1 ml.
[0043] The dendritic mesoporous silica described in this invention has an overall diameter between 100 and 200 nm. This structure facilitates endocytosis by cells, and the porous structure facilitates drug release. This invention removes free mt-dsRNA through the release of cerium ions after endocytosis. Simultaneously, IMT1, as a mitochondrial transcription (IMTs) specific inhibitor against mitochondrial RNA polymerase (POLRMT), can effectively disrupt mtDNA transcription and induce dose-dependent inhibition of mtDNA expression and OXPHOS in cell lines, reducing the production of mt-dsRNA.
[0044] The principle of this invention: The obtained mesoporous silica is stable under normal physiological conditions and can exist in the joint cavity for a relatively long time, stably releasing drugs and cerium ions. IMT1 can act on the mitochondrial mtDNA transcription process, thereby reducing the release of mt-dsRNA under inflammatory conditions. At the same time, cerium ions can hydrolyze the generated mt-dsRNA, thereby blocking the activation of downstream response proteins RIG-1 and MDA5 by mt-dsRNA, thus inhibiting the occurrence of inflammation. Furthermore, the dendritic morphology and suitable particle size of the mesoporous silica are conducive to drug adsorption and efficient endocytosis, increasing the enrichment and residence time of the mesoporous silica within cells.
[0045] Example 1
[0046] 1) Add 6g of hexadecyltrimethylammonium chloride (CTAC) and 0.18g of triethanolamine sequentially to 24ml of water, followed by 36ml of water. Stir vigorously in a 60°C oil bath for half an hour to ensure complete dissolution. Slowly add 2ml of tetraethyl orthosilicate and 18ml of cyclohexane dropwise to the mixture, stirring slowly in a 60°C oil bath for 8-10 hours to obtain monodisperse mesoporous silica particles. After removing excess CTAC ligand by low-speed centrifugation, add a small amount of anhydrous ethanol to reduce the solubility of the mesoporous silica in the solvent, followed by high-speed centrifugation to separate the mesoporous silica. Redisperse the mesoporous silica in 40ml of anhydrous methanol and add 1ml of concentrated hydrochloric acid. Stir in a 60°C oil bath for 1-2 hours to remove the template, then centrifuge at high speed to obtain the mesoporous silica. Repeat this step 2-3 times to completely remove the template.
[0047] Dendritic mesoporous silica obtained by high-speed centrifugation was redissolved in water until no foaming occurred to confirm complete removal of residual surfactant. DMSN was centrifuged (12000 rpm, 30 min) and redissolved in anhydrous ethanol. NTA-NH2 was added at a mass ratio of DMSN:NTA-NH2 = 1:2, and the mixture was stirred overnight. After centrifugation at 12000 rpm for 30 min, the mixture was redispersed in water. Cerium nitrate was added at a mass ratio of DMSN-NTA:cerium ammonium nitrate = 1:3, and the mixture was stirred for 1 h. After high-speed centrifugation, the product Ce@DMSN was redispersed in water. Its transmission electron microscope image is shown below. Figure 1 .
[0048] 2) Centrifuge 1 mg of the Ce@DMSN microparticles obtained in step 1) to obtain Ce@DMSN precipitate microparticles. Dissolve Ce@DMSN and 0.25 mg IMT1 in anhydrous ethanol, and bring the volume to 5 mL with anhydrous ethanol. Perform rotary evaporation at 150 MPa, 70 rpm, and 36°C. Wash twice with water, and bring the volume to 1 mL. Collect the microparticles, freeze-dry them, and redissolve them in DMSO to remove IMT1 from the mesoporous silica. Collect the supernatant and determine the drug loading using HPLC. The results show that the IMT1 drug loading is 3.4% (…). Figure 2 ).
[0049] 3) Dissolve 1 mg of DMSN, Ce@DMSN, and Ce@DMSN-IMT1 obtained in steps 1) and 2) in ultrapure water, respectively. Detect the particle size and surface potential of dendritic mesoporous silica before and after cerium modification and drug loading. The results show that after cerium modification and drug loading, the size of the mesoporous silica particles significantly increased, and the surface charge changed from negative to positive, indicating a change in surface molecules. Figure 3 ).
[0050] 4) The Ce@DMSN-IMT1 microparticles (5 µg / mL) obtained in step 2) were co-cultured with primary macrophages (BMDM) stimulated with LPS (100 ng / mL) for 24 hours for 24 hours. After washing with PBS, RNA was collected and reverse transcribed. The inhibitory effect of the microparticles on inflammation was tested by qPCR (primer sequences: RIG1-F: CGATATTTGAAAGACTTGGGTACA, R: ATGGCTCCGTTGTTGAGATTG; IL-6-F: TACCACTTCACAAGTCGGAGGC, R: CTGCAAGTGCATCATCGTTGTTC). The results showed that the presence of Ce@DMSN-IMT1 had a better anti-inflammatory effect and a better inhibitory effect on pathway proteins than Ce@DMSN or IMT1 alone. Figure 4 ).
[0051] 5) Dilute 1 ml of the Ce@DMSN-IMT1 microparticles obtained in step 2) into 10 ml of 0.1% Tween water for sustained release via dialysis. The release rates of IMT1 drug and cerium ions were measured by HPLC and ICP at time points of 0.5 h, 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h. Figure 5 ).
[0052] 6) The Ce@DMSN-IMT1 microparticles (50 μL, 10 mg / ml) obtained in step 2) were injected into the joint cavity of rats. After one month of continuous injection, blood samples were collected from the rats for routine blood tests and biochemical analysis. The results showed that the nanoparticles did not exhibit significant drug toxicity. Figure 6 ).
[0053] Example 2
[0054] Same as Example 1, except for step 2): 10 mg of cerium-modified dendritic mesoporous silica nanoparticles were taken, and Ce@DMSN and 0.25 mg of IMT1 were dissolved in anhydrous ethanol, and the volume was adjusted to 5 ml with anhydrous ethanol. The solution was then rotary evaporated at 150 MPa, 70 rpm, and 36 degrees Celsius, followed by washing twice with water, and the volume was adjusted to 1 ml with water. Subsequently, the same doses of Ce@DMSN-IMT1, Ce@DMSN, and DMSN-IMT1 were injected weekly into the knee joints of rats with a meniscus removal and anterior cruciate ligament transection model for anti-inflammatory treatment. After 5 weeks, the rats were sacrificed, the knee joints were dissected, and micro-CT scans were performed to assess the absorption of the knee joint. The results showed that Ce@DMSN-IMT1 had a better anti-inflammatory effect. Figure 7 ).
[0055] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, make equivalent substitutions for some of the technical features, or implement the present invention in other improved forms. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for preparing mesoporous silica with the ability to intervene in dsRNA to inhibit inflammation, characterized in that, Includes the following steps: Preparation of dendritic mesoporous silica DMSN: hexadecyltrimethylammonium chloride (CTAC) and triethanolamine were added to water, followed by the addition of a mixture of ethyl silicate and cyclohexane. The mixture was stirred in an oil bath to obtain monodisperse mesoporous silica particles. After removing excess CTAC ligand, anhydrous methanol and concentrated hydrochloric acid were added to remove the template, and mesoporous silica was obtained by high-speed centrifugation. Repeat the template removal steps to completely remove residual surfactant; Preparation of NTA-NH2: nε-benzyloxycarbonyl-l-lysine was dissolved in NaOH solution and added dropwise to bromoacetic acid solution. After adding NaOH, the mixture was stirred and heated. After cooling, HCl was added, and the mixture was filtered and dried to obtain a coarse white powder. The powder was further dissolved and purified to obtain compound 1. Compound 1 was dissolved in methanol / water, and a Pd / C catalyst was added. The mixture was stirred in hydrogen gas, filtered, and freeze-dried to obtain a white powder. After dissolving, the powder was allowed to stand with seeds to obtain NTA. NTA was reacted with propyltriethoxysilane isocyanate to obtain NTA-NH2. Compound 1 is (1S)-n-(5-carbenyloxyamine-1-carboxypentyl)iminodiacetic acid. NTA is (1S)-n-(5-amino-1-carboxypentyl)iminodiacetic acid. Synthesis of Ce@DMSN: After centrifugation, DMSN was redissolved in anhydrous ethanol, NTA-NH2 was added and stirred; after centrifugation, it was redispersed in water, cerium ammonium nitrate was added and stirred, and then centrifuged at high speed to redisperse in water to obtain the product Ce@DMSN; Drug loading of Ce@DMSN: Ce@DMSN and IMT1 were dissolved in anhydrous ethanol and diluted to a certain volume; rotary evaporation was performed, followed by washing with water and diluting to a certain volume with water.
2. The preparation method according to claim 1, characterized in that, In the preparation of the dendritic mesoporous silica, the surfactant is a quaternary ammonium salt compound, the catalyst is an alkanolamine compound, the silicate source is a silicate ester compound, and the organic solvent is cyclohexane.
3. The preparation method according to claim 1, characterized in that, In the preparation of NTA-NH2, the amino acid derivative is a benzyloxycarbonyl-protected amino acid, the base is sodium hydroxide, and the haloacid is bromoacetic acid.
4. The preparation method according to claim 1, characterized in that, In the synthesis of Ce@DMSN, the ligand is a compound containing an iminodiacetic acid group, and the cerium source is cerium ammonium nitrate.
5. The preparation method according to claim 1, characterized in that, The drug loaded in the Ce@DMSN is a transcriptional inhibitor targeting mitochondrial RNA polymerase.
6. A mesoporous silica that inhibits inflammation, prepared by any one of claims 1 to 5.
7. The mesoporous silicon according to claim 6, characterized in that, The dendritic mesoporous silica has an overall diameter between 100 and 200 nm, which is conducive to endocytosis by cells.
8. The mesoporous silicon according to claim 7, characterized in that, The release of cerium ions after endocytosis can clear free mt-dsRNA. At the same time, IMT1, as a mitochondrial transcription-specific inhibitor of mitochondrial RNA polymerase, disrupts mtDNA transcription and reduces the production of mt-dsRNA.
9. A pharmaceutical composition comprising the mesoporous silica of claim 6, characterized in that, The pharmaceutical composition also includes a pharmaceutically acceptable carrier.