Construction method of human type III collagen cell line, collagen preparation and application

Abstract

This invention provides a method for constructing a human type III collagen cell line, as well as the preparation and application of collagen. Specifically, the method involves simultaneously introducing gene sequences of human type III collagen and different coenzyme combinations into cells, thereby directly folding the expressed human type III collagen within the cells and secreting human type III collagen with a triple-helix structure. This method can produce human type III collagen with a triple-helix structure in high yield, and the protein exhibits excellent proliferation, migration, adhesion activity, and biocompatibility.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology. More specifically, this invention relates to a method for constructing a human type III collagen cell line and the preparation and application of collagen. Background Technology

[0002] Collagen accounts for 25%–30% of the total protein in the human body. Of the 28 types of collagen, types I, II, and III account for approximately 80%–90% of all collagen, with type III making up about 5-20% of the total and having the most widespread medical applications. Human type III collagen is a fibrous protein formed by three α-chain helices. The collagen α-1 (III) chain, also known as the α1 chain of type III collagen, is a protein encoded by the COL3A1 gene in humans. Three α1 chains are required to form type III collagen molecules with long triple-helical domains. Type III collagen is an extracellular matrix protein synthesized by cells as procollagen. It is a major structural component of hollow organs such as large blood vessels, the uterus, and the intestines. Other functions of type III collagen include its interaction with platelets in the coagulation cascade and its role as an important signaling molecule in wound healing.

[0003] Type III collagen is a procollagen synthesized by cells that undergoes various co-translational and post-translational modifications. Three identical type III procollagen chains aggregate at the C-terminus, stabilizing the structure by forming disulfide bonds. Each individual chain folds into a left-handed helix, and then the three chains wrap together to form a right-handed supercoil, or triple helix. Before assembling the supercoil, each monomer undergoes a series of post-translational modifications during translation. First, the prolyl residues in the triple helix domain are hydroxylated to 4-hydroxyproline by prolyl-4-hydroxylase. Second, some lysine residues are hydroxylated or glycosylated. The hydroxylation of proline residues occurs in two types, forming 4-hydroxyproline and 3-hydroxyproline through two different enzymes. The triple helix conformation is a characteristic of all protoporphyrin collagens because glycine is present in every three amino acids in a sequence of approximately 1000 amino acids. This (Gly-Xaa-Yaa)n sequence is repeated in the type III collagen molecule, with proline or hydroxyproline typically located at the X and Y positions, contributing to the triple helix stability.

[0004] Currently, most complete collagen products on the market are animal-derived collagen, which carries the risk of immunogenicity. Therefore, there is an urgent need in this field for human-derived collagen products. Summary of the Invention

[0005] The purpose of this invention is to provide an in vitro preparation method for recombinant human type III collagen.

[0006] In a first aspect of the present invention, a method for preparing recombinant human type III collagen is provided, the method comprising the steps of:

[0007] a. Introducing the gene sequence of the human type III collagen α1 chain (COL3A1) and coenzyme combination into host cells; and

[0008] b. Under suitable conditions, culture the host cells from step a to obtain human type III collagen with a triple helix structure.

[0009] The coenzyme combination is a combination of 7, 8, 9, or 10 coenzymes selected from the following group: P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2, GLT25D1, BIP, and CRTAP.

[0010] In another preferred embodiment, the coenzyme combination is a 7-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, and LH2.

[0011] In another preferred embodiment, the coenzyme combination is an 8-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2 and GLT25D1.

[0012] In another preferred embodiment, the coenzyme combination is a 9-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2, GLT25D1, and Bip.

[0013] In another preferred embodiment, the coenzyme combination is a 10-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2, GLT25D1, Bip, and CRTAP.

[0014] In another preferred embodiment, the optimized sequence of COL3A1 is shown in SEQ ID NO.1.

[0015] In another preferred embodiment, the optimized sequence of P4HA1 is shown in SEQ ID NO.2.

[0016] In another preferred embodiment, the optimized sequence of the LH3 is shown in SEQ ID NO.3.

[0017] In another preferred embodiment, the optimized sequence of the PPIB is shown in SEQ ID NO.4.

[0018] In another preferred embodiment, the optimized sequence of LH1 is shown in SEQ ID NO.5.

[0019] In another preferred embodiment, the optimized sequence of the GLT25D1 is shown in SEQ ID NO.6.

[0020] In another preferred embodiment, the optimized sequence of the PDI is shown in SEQ ID NO.7.

[0021] In another preferred embodiment, the optimized sequence of the HSP47 is shown in SEQ ID NO.8.

[0022] In another preferred embodiment, the optimized sequence of LH2 is shown in SEQ ID NO.9.

[0023] In another preferred embodiment, the optimized sequence of the BIP is shown in SEQ ID NO.10.

[0024] In another preferred embodiment, the optimized sequence of the CRTAP is shown in SEQ ID NO.11.

[0025] In another preferred embodiment, the preparation method further includes step c, enzymatically purifying and / or separating the human type III collagen obtained in step b.

[0026] In another preferred embodiment, step a further includes constructing expression vectors for COL3A1 and different coenzyme combinations.

[0027] In another preferred embodiment, the expression vector is a plasmid vector, a bacteriophage vector, or a viral vector.

[0028] In another preferred embodiment, the expression vector is PEE12.4.

[0029] In another preferred embodiment, the gene sequences of the COL3A1 and coenzyme combination are contained in the same expression vector.

[0030] In another preferred embodiment, the gene sequence of the COL3A1 and coenzyme combination is contained in different expression vectors.

[0031] In another preferred embodiment, the host cell is a CHO cell.

[0032] In another preferred embodiment, step a includes:

[0033] a1. Construct an expression vector containing the COL3A1 sequence;

[0034] a2. Construct expression vectors containing different coenzyme combinations; and

[0035] a3. Transfect host cells with the expression vectors of a1 and a2.

[0036] In another preferred embodiment, the COL3A1 expression vector and the coenzyme combination expression vector are transfected into host cells simultaneously or sequentially.

[0037] In another preferred embodiment, the proportion of human type III collagen with a triple helix structure obtained by the method is ≥90% of the total human type III collagen.

[0038] In another preferred embodiment, the proportion of human type III collagen with a triple helix structure obtained by the method is ≥95% of the total human type III collagen.

[0039] In another preferred embodiment, the recombinant human type III collagen is used to prepare a composition, which is a pharmaceutical composition or a cosmetic composition.

[0040] In another preferred embodiment, the composition comprises:

[0041] a. Recombinant human type III collagen; and

[0042] b. A carrier acceptable in the pharmaceutical or cosmetic fields.

[0043] In another preferred embodiment, the recombinant human type III collagen or a combination thereof is used to promote cell proliferation, reduce wrinkles, repair skin, or a combination thereof.

[0044] In another preferred embodiment, the preparation method is used to directly express and secrete human type III collagen with a triple helix structure in vitro.

[0045] In a second aspect of the invention, a nucleic acid is provided comprising a gene sequence of a human type III collagen α1 chain (COL3A1) and a coenzyme combination as described in the first aspect of the invention.

[0046] In a third aspect of the invention, a carrier is provided, the carrier comprising the nucleic acid described in the second aspect of the invention.

[0047] In another preferred embodiment, the vector is a PEE12.4 expression vector.

[0048] In a fourth aspect of the invention, a host cell is provided, the host cell comprising a vector as described in the third aspect of the invention or its genome having integrated nucleic acids as described in the second aspect of the invention.

[0049] In another preferred embodiment, the host cell is a CHO cell.

[0050] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0051] Figure 1 The plasmid map of PEEl 2.4-COL3-A1 is shown.

[0052] Figure 2 The coenzyme plasmid maps of Pee12.4-P4HA1-PPIB-LH1, Pee12.4-LH3-PDI-Hsp47, Pee12.4-LH2, Pee12.4-LH2-GLT25D1, Pee12.4-LH2-GLT25D1-Bip, and Pee12.4-LH2-GLT25D1-Bip-CRTAP plasmids are shown.

[0053] Figure 3 The HPLC chromatograms of COL3A1 containing different coenzymes are shown.

[0054] Figure 4 The electrophoretic pattern of COL3A1 is shown.

[0055] Figure 5 The electrophoretic pattern of COL3A1 after Pepsin digestion is shown.

[0056] Figure 6 The CD spectrum of COL3A1 is shown. The left image is the spectrum without coenzyme, and the right image is the spectrum with coenzyme.

[0057] Figure 7 The CD maps of COL3A1 protein at different concentrations are shown.

[0058] Figure 8 The CD maps of COL3A1 protein at different temperatures are shown.

[0059] Figure 9 The triple-helix electron microscope structure of COL3A1 is shown.

[0060] Figure 10 The electrophoretic pattern of the thermal stability of COL3A1 is shown.

[0061] Figure 11 The results show the relative cell proliferation activity.

[0062] Figure 12 The cell migration rate results are shown.

[0063] Figure 13 The cell adhesion rate results are shown.

[0064] Figure 14 This demonstrates the biosafety of COL3A1 at the animal level. Detailed Implementation

[0065] Through extensive and in-depth research, the inventors have developed a method for preparing human type III collagen. This method involves simultaneously introducing the gene sequences of human type III collagen and different coenzyme combinations (coenzyme combinations 6, 7, 8, 9, or 10) into cells in vitro, thereby directly folding the expressed human type III collagen within the cells and secreting human type III collagen with a triple helix structure.

[0066] the term

[0067] To facilitate understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing this invention, it should be understood that it is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied.

[0068] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0069] Sequence identity is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the length of a reference nucleotide sequence or a protein) and determining the number of positions where identical residues occur. This is typically expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0070] In this invention, "human type III collagen α1 chain" and "COL3A1" can be used interchangeably.

[0071] Human type III collagen

[0072] Human type III collagen is a fibrous protein formed by three α-chain helices. The collagen α-1 (III) chain, also known as the α1 chain of type III collagen, is a protein encoded by the COL3A1 gene in humans. Three α1 chains are required to form a type III collagen molecule with a long triple-helical domain. Type III collagen is a procollagen synthesized by cells, undergoing various co-translational and post-translational modifications. Three identical type III procollagen chains aggregate at the C-terminus, stabilizing the structure by forming disulfide bonds. Each individual chain folds into a left-handed helix, and then the three chains wrap together to form a right-handed supercoil, i.e., a triple helix.

[0073] The recombinant human type III collagen of this invention simultaneously introduces the full-length sequence of the human type III collagen α1 chain and gene sequences of different coenzyme combinations into CHO cells, causing the α1 chain to be expressed and folded into a triple helix structure in CHO cells, thereby being secreted extracellularly. With the help of different coenzymes, the proportion of human type III collagen with a triple helix structure in total collagen is significantly increased, and it exhibits excellent activity in proliferation, migration, and adhesion, making it suitable for skin moisturizing, wrinkle removal, fading of age spots, and wound repair.

[0074] Preparation method

[0075] The preparation method of recombinant human type III collagen of the present invention specifically includes:

[0076] a1. Construct a plasmid containing the COL3A1 sequence;

[0077] a2. Construct plasmids containing different coenzyme combinations;

[0078] a3. Transfect CHO cells with the plasmid of a1 and screen for stable CHO cells expressing COL3A1;

[0079] a4. Transfect the plasmid from a2 into the stable CHO strain described in a3, and screen for stable CHO strains that stably express COL3A1 and coenzyme;

[0080] a5. Cultivate the stable CHO strain described in a4, and isolate and purify triple-helical human type III collagen from the supernatant.

[0081] The preparation method described in this invention can produce high levels of human type III collagen with a triple helix structure in vitro, with an expression level as high as 26.0±1.0 ng / cell.

[0082] Composition and application

[0083] The compositions described in this invention include (but are not limited to): pharmaceutical compositions, cosmetic compositions, and / or medical aesthetic compositions.

[0084] The compositions of the present invention may further include pharmaceutically, cosmetically, or medically acceptable carriers. "Pharmaceutically, cosmetically, or medically acceptable carriers" refers to one or more compatible solid or liquid fillers or gelling substances suitable for human use and possessing sufficient purity and low toxicity. "Compatibility" here refers to the ability of the components in the composition to interact with and incorporate the active ingredients of the present invention without significantly reducing the efficacy of the active ingredients. Some examples of pharmaceutically, cosmetically, or medically acceptable carriers include cellulose and its derivatives, gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as... (e.g., wetting agents, colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, dispersants, humectants, UV stabilizers, film-forming agents, oil-soluble gelling agents, organically modified clay minerals, antibacterial agents, fragrances, salts, pH adjusters, chelating agents, cooling agents, anti-inflammatory agents, skin beautifying ingredients (whitening agents, cell activators, skin roughness improvers, blood circulation promoters, skin astringents, anti-seborrheic agents, etc.), vitamins, amino acids, etc.)

[0085] Oil-soluble gelling agents are selected from metal soaps such as aluminum stearate, magnesium stearate, and zinc myristate; amino acid derivatives such as N-lauroyl-L-glutamic acid and α,γ-di-n-butylamine; cyclodextrin fatty acid esters such as cyclodextrin palmitate, cyclodextrin stearate, and cyclodextrin 2-ethylhexanoate palmitate; sucrose fatty acid esters such as sucrose palmitate and sucrose stearate; benzylidene sorbitol derivatives such as benzylidene sorbitol and dibenzylidene sorbitol; and organically modified clay minerals such as dimethylbenzyl dodecylammonium montmorillonite clay and dimethyl octadecylammonium montmorillonite clay. One, two, or more can be used as needed.

[0086] Moisturizers include: glycerin, sorbitol, propylene glycol, dipropylene glycol, 1,3-butanediol, glucose, xylitol, maltitol, polyethylene glycol, hyaluronic acid, chondroitin sulfate, pyrrolidone carboxylate, polyoxyethylene methyl glucoside, polyoxypropylene methyl glucoside, etc. Antibacterial and preservative agents include: alkyl p-hydroxybenzoate, benzoic acid, sodium benzoate, sorbic acid, potassium sorbate, phenoxyethanol, etc. Antibacterial agents include: benzoic acid, salicylic acid, carbolic acid, sorbic acid, alkyl p-hydroxybenzoate, p-chloro-m-cresol, hexachlorophenol, benzalkonium chloride, chlorhexidine chloride, trichloro-N-carbonylaniline, triclosan, photosensitizer, phenoxyethanol, etc.

[0087] Antioxidants include: tocopherol, butylated hydroxyanisole, butylated hydroxytoluene, phytic acid, etc. pH adjusters include: lactic acid, citric acid, glycolic acid, succinic acid, tartaric acid, dl-malic acid, potassium carbonate, sodium bicarbonate, ammonium bicarbonate, etc. Chelating agents include: alanine, sodium ethylenediaminetetraacetate, sodium polyphosphate, sodium metaphosphate, phosphoric acid, etc. Cooling agents include: L-menthol, camphor, etc. Anti-inflammatory agents include: allantoin, glycyrrhizic acid, glycyrrhizic acid, tranexamic acid, azulene, etc.

[0088] Skin-beautifying ingredients include: whitening agents such as placental extract, arbutin, glutathione, and saxifrage extract; cell activators such as royal jelly, photosensitizers, cholesterol derivatives, and calf blood extract; skin roughness improvers; blood circulation promoters such as valeramide nonanoate, benzyl nicotinate, β-butoxyethyl nicotinate, capsaicin, gingerone, cantharides tincture, ichthammol, caffeine, tannic acid, α-borneol, nicotinic acid tocopherol, hexanicotinic acid inositol ester, cyclomansyl ester, cinnarizine, tolazoline, acetylcholine, verapamil, strychnine, and γ-oryzanol; skin astringents such as zinc oxide and tannic acid; and anti-seborrheic agents such as sulfur. Vitamins include: Vitamin A oil, rosin oil, rosin acetate oil, palmitic acid rosin oil, etc. (Vitamin A derivatives); riboflavin, riboflavin butyrate, flavin adenine nucleotide, etc. (Vitamin B2 derivatives); pyridoxine hydrochloride, pyridoxine dicaprylate, pyridoxine tripalmitate, etc. (Vitamin B6 derivatives); Vitamin B12 and its derivatives; Vitamin B15 and its derivatives, etc. (Vitamin B derivatives); L-ascorbic acid, L-ascorbic acid dipalmitate, L-ascorbic acid-2-sulfate sodium salt, etc. Vitamin C derivatives such as L-ascorbic acid phosphate dipotassium; Vitamin D derivatives such as ergocalciferol and cholecalciferol; Vitamin E derivatives such as α-tocopherol, β-tocopherol, γ-tocopherol, dl-α-tocopherol acetate, dl-α-tocopherol niacin, and dl-α-tocopherol succinate; Vitamin H; Vitamin P; Niacin derivatives such as nicotinic acid, benzyl nicotinate, and nicotinamide; Pantothenic acid derivatives such as calcium pantothenate, D-panthenol, pantothenicotinyl ethyl ether, and acetyl pantothenicotinyl ethyl ether; Biotin, etc.

[0089] Amino acids include: glycine, valine, leucine, isoleucine, serine, threonine, phenylalanine, arginine, lysine, aspartic acid, glutamic acid, cystine, cysteine, methionine, tryptophan, etc.

[0090] There are no particular limitations on the administration method of the compositions of the present invention. Representative administration methods include (but are not limited to): oral administration, parenteral (intravenous, intramuscular, intraperitoneal, subcutaneous) injection, local application, or topical application. The dosage form of the compositions of the present invention is an oral preparation, a topical preparation, or an injectable preparation, preferably a local injectable preparation or a local topical preparation, and more preferably a local subcutaneous injection preparation.

[0091] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures thereof. Besides these inert diluents, the composition may also contain adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and fragrances. In addition to the active ingredient, suspensions may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures thereof.

[0092] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0093] Dosage forms of the compositions of the present invention for topical application or administration include ointments, powders, patches, sprays, and inhalers. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as needed.

[0094] When administering the composition, a safe and effective amount of the cell-free lipid extract of the present invention is applied to humans or non-human animals (such as rats, mice, dogs, cats, cattle, sheep, chickens, ducks, etc.) requiring treatment, wherein the dosage administered is a pharmaceutically, food-, or health-product-acceptable effective dosage. As used herein, the term "safe and effective amount" refers to an amount that produces function or activity in humans and / or animals and is acceptable to humans and / or animals. Those skilled in the art will understand that the "safe and effective amount" can vary depending on the form of the pharmaceutical composition, the route of administration, the excipients used, the severity of the disease, and whether it is used in combination with other drugs. For example, for a person weighing 60 kg, the daily dosage is typically 0.1-1000 mg, preferably 1-600 mg, and more preferably 2-300 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are within the scope of the skill of a skilled physician.

[0095] Compared with the prior art, the main advantages of the present invention include:

[0096] 1. The method for preparing human type III collagen of the present invention can produce high yields of human type III collagen with a triple helix structure in vitro, with an expression level of up to 26.0±1.0 ng / cell.

[0097] 2. This invention, by simultaneously expressing human type III collagen and plasmids with different coenzyme combinations, greatly increases the proportion of human type III collagen with a triple helix structure, and different proportions of triple helix collagen can be obtained by adjusting the input amounts of collagen and coenzymes.

[0098] 3. The preparation method of the present invention can directly express and secrete human type III collagen with a triple helix structure in vitro cells, and has excellent proliferation, migration and adhesion activities.

[0099] 4. The human type III collagen produced by the method of this invention has good biocompatibility.

[0100] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0101] Example 1. Sequence Analysis and Acquisition of Candidate Small Molecule Collagen Sequences

[0102] The amino acid sequence of the α1 chain of human type III collagen was obtained from the National Center for Biotechnology Information (NCBI), accession number KAI4029513.1 (https: / / www.ncbi.nlm.nih.gov / protein / KAI4029513.1 / ), with a full length of 2944 amino acids. The optimized collagen nucleotide sequence is shown in SEQ ID NO.1. The optimized collagen nucleotide sequence showed 75.56% homology with the native nucleotide sequence. The number of integrin recognition sites in the collagen sequence will affect cellular activities such as proliferation, adhesion, and migration.

[0103] Optimized sequence of COL3A1 (SEQ ID NO.1):

[0104]

[0105] 1. Construction of the target gene vector

[0106] 1.1 The gene sequence was optimized through gene synthesis, and the target gene vector was constructed using restriction endonucleases and ligases.

[0107] CO3-A1 nucleotide amplification: Exogenous PCR was performed in two rounds. In the first round of PCR, four fragments were amplified using pcDNA3.1 Zeo(+)-a1(Ⅲ) as a template. Fragment 1 was amplified using COL-1F and COL-1R (129 bp), fragment 2 was amplified using COL-2F, COL-3F, COL-4F, and COL-4R (121 bp), fragment 3 was amplified using COL-4F and COL-3R (4.3 kb), and fragment 4 was amplified using COL-5F and COL-5R (342 bp). The primer sequences and product sizes are shown in the table below.

[0108]

[0109]

[0110] The second round of PCR used recovered fragments 1, 2, 3, and 4 as templates, and COL-1F and COL-5R as primers to amplify fragments 1-4. The amplification system was the same as before, and the fragments were purified using a common DNA product purification kit for later use.

[0111] PEE12.4 expression vector digestion: PEE12.4 plasmid and CO3-A1 nucleotides were extracted, and the pEE12.4 plasmid was double-digested with HindIII (NEB) and EcoRI (NEB) to linearize the vector. The specific digestion reaction system is as follows (50 μL system):

[0112]

[0113] After enzyme digestion, the plasmid was purified using a standard DNA product purification kit and is ready for use.

[0114] 1.2 Ligation and Positive Clone Verification: The linearized vectors and PCR exogenous fragments from 2.1 and 2.2, respectively, were ligated using TSINGKE TSV-S3. The Seamless Cloning Kit is used for connection, and the connection system is as follows;

[0115] PB513B-GS (EcoRI) 0.8μL

[0116] 1-4 PCR exogenous fragment 1.7 μL

[0117] 2x Seamless Cloning Mix 2.5μL

[0118] The reaction was carried out at 50℃ for 30 min. After ligation, the cells were transformed into DH5α E. coli and cultured overnight at 37℃. The next day, single clones were picked, amplified, and plasmids were extracted. The plasmids were sequenced to confirm the correct insertion position and sequence. The correctly sequenced plasmid was named PEE12.4-COL3-A1.

[0119] 1.3 Large-scale extraction of PEE12.4-DSA-10XHIS-A1(3) endotoxin-free plasmids

[0120] The E. coli culture of PEE12.4-COL3-A1 was cultured overnight, and plasmids were extracted using Tiangen's endotoxin-free plasmid extraction kit, following the instructions.

[0121] 2. Coenzyme gene optimization and vector construction

[0122] 2.1 The P4HA1 sequence was obtained from the UniProt database, ID: P13674·P4HA1_HUMAN

[0123] (https: / / www.uniprot.org / uniprotkb / P13674 / entry#sequences). The optimized nucleotide sequence is shown in SEQ ID NO.2. The optimized collagen nucleotide sequence has 76.13% homology with the native nucleotide sequence.

[0124] P4HA1 optimized sequence (SEQ ID NO.2):

[0125]

[0126] 2.2 The LH3 sequence was obtained from the UniProt database, ID: O60568·PLOD3_HUMAN

[0127] (https: / / www.uniprot.org / uniprotkb / O60568 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.3. The optimized collagen nucleotide sequence shows 82.29% homology with the native nucleotide sequence.

[0128] LH3 optimized sequence (SEQ ID NO.3):

[0129]

[0130] 2.3 The PPIB sequence was obtained from the UniProt database, ID: P23284·PPIB_HUMAN

[0131] (https: / / www.uniprot.org / uniprotkb / P23284 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.4. The optimized collagen nucleotide sequence has 82.74% homology with the native nucleotide sequence.

[0132] PPIB optimized sequence (SEQ ID NO.4):

[0133] .

[0134] The 2.4LH1 sequence was obtained from the UniProt database, ID: Q02809·PLOD1_HUMAN

[0135] (https: / / www.uniprot.org / uniprotkb / Q02809 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.5. The optimized collagen nucleotide sequence has 82.91% homology with the native nucleotide sequence.

[0136] LH1 optimized sequence (SEQ ID NO.5):

[0137]

[0138] The 2.5GLT25D1 sequence was obtained from the UniProt database, ID: Q8NBJ5·GT251_HUMAN

[0139] (https: / / www.uniprot.org / uniprotkb / Q8NBJ5 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.6. The optimized collagen nucleotide sequence has 82.23% homology with the native nucleotide sequence.

[0140] Optimized GLT25D1 sequence (SEQ ID NO.6):

[0141]

[0142] 2.6 The PDI sequence was obtained from the UniProt database, ID: P07237·PDIA1_HUMAN

[0143] (https: / / www.uniprot.org / uniprotkb / P07237 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.7. The optimized collagen nucleotide sequence has 81.64% homology with the native nucleotide sequence.

[0144] PDI-optimized sequence (SEQ ID NO.7):

[0145]

[0146] 2.7 The HSP47 sequence was obtained from the UniProt database, ID: P50454·SERPH_HUMAN

[0147] (https: / / www.uniprot.org / uniprotkb / P50454 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.8. The optimized collagen nucleotide sequence has 82.26% homology with the native nucleotide sequence.

[0148] HSP47 optimized sequence (SEQ ID NO.8):

[0149]

[0150] The 2.8LH2 sequence was obtained from the UniProt database, ID: O00469·PLOD2_HUMAN

[0151] (https: / / www.uniprot.org / uniprotkb / O00469 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.9. The optimized collagen nucleotide sequence has 76.63% homology with the native nucleotide sequence.

[0152] LH2 optimized sequence (SEQ ID NO.9):

[0153]

[0154] 2.9 The BIP sequence is from the UniProt database, ID: P11021·BIP_HUMAN

[0155] (https: / / www.uniprot.org / uniprotkb / P11021 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.10. Homology between the optimized collagen nucleotide sequence and the native nucleotide sequence.

[0156] BIP-optimized sequence (SEQ ID NO.10):

[0157]

[0158] 2.10 The CRTAP sequence was obtained from the UniProt database, ID: O75718·CRTAP_HUMAN

[0159] (https: / / www.uniprot.org / uniprotkb / O75718 / entry). The optimized nucleotide sequence is shown in SEQ ID NO.11. Homology between the optimized collagen nucleotide sequence and the native nucleotide sequence.

[0160] CRTAP-optimized sequence (SEQ ID NO.11):

[0161]

[0162] These sequences were synthesized into an expression vector and combined to obtain, as shown below. Figure 2 The six plasmids shown are: Pee12.4-P4HA1-PPIB-LH1, Pee12.4-LH3-PDI-Hsp47, Pee12.4-LH2, Pee12.4-LH2-GLT25D1, Pee12.4-LH2-GLT25D1-Bip, and Pee12.4-LH2-GLT25D1-Bip-CRTAP. After transformation into DH5α *E. coli*, the cultures were incubated overnight at 37°C. The next day, single colonies were picked, amplified, and plasmids were extracted. The plasmids were sequenced to confirm the insertion position and sequence correctness. Plasmids were extracted from the overnight cultured *E. coli* containing the coenzyme gene using Tiangen's endotoxin-free plasmid extraction kit, following the manufacturer's instructions.

[0163] Example 2: Construction of Stable Cell Lines

[0164] 1. Screening of collagen III stable cell lines using Minipool

[0165] 1.1 CHO Cell Thawing: Remove CHO cells from liquid nitrogen and place them in a 37°C water bath. Shake the cryovial for 1-2 minutes to rapidly thaw the cell suspension. In a biosafety cabinet, use a pipette to transfer the cells from the cryovial to a centrifuge tube containing 10 ml of CHO CDFusion (Merck). Centrifuge at 850 rpm for 5 minutes, discard the supernatant, count the cells, and seed them at 0.5*10^6 / ml into 125 ml shake flasks. The seeding medium is CHO CDFusion + 6 mM Gln. Incubate at 37°C and 125 rpm in a shaker.

[0166] 1.2 CHO cell resuscitation culture: CHO cells in a shaker were passaged every 2 days at a passage density of 0.5*10^6 / ml and a volume of 30ml. After 3 passages, the cells were used for stable cell line selection.

[0167] 1.3 Screening of stable cell lines:

[0168] 1.3.1 Plasmid electroporation: Count CHO cells with a viability of over 95% and a cell count of 1*10^7. After centrifugation, discard the supernatant and resuspend the cells in electroporation buffer (Suzhou Yida). Add 30ug of PEE12.4-COL-A1(3) plasmid, for a total electroporation volume of 200ul. Coat the cell suspension onto a 0.2mm spinneret. Set the electroporator (Suzhou Yida X-Porator H1) parameters to 200V, 1000uF, 6T, and 1000ms. After setting the parameters, perform electroporation. After electroporation, transfer all cells to a T25 culture medium containing 5ml CHO CDfusion + 6Mm Gln medium and incubate in a cell culture incubator at 37℃ and 5% CO2.

[0169] 1.3.2 Screening and Plating: After culturing cells in an incubator for 2 days, cell density and viability were calculated, and cells were seeded into 96-well minipool plates with 10,000 cells per well. 200 μL of CHO CD fusion + 30 μM MSX (Sigma) was added for screening. The plates were then placed in a cell culture incubator at 37°C and 5% CO2. On day 8, cell status was observed, and replenishment was performed by adding 50 μL of CHO CD fusion + 30 μM MSX (Sigma) to each well. The plates were then placed in a cell culture incubator at 37°C and 5% CO2.

[0170] 1.3.3 Minipool identification and scale-up: On day 18, cells were harvested for observation. Minipool cells were screened using an ELISA kit, with the top 10 cells from each 96-well plate scaled up to 48-well plates. 250 μL of CHO CD fusion + 30 μM MSX medium was added for further culture. Using an ELISA kit (Jianglai Biotechnology), the top 10 cells were scaled up to 24-well plates and cultured with 500 μL of CHO CD fusion + 30 μM MSX medium. After 2 days of culture, the supernatant was collected for His-WB analysis. The top 10 cells were scaled up to 6-well plates, with 2 ml of CHO CD fusion + 30 μM MSX medium added. After 3 days of culture, the cells were transferred to T25 culture flasks, with 5 ml of CHO CD fusion + 30 μM MSX medium added. After 3 days of culture, the cells were transferred to T75 culture flasks, with 10 ml of CHO CD fusion + 30 μM MSX medium added. MSX culture; after 3 days of culture, cells were seeded at 1*10^6 / ml into 125ml shake flasks for culture at 37℃, 8% CO2, and 125rpm / min. Subsequently, the culture medium was changed to CHO CD fusion + 30Um MSX every 2 days, with a seeding density of 0.5*10^6 / ml, until the maximum seeding volume of cells reached 30ml and the viability exceeded 95%. The stable cell line minipool selection was completed.

[0171] 1.3.4 Minipool Fedbatch: Minipool TOP10 was inoculated into 125ml shake flasks at an inoculation density of 0.5*10^6 / ml, 30ml volume. The culture medium was Actipro (Cytiva), using CellBoost 7a / 7b (Cytiva). CellBoost 7a was added at 4% of the total volume each time, and CellBoost 7b at 0.4% of the total volume. The feeding strategy was as follows:

[0172] CellBoost 7a / 4％ 4％ 4％ 4％ 4％ 4％ 4％ CellBoost 7b / 0.40％ 0.40％ 0.40％ 0.40％ 0.40％ 0.40％ 0.40％ Sugar replenishment / Supplement to 6g / L Supplement to 6g / L Supplement to 6g / L Supplement to 6g / L Supplement to 6g / L Supplement to 6g / L

[0173] 1.3.5: Sample collection: If the viability is below 80% during the feeding process, collect all samples on day 14. After collection, all samples are purified, and the best samples are selected for monoclonal selection.

[0174] 2. Selection of Collagen III Monoclonal Proteins

[0175] 2.1 Select the optimal Minipool 1B8 for single-clone selection. Resuscitate cells and seed them into 125ml shake flasks at a seeding density of 0.5*10^5 / ml. Culture using CHO CD fusion at 37℃, 8% CO2, and 125rpm / min. Replace with fresh culture every 2 days and add 30um MSX+CHO CD fusion. After replacing with fresh culture twice, plate the cells.

[0176] 2.2 Monoclonal plating: Monoclonal plating was performed using the limiting dilution method with monoclonal medium. 0.5 cells were seeded into each well, and 10 96-well plates were plated. The plates were then incubated statically at 37°C and 8% CO2. On Day 8, additional culture was performed at 50 μL / well, and the plates were then incubated statically again at 37°C and 8% CO2.

[0177] 2.3 Detection and Scale-up: When the single colony reaches 40% of the plate bottom area, perform ELISA on the cells. Select the top 48 cells and culture them in 24-well plates, adding 0.5 ml of CHO CD fusion + 30 Um MSX. After 2 days of culture, collect the supernatant again for ELISA. Select the top 10 cells and scale them up in 6-well plates, adding 2 ml of CHO CD fusion + 30 Um MSX. After the cells reach confluence, culture for 3 days and then transfer them to a T25 culture flask, adding 5 ml of CHO CD fusion + 30 Um MSX. After 3 days of culture, transfer them to a T75 culture flask, adding 10 ml of CHO CD fusion + 30 Um MSX. After 3 days of culture, seed the cells at 1*10^6 / ml into 125 ml shake flasks and culture under the conditions of 37℃, 8% CO2, and 125 rpm / min. Thereafter, change the CHO CD fusion + 30 Um MSX solution every 2 days. Cells were cultured in MSX medium at an inoculation density of 0.5*10^6 / ml until the maximum inoculation volume reached 30ml and the viability exceeded 95%. The selection process was then complete.

[0178] 2.4 TOP Single-Clon Fedbatch: The method is the same as minipool Fedbatch, selecting the best single clone.

[0179] Construction of a stable strain of collagen coenzyme-collagen III

[0180] 3.1 Monoclonal cell resuscitation: Remove the monoclonal cells from liquid nitrogen and place them in a 37°C water bath. Shake the cryovials for 1-2 minutes to rapidly thaw the cell suspension. In a biosafety cabinet, use a pipette to transfer the cells from the cryovials to a centrifuge tube containing 10 ml of CHO CD Fusion (Merck). Centrifuge at 850 rpm for 5 minutes, discard the supernatant, count the cells, and seed them at 0.5 * 10^6 / ml into 125 ml shake flasks. The seeding medium is CHO CD Fusion + 6 mM Gln. Incubate at 37°C and 125 rpm in a shaker.

[0181] 3.2 Monoclonal cell resuscitation culture: CHO cells in a shaker were passaged every 2 days at a passage density of 0.5*10^6 / ml and a volume of 30ml. After 3 passages, the cells were used for stable cell line selection.

[0182] 3.3 Screening of stable cell lines:

[0183] 3.3.1 Plasmid electroporation: Single-clone cells were counted, with a viability exceeding 95% and a cell count of 1*10^7. After centrifugation, the supernatant was discarded, and the cells were resuspended in electroporation buffer (Suzhou Yida). Two helper enzyme expression plasmids, pEEl2.4-LH3+PDI+Hsp47 and pEEl2.4-P4HA1+PPIB+LH1, were added, 10ug for each helper enzyme plasmid, for a total electroporation volume of 200ul. The cell suspension was transferred to a 0.2mm transfer cup, and the electroporator (Suzhou Yida X-Porator H1) parameters were set as follows: 200V, 1000uF, 6T, 1000ms. After setting the parameters, electroporation was performed. After electroporation, all cells were transferred to a T25 culture medium containing 5ml CHO CD fusion + 6Mm Gln medium and cultured in a cell culture incubator at 37℃ and 5% CO2.

[0184] 3.3.2 Cell line screening: After electroporation, cells were cultured in an incubator for 2 days. Cell density and viability were calculated. Cells were seeded into TPP tubes for screening at a cell density of 1*10^6 / ml and a minimum seeding volume of 5ml. 5ml of CHO CD fusion + 10ug / ml Puromycin was added, and the cells were screened on a high-speed shaker at 37℃, 8% CO2, and 220rpm / min. Cell density and viability were counted every 3 days, and the medium was changed to fresh CHO CD fusion + 10ug / ml Puromycin for further screening. After multiple passages and screenings, the cell viability reached 95% or higher, and the stable cell line screening was completed.

[0185] 3.3.3 Preparation of Febbatch cell line and protein: The stable line obtained above was inoculated into Febbatch cells and cultured for 14 days. The supernatant was collected and purified, and the expression level was 1.1 g / L.

[0186] 4. Collagen Coenzyme Combination - Yield of Stable Collagen III Strains

[0187] 4.1 Monoclonal cell resuscitation: Remove the monoclonal cells from liquid nitrogen and place them in a 37°C water bath. Shake the cryovials for 1-2 minutes to rapidly thaw the cell suspension. In a biosafety cabinet, use a pipette to transfer the cells from the cryovials to a centrifuge tube containing 10 ml of CHO CD Fusion (Merck). Centrifuge at 850 rpm for 5 minutes, discard the supernatant, count the cells, and seed them at 0.5 * 10^6 / ml into 125 ml shake flasks. The seeding medium is CHO CD Fusion + 6 mM Gln. Incubate at 37°C and 125 rpm in a shaker.

[0188] 4.2 Monoclonal cell resuscitation culture: CHO cells in a shaker were passaged every 2 days at a passage density of 0.5*10^6 / ml and a volume of 30ml. After 3 passages, the cells were used for stable cell line selection.

[0189] 4.3 Screening of stable cell lines:

[0190] 4.3.1 Plasmid electroporation: Take single clone cells, count them, the viability is more than 95% and the number of cells is 1*10^7. After centrifugation, discard the supernatant, resuspend in electroporation buffer (Suzhou Yida), and add different amounts of helper enzyme expression plasmids as shown in Table 1.

[0191] Table 1. Coenzyme Combinations

[0192]

[0193] 10 μg of each helper enzyme plasmid was used, with a total electroporation volume of 200 μL. The cell suspension was transferred to a 0.2 mm transfer cup. The electroporator (Suzhou Yida X-Porator H1) parameters were set as follows: 200 V, 1000 μF, 6 T, 1000 ms. After setting the parameters, electroporation was performed. After electroporation, all cells were transferred to a T25 culture medium containing 5 ml of CHO CD fusion medium and 6 ml of Gln medium, and then placed in a cell culture incubator at 37°C and 5% CO2.

[0194] 4.3.2 Cell line screening: After electroporation, cells were cultured in an incubator for 2 days. Cell density and viability were calculated. Cells were seeded into TPP tubes for screening at a cell density of 1*10^6 / ml and a minimum seeding volume of 5ml. 5ml of CHO CD fusion + 10ug / ml Puromycin was added, and the cells were screened on a high-speed shaker at 37℃, 8% CO2, and 220rpm / min. Cell density and viability were counted every 3 days, and the medium was changed to fresh CHO CD fusion + 10ug / ml Puromycin for further screening. After multiple passages and screenings, the cell viability reached 95% or higher, and the stable cell line screening was completed.

[0195] 4.3.3 Fedbatch Cell Line and Protein Preparation: The stable cell line obtained above was inoculated into Fedbatch cells and cultured for 14 days. The supernatant was collected and purified, and the protein expression level of CHO COL3A1 was detected after different coenzyme combinations. It was found that the expression levels of the 9-coenzyme and 10-coenzyme combinations were the highest, reaching 1.5 g / L.

[0196] Table 2. Expression levels of COL3A1 protein in single cells with different coenzyme combinations

[0197] 1 6 coenzyme combinations 20.1±1.1 2 7 coenzyme combinations 21.0±0.9 3 8 coenzyme combinations 22.1±0.8 4 9 coenzyme combinations 25.5±1.5 5 10 coenzyme combinations 26.0±1.0

[0198] 5. Collagen Coenzyme Combination - Triple Helix Ratio of Stable Collagen III Strains

[0199] 5.1 Monoclonal Cell Resuscitation: Remove monoclonal cells from liquid nitrogen and place them in a 37°C water bath. Shake the cryovials for 1-2 minutes to rapidly thaw the cell suspension. In a biosafety cabinet, use a pipette to transfer the cells from the cryovials to a centrifuge tube containing 10 ml of CHO CD Fusion (Merck). Centrifuge at 850 rpm for 5 minutes, discard the supernatant, count the cells, and seed them at 0.5*10^6 / ml into 125 ml shake flasks. The seeding medium is CHO CD Fusion + 6 mM Gln. Incubate at 37°C and 125 rpm in a shaker.

[0200] 5.2 Monoclonal cell resuscitation culture: CHO cells in a shaker were passaged every 2 days at a passage density of 0.5*10^6 / ml and a volume of 30ml. After 3 passages, the cells were used for stable cell line selection.

[0201] 5.3 Screening of stable cell lines:

[0202] 5.3.1 Plasmid electroporation: Take single clone cells, count them, the viability is more than 95% and the number of cells is 1*10^7. After centrifugation, discard the supernatant, resuspend in electroporation buffer (Suzhou Yida), and add different amounts of helper enzyme expression plasmids as shown in Table 2.

[0203] 10 μg of each helper enzyme plasmid was used, with a total electroporation volume of 200 μL. The cell suspension was transferred to a 0.2 mm transfer cup. The electroporator (Suzhou Yida X-Porator H1) parameters were set as follows: 200 V, 1000 μF, 6 T, 1000 ms. After setting the parameters, electroporation was performed. After electroporation, all cells were transferred to a T25 culture medium containing 5 ml of CHO CD fusion medium and 6 ml of Gln medium, and then placed in a cell culture incubator at 37°C and 5% CO2.

[0204] 5.3.2 Cell line screening: After electroporation, cells were cultured in an incubator for 2 days. Cell density and viability were calculated. Cells were seeded into TPP tubes for screening at a density of 1*10^6 / ml and a minimum seeding volume of 5ml. 5ml of CHO CD fusion + 10ug / ml Puromycin was added, and the cells were screened on a high-speed shaker at 37℃, 8% CO2, and 220rpm / min. Cell density and viability were counted every 3 days, and the medium was replaced with fresh CHO CD fusion + 10ug / ml Puromycin for further screening. After multiple passages and screenings, the cell viability reached 95% or higher, and the stable cell line screening was completed.

[0205] 5.3.3 Fedbatch Cell Line and Protein Preparation: The stable cell line obtained above was inoculated into Fedbatch cells and cultured for 14 days. The supernatant was collected and purified, and the triple helix ratio of CHO COL3A1 protein expression was detected after different coenzyme combinations. It was found that the 10 coenzyme combinations showed the highest triple helix ratio, reaching 90.7%.

[0206] Table 3. Trihex ratio of COL3A1 protein with different coenzyme combinations

[0207] 1 6 coenzyme combinations 45.2％ 2 7 coenzyme combinations 56.1％ 3 8 coenzyme combinations 72.7％ 4 9 coenzyme combinations 88.4％ 5 10 coenzyme combinations 90.7％

[0208] 6. Collagen Coenzyme Addition Amount - Construction of Stable Collagen III Strains

[0209] 6.1 Monoclonal Cell Resuscitation: Remove monoclonal cells from liquid nitrogen and place them in a 37°C water bath. Shake the cryovials for 1-2 minutes to rapidly thaw the cell suspension. In a biosafety cabinet, use a pipette to transfer the cells from the cryovials to a centrifuge tube containing 10 ml of CHO CD Fusion (Merck). Centrifuge at 850 rpm for 5 minutes, discard the supernatant, count the cells, and seed them at 0.5 * 10^6 / ml into 125 ml shake flasks. The seeding medium is CHO CD Fusion + 6 mM Gln. Incubate at 37°C and 125 rpm in a shaker.

[0210] 6.2 Monoclonal cell resuscitation culture: CHO cells in a shaker were passaged every 2 days at a passage density of 0.5*10^6 / ml and a volume of 30ml. After 3 passages, the cells were used for stable cell line selection.

[0211] 6.3 Screening of stable cell lines:

[0212] 6.3.1 Plasmid electroporation: Take single clone cells, count them, the viability is more than 95% and the number of cells is 1*10^7. After centrifugation, discard the supernatant, resuspend in electroporation buffer (Suzhou Yida), and add different amounts of coenzyme expression plasmids as shown in Table 4.

[0213] Table 4. Number of plasmids for 10 coenzyme combinations

[0214] 1 10 coenzyme combinations 10ug 2 10 coenzyme combinations 15ug 3 10 coenzyme combinations 20ug 4 10 coenzyme combinations 30ug 5 10 coenzyme combinations 40ug

[0215] Add different amounts of coenzyme plasmids, with a total electroporation volume of 200 μL. Transfer the cell suspension to a 0.2 mm transfer cup and set the electroporator (Suzhou Yida X-Porator H1) parameters as follows: 200 V, 1000 μF, 6 T, 1000 ms. After setting the parameters, perform electroporation. After electroporation, transfer all cells to a T25 culture medium containing 5 ml of CHO CD fusion + 6 Mm Gln medium and incubate in a cell culture incubator at 37°C and 5% CO2.

[0216] 6.3.2 Cell line screening: After electroporation, cells were cultured in an incubator for 2 days. Cell density and viability were calculated. Cells were seeded into TPP tubes for screening at a density of 1*10^6 / ml and a minimum seeding volume of 5ml. 5ml of CHO CD fusion + 10ug / ml Puromycin was added, and the cells were screened on a high-speed shaker at 37℃, 8% CO2, and 220rpm / min. Cell density and viability were counted every 3 days, and the medium was replaced with fresh CHO CD fusion + 10ug / ml Puromycin for further screening. After multiple passages and screenings, the cell viability reached 95% or higher, and the stable cell line screening was completed.

[0217] 6.3.3 Febbatch Cell Line and Protein Preparation: The stable cell line obtained above was inoculated into Febbatch cells and cultured for 14 days. The supernatant was collected for purification, and the proportion of triple helices of CHO COL3A1 protein with different plasmid amounts was detected. It was found that the highest proportion of expressed triple helices, reaching over 95%, was obtained by transforming 30 μg and 40 μg of the 10 coenzyme combination.

[0218] Table 5. Proportions of triple helices after 10 coenzyme combinations were transformed into different numbers of plasmids.

[0219] 1 10 coenzyme combinations 10ug 89.5％ 2 10 coenzyme combinations 15ug 90.3％ 3 10 coenzyme combinations 20ug 93.1％ 4 10 coenzyme combinations 30ug 95.4％ 5 10 coenzyme combinations 40ug 95.6％

[0220] Example 3: Purification and Purity Analysis of CHO Collagen

[0221] The harvested cell culture supernatant was adjusted to pH 8.5 with 2M Tris, diluted with purified water to a conductivity of 6.0–8.0 mS / cm, filtered through a 0.45 μm filter, and loaded onto the NM90 Agarose HCM composite cation exchange chromatography column. First, the column was equilibrated with 5 column volumes of cation exchange chromatography equilibration buffer: 20 mM Tris, 50 mM NaCl, pH 8.5. After loading, the column was washed with 8 column volumes of cation exchange chromatography equilibration buffer, followed by elution with cation exchange chromatography elution buffer: 20 mM Tris, 500 mM NaCl, pH 8.5. Collection began when UV210 reached 100 mAU and stopped when UV210 decreased to 200 mAU. The collected sample was adjusted to pH 2.0–3.0 with glacial acetic acid, and then digested with 0.2% pepsin at room temperature for 4–8 hours. The digested sample was further purified using an NM Super 150 molecular sieve to obtain pure CHO COL3A1.

[0222] The purity of CHO COL3A1 was analyzed using high-performance liquid chromatography (HPLC) and SDS-PAGE protein electrophoresis. The HPLC methods are as follows:

[0223]

[0224] The results are as follows Figure 3 And as shown in the table below: Figure 3 The HPLC chromatogram of CHO COL3A1 shows a peak retention time consistent with that of human umbilical cord blood type 3 collagen, indicating that its molecular weight is consistent with natural collagen (human umbilical cord blood type 3 collagen). HPLC area normalization and analysis of CHO COL3A1 revealed that the purity of CHO-synthesized collagen COL3A1 was significantly improved in the presence of coenzymes. This indicates that the purity of CHO-synthesized collagen COL3A1 is greatly enhanced in the presence of coenzymes. Compared to COL3A1 without coenzymes, the addition of coenzyme 6 increased the purity by 2.73%, coenzyme 7 by 7.29%, coenzyme 8 by 8.26%, coenzyme 9 by 11.45%, and coenzyme 10 by 8.9%. According to the YY / T 1888-2023 medical device industry standard "Recombinant Humanized Collagen," coenzyme combinations with a purity higher than 95% (coenzyme 7, coenzyme 8, coenzyme 9, and coenzyme 10) all meet the requirements.

[0225] Table 6. Purity of collagen COL3A1 after transfer to different coenzyme combinations

[0226]

[0227] The purified COL3A1 protein was subjected to SDS-PAGE protein electrophoresis, as follows: Figure 4 The results showed that the prepared collagen was a single band with a purity of ≥90%, which significantly improved the purity compared to human umbilical cord blood collagen with multiple bands.

[0228] Example 4: Detection of gene expression levels in cell lines

[0229] Sample preparation: Centrifuge the constructed cell lines and control blank cell lines (cell quantity 1.5–2E6 cells) at 25°C and 1500 rpm for 10 min, then carefully aspirate the supernatant from each PCR tube using a pipette. Perform RNA extraction according to the instructions of the “TaKaRa MiniBEST Universal RNA Extraction Kit” (Code No. 9767).

[0230] Sample reverse transcription: Take out a new PCR tube and add samples according to the table below (the reaction system can be scaled up proportionally). Cap the tube, mix well, centrifuge for 5 seconds, and place it in a PCR instrument. Reaction conditions: 42℃ for 15 min, 95℃ for 3 min, 4℃ forever. After reverse transcription, the samples can be stored at -20℃ and qPCR detection can be performed within two days.

[0231] 5×Fasting-RT Super Mix 4μL Total RNA 1μg Rnase-Free ddH2O To bring the volume up to 20 μL

[0232] qPCR primer information

[0233] β-actin-F (upstream primer of internal reference gene β-actin) CCTGAACCCTAAGGCCAACC β-actin-R (downstream primer of internal reference gene β-actin) AGCCTGGATGGCTACGTACA COL3-F AAAGGATGGTTCTCCTGGCG COL3-R CTCTCATACCAGGTCCCCCA LH1-1F ACCAGATCGGGTTCGAGAGA LH1-1R ATGGAGCAGTTGTACCGCAA LH3-6F CGCCGAGACAGAAGGATACC LH3-6R AAGACTCGGCAGAGAACAGC PPI-2F GGGCTTCGGCTACAAGAACT PPI-2R GGTCCGTAGTGCTTCAGCTT PDI-3F GTGGCCTTCGACGAGAAGAA PDI-3R CTCGCCGTTGTAGTCGATCA Hsp47-1F GATCGTGGAGATGCCTCTGG Hsp47-1R CCACCACTCCTTTAGGCAGG LH2-2F TCGACCCCCTGAAGAGAGAG LH2-2R GTCCAAGAGTTGGGCACGTA GLT25D1-2F AGATGGTCCCCTGAGTCTCC GLT25D1-2R ACCAGCCATTCTCTCAGCAC P4HA1-5F ACTTCGCCAGAAAGGACGAG P4HA1-5R GTTGGACACCCACTTGTTGC Bip-2F GCACATTCGACCTGACTGGA Bip-2R TCCAGCTCGTTTCTGGTGTC CRTAP-2F ACCACTACGTGGAAGTGCTG CRTAP-2R TCACCTTGTCGTTCTGGTCG

[0234] qPCR reaction solution preparation

[0235] primer mixture 1.6 TB Green Premix Ex Taq II 10 ROX Reference Dye 0.4 EASY Dilution 8 Total volume 20

[0236] Add 18 μL of qPCR reaction solution to each of the 8-tube strips, add 2 μL of sample to each well, and spot each sample twice. Centrifuge for 5 seconds and prepare for PCR.

[0237] qPCR reaction conditions (Run)

[0238]

[0239] Result calculation: relative mRNA expression level = 2 - (ΔT sample group - ΔT control group) Where: ΔT = CT target gene - CTβ-actin

[0240] The results are shown in the table below. The results show that, compared with the control blank cell line, both collagen gene and coenzyme gene are expressed in the constructed cell line.

[0241] Table 7. Gene expression levels of the constructed cell line and the control cell line

[0242]

[0243]

[0244] Example 5: Sequence Coverage Study

[0245] The purity and molecular weight of purified CHO COL3A1 protein were studied using high-performance liquid chromatography-mass spectrometry (HPLC-MS). The chromatographic column used was an ACQUITY UPLC Peptide BEH C18 300A, 1.7 μm, 2.1 × 150 mm. The mobile phase was: MPA: 0.1% FA (formic acid), 2% ACN (acetonitrile), 98% H2O; MPB: 0.1% FA (formic acid), 98% ACN (acetonitrile), 2% H2O. The injection volume was 4 μg, the detection wavelength was UV 240 nm, and the column temperature was 40 °C. The chromatographic gradient conditions are shown in Table 1. The results showed that the sequence coverage determined by mass spectrometry was consistent with the theoretical sequence.

[0246] chromatographic gradient conditions

[0247]

[0248] Example 6: Structural Characterization of Collagen

[0249] 1. Identification of the triple helix structure by Pepsin restriction enzyme digestion

[0250] After digestion with Pepsin, the target protein was found to have a distinct Pepsin-resistant band at the apparent molecular weight of 140 kDa. Figure 5 As shown, this demonstrates that the collagen expressed from CHO cells has a triple helix structure.

[0251] 2. Identification of the triple helix structure using circular dichroism chromatograph

[0252] Instrument: Circular dichroism chromatograph (CD) J-1500.

[0253] On-machine parameters:

[0254] Data spacing 0.1nm rate 50nm / min

[0255] Structural testing of CHO COL3A1: The sample concentration was 0.2 mg / ml, and a 1 mm cuvette was used. The blank control was acetic acid buffer.

[0256] The results are as follows Figure 6 As shown, samples expressed by CHO cell lines without coenzyme do not exhibit triple helix structures. Samples expressed by CHO cell lines containing coenzyme exhibit characteristic peaks of triple helix structures, and the intensity ratio of their positive to negative absorption peaks (RPN) is 0.11, falling within the triple helix ratio range of 0.09–1.5.

[0257] Purified COL3A1 protein was diluted with 0.2% acetic acid to concentrations of 0.1 mg / mL, 0.2 mg / mL, 0.35 mg / mL, and 0.5 mg / mL for detection. The results showed that the CD[mdeg] signal increased with increasing concentration, but the RPN value did not differ significantly. Figure 7 And as shown in the table below.

[0258] RPN 0.11 0.10 0.11 0.11

[0259] The purified COL3A1 protein was diluted to 0.2 mg / mL with 0.2% acetic acid solution and incubated at 4℃, 25℃, 37℃, and 57℃ for 10 min before detection. The RPN value was calculated. Figure 8 As shown in the table below, there is no significant difference in RPN values ​​at different temperatures.

[0260] RPN 0.11 0.11 0.11 0.11

[0261] 3. Electron microscopy structure identification

[0262] Scanning electron microscopy (SEM) uses an electron beam to scan the surface of a sample and collect secondary electron signals to form an image. For recombinant humanized collagen, SEM is mainly used to observe its surface microstructure. When collagen forms membranes, scaffolds, and other structures, SEM can clearly show the interstitial structure and fiber distribution on its surface.

[0263] Use an air compressor to blow clean the surface. Cut a small 8*8mm section of carbon conductive tape and stick it onto the sample stage. Peel off the white protective layer on the surface of the conductive tape. Place the COL3A1 sample with the test side facing up and fix it on the sample stage. Then cut an appropriate length of 1mm wide conductive tape to position the four corners of the sample to prevent it from falling off the sample stage.

[0264] Fix the sample on the sputtering apparatus tray and close the sputtering apparatus cover; turn on the power of the sputtering apparatus to evacuate the vacuum until the pressure is < -0.08 MPa, then press Flash to clean the dust adsorbed on the surface of the gold target; press "Leak" to evacuate the vacuum until the pressure is < -0.08 MPa, then press START to start sputtering the gold, setting the sputtering time to 10 seconds. After completion, turn off the power and wait for the vacuum in the sputtering apparatus chamber to return to normal pressure before opening the chamber cover to remove the sample.

[0265] Testing instruments

[0266] SEM-EDS Sigma500-Xflash6 / 60 Zeiss-Bruker Ion sputtering instrument 109Auto Cressington

[0267] Test conditions

[0268]

[0269]

[0270] The results are as Figure 9 shown. At 20 μm and 100 μm resolutions, COL3A1 presents a three-dimensional structure, mainly fibrous and reticular structures.

[0271] Example 7 Stability Study

[0272] The freeze-dried collagen powder was dissolved in purified water, PB solution, and physiological saline to a 10 mg / mL solution, respectively. After incubating the solutions in a water bath at (37 ± 0.5) °C for 4 h, the visible foreign substance inspection method was used, and no gelation or flocculation should be observed visually. The SDS-PAGE electrophoresis purity before and after heating was detected by electrophoresis, and the sample loading amount was required to be 10 μg. Result determination: If there is no gelation or flocculation in the test solution, the test sample is determined to be qualified; otherwise, it is determined to be unqualified. If there is no significant difference in the SDS-PAGE electrophoresis purity and gray scale change of the test sample before and after heating, the test sample is determined to be qualified; otherwise, it is determined to be unqualified.

[0273] The results are as Figure 10 shown. The collagen products have good thermal stability in 0.2% acetic acid, PB solution, and physiological saline, without gelation or flocculation, and there is no obvious difference in electrophoresis before and after heating.

[0274] Example 8 Cell Activity Detection

[0275] Cell Proliferation Activity Detection

[0276] 1) Experimental grouping

[0277] 1) Negative group: DMEM medium containing 0.1% FBS.

[0278] 2) Positive group: 1. A mg / mL and 0.5 mg / mL bovine type I + III collagen (Hebei Junxing) diluted with DMEM medium containing 0.1% FBS.

[0279] 3) Sample group: 1. A mg / mL and 0.5 mg / mL Col3A1 diluted with DMEM medium containing 0.1% FBS.

[0280] 4) 2) Cell seeding: The NIH-3T3 cells with good growth status and a confluence of 80%-90% were digested and counted. The digested NIH-3T3 cells were diluted with DMEM complete medium containing 10% FBS and seeded in a 96-well plate at a density of 4.5×104 cells / cm2. After seeding, the plate was placed in a carbon dioxide incubator and cultured at a temperature of 37 °C and a carbon dioxide concentration of 5% for 24 hours.

[0281] 5)3) Drug administration: After culturing NIH-3T3 cells for 24 hours, the supernatant was removed from the 96-well plate, and the cells were washed once with 200 μL of DMEM medium. 200 μL of the corresponding solution was added to each well according to the group, and each group was repeated 5 times. The cells were then placed in a carbon dioxide incubator at 37°C and 5% carbon dioxide concentration.

[0282] 6) CCK8 assay: Prepare CCK8 reagent and DMEM complete medium containing 10% FBS at a ratio of 1:10. After culturing in 96-well plates for 24 hours, remove the supernatant and add 110 μL of the prepared CCK8 solution. Add a blank control group (containing only CCK8 reagent and DMEM complete medium containing 10% FBS, without cells). Incubate in a CO2 incubator for 1 hour, then measure the absorbance at 450 nm using a microplate reader. The greater the cell proliferation, the higher the absorbance (OD) value.

[0283] Formula for calculating relative cell proliferation activity:

[0284]

[0285] In vitro cell proliferation experiments, to some extent, simulate the process of cell proliferation in vivo. Cell proliferation activity is an effective indicator of the biological activity of collagen; the faster the proliferation rate, the better the biological activity of collagen. For example... Figure 11 As shown in Table 8, COL3A1 collagen exhibited significant cell proliferation-promoting activity at concentrations of 1 mg / mL and 0.5 mg / mL, with the 0.5 mg / mL concentration showing significantly better cell proliferation-promoting ability than the positive control. This demonstrates that COL3A1 possesses good cell proliferation-promoting activity, providing strong experimental evidence for its application in related biomedical fields.

[0286] Table 8: Results of relative cell proliferation activity

[0287]

[0288] Cell migration activity assay

[0289] 1) Experimental group: negative group: DMEM basal medium.

[0290] Positive group: 1.0 mg / mL and 0.5 mg / mL bovine type I+III collagen (Hebei Junxing) diluted with DMEM medium.

[0291] Sample groups: 1.0 mg / mL and 0.5 mg / mL Col3A1 diluted with DMEM basal medium.

[0292] 2) Experimental preparation: First, use a marker pen to draw four horizontal lines evenly on the back of the 6-well plate, with a ruler, about 0.5 cm apart.

[0293] 3) Sample coating: Take a 6-well plate with the lines drawn, add 1 mL of the corresponding solution to each well according to the group (add 0.2% acetic acid to the positive group), repeat 2 replicates for each group, coat overnight at 4℃, remove the supernatant after coating, and carefully wash once with PBS.

[0294] 4) Cell plating: Digest and count NIH-3T3 cells in good growth condition with a confluence of 80%-90%. Dilute the digested NIH-3T3 cells with DMEM complete medium containing 10% FBS, and plate them at 7×10⁶ cells / mL. 4 cells / cm 2 Add the coated 6-well plate, place it in a CO2 incubator at 37°C and 5% CO2 concentration.

[0295] 5) Scratch Marking: After culturing in 6-well plates for 24±2 hours, use a 10μL pipette tip, aligned with a ruler, to make scratches as perpendicular as possible to the horizontal lines on the back of the plate. The pipette tip should be vertical and not tilted. Then, wash the cells twice with DMEM basal medium to remove the scratched cells. Add 2mL of DMEM basal medium to each well (for the control group, add 2mL of DMEM medium containing 10% FBSDMEM). Incubate in a CO2 incubator at 37℃ and 5% CO2 concentration. Take samples and photographs at 0h and 24h. Calculate the scratch area for each image using ImageJ image processing software.

[0296] 6) Formula for calculating cell migration rate:

[0297]

[0298] In vitro cell migration experiments of fibroblasts, to a certain extent, simulate the in vivo cell migration process, directly reflecting the interactions between cells and the extracellular matrix, and the influence of the matrix on cell-cell relationships. Cell migration activity is a more effective indicator of collagen biological activity; the higher the migration rate and the faster the migration speed, the better the collagen's biological activity. Figure 12 As shown in Table 9, after 24 hours of culture, 1 mg / mL and 0.5 mg / mL COL3A1 significantly promoted cell migration, with migration rates of 30.1% and 30.2%, respectively. Furthermore, at a concentration of 0.5 mg / mL, the migration-promoting activity of COL3A1 was significantly superior to the positive control. This result further demonstrates that COL3A1 possesses certain biological activity in cell migration, providing important experimental data support for its application in tissue repair, regeneration, and other related fields.

[0299] Table 9: Cell migration rate results

[0300]

[0301] Cell adhesion ability test

[0302] 1) Experimental Grouping

[0303] Negative group (NC): 0.2% acetic acid.

[0304] Positive group (PC): 0.1 mg / mL bovine type I+III collagen (Hebei Junxing) diluted with 0.2% acetic acid.

[0305] Low concentration group: 0.02 mg / mL Col3 diluted with 0.2% acetic acid.

[0306] Medium concentration group: 0.05 mg / mL Col3 diluted with 0.2% acetic acid.

[0307] High concentration group: 0.1 mg / mL Col3 diluted with 0.2% acetic acid.

[0308] 2) Plate Coating: Take a 96-well plate that has not undergone TC treatment, add 100 μL of the corresponding solution to each well according to the group, with 6 replicates per group, and incubate overnight at 2-8℃. Then, use a pipette to aspirate the liquid from the wells, being careful not to touch the collagen coating at the bottom, and add 100 μL of 1% BSA-DPBS solution to block the uncoated areas. Incubate at 37℃ and 5% CO2 for 1 hour. After 1 hour, aspirate the liquid from the wells and wash all coated wells with DBPS, repeating three times to ensure the removal of unbound blocking agent and impurities, creating a stable environment for cell adhesion experiments.

[0309] 3) NIH-3T3 cell incubation: NIH-3T3 cells in good growth condition with a confluence of 80%-90% were digested and counted. The digested NIH-3T3 cells were resuspended in DMEM medium containing 1% FBS to a concentration of 8 × 10⁶ cells / mL. 5 Cells / mL, add 100 μL of cell suspension to each well. Take another 96-well plate as the pre-centrifugation cell group, add an equal volume of cell suspension, and incubate at 37°C, 5% CO2 for 50 min. After incubation, remove the 96-well plate and add 250 μL of DPBS to each well except the pre-centrifugation cell group wells. Cover the plate surface with sealing film. Centrifuge the plate upside down at 300g for 5 min, wash once with DPBS, and carefully remove the supernatant from the pre-centrifugation cell group plate.

[0310] 4) CCK8 assay: Prepare CCK8 reagent and DMEM complete medium containing 10% FBS at a ratio of 1:10, and add 110 μL of the prepared CCK8 reagent to each group. A blank control group (containing only CCK8 reagent and DMEM complete medium containing 10% FBS, without cells) was also added. The groups were incubated in a CO2 incubator for 1 hour, and the absorbance was measured at 450 nm using a microplate reader.

[0311] 5) Formula for calculating cell adhesion rate:

[0312]

[0313] As shown in Table 10 and Figure 13 As shown, after incubating cells in the experimental group plates for 50 min and centrifuging, the average adhesion rates of COL3 samples were 62.1%, 62.0%, and 61.2% compared to before centrifugation. The average adhesion rate of the positive group was 60.5%, while the negative group showed almost no cell adhesion. These results indicate that the proportion of cell adhesion is related to COL3, but it is not a simple concentration-dependent relationship; a low concentration of 0.02 mg / mL has reached the saturation point for adhesion efficacy. Furthermore, there were significant differences between each group and the negative group, suggesting that COL3 has good cell adhesion-promoting activity and has potential value in research and applications related to cell-extracellular matrix interactions.

[0314] Table 10: Cell adhesion rate results

[0315]

[0316] Example 9. Animal safety experiment

[0317] The day before the experiment, all equipment was checked, and all necessary reagents, consumables, and instruments were prepared. High-temperature resistant instruments were sterilized by moist heat. Twenty New Zealand rabbits were used. Anesthesia was administered via intravenous injection of 0.3% sodium pentobarbital at 1 mL / kg via the ear. After anesthesia took effect, the animals were fixed in the rabbit platform, and their backs were shaved and skin prepared as the injection site. Ten rabbits served as the control group, and the other ten as the experimental group. The control group (CK) received 0.3 mL of PBS buffer, while the experimental group received 0.3 mL of the collagen (COL3) of this invention injected subcutaneously. The animals' condition was observed weekly during the experiment, and any adverse reactions were recorded. Special attention was paid to any abnormalities such as redness, swelling, ulceration, or hyperplasia at the injection site (once a week) for four consecutive weeks. Samples were collected from each group at the corresponding observation endpoint. Sufficient blood samples were collected from each group before and after injection (4 weeks) at the corresponding observation endpoint for complete blood count and immunogenicity testing. Samples were taken from each group 4 weeks after injection to detect the expression levels of collagen genes (COL1 and COL3).

[0318] The results showed that after 4 weeks of continuous observation, no abnormalities such as redness, swelling, ulceration, or hyperplasia occurred at the injection sites in either the experimental or control groups. After 4 weeks, embedded sections of skin tissue were prepared for immunohistochemical staining, and no significant differences were observed between the experimental and control groups. Before and after injection (4 weeks), there were no significant differences in blood routine examinations and immunogenicity (IL10 and TNF-α) test results between the experimental and control groups. In conclusion, these results indicate that subcutaneous injection of collagen has no significant impact on the skin and demonstrates good safety.

[0319] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A method for preparing recombinant human type III collagen, characterized in that, The method includes the following steps: a. Introducing the gene sequence of the human type III collagen α1 chain and coenzyme combination into host cells; and b. Under suitable conditions, culture the host cells from step a to obtain human type III collagen with a triple helix structure. The coenzyme combination is selected from the following group: 1) The coenzyme combination is a 6-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, and Hsp47; 2) The coenzyme combination is a 7-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47 and LH2; 3) The coenzyme combination is an 8-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2 and GLT25D1; 4) The coenzyme combination is a 9-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2, GLT25D1, and Bip; or 5) The coenzyme combination is a 10-coenzyme combination, including P4HA1, PPIB, LH1, LH3, PDI, Hsp47, LH2, GLT25D1, Bip and CRTAP; The sequence of P4HA1 is shown in SEQ ID NO. 2, the sequence of LH3 is shown in SEQ ID NO. 3, the sequence of PPIB is shown in SEQ ID NO. 4, the sequence of LH1 is shown in SEQ ID NO. 5, the sequence of GLT25D1 is shown in SEQ ID NO. 6, the sequence of PDI is shown in SEQ ID NO. 7, the sequence of HSP47 is shown in SEQ ID NO. 8, the sequence of LH2 is shown in SEQ ID NO. 9, the sequence of BIP is shown in SEQ ID NO. 10, or the sequence of CRTAP is shown in SEQ ID NO.

11.

2. The preparation method according to claim 1, characterized in that, The optimized sequence of the human type III collagen α1 chain is shown in SEQ ID NO.

1.

3. The preparation method according to claim 1, characterized in that, The recombinant human type III collagen promotes cell proliferation, anti-wrinkle, skin repair, or a combination thereof.

4. A nucleic acid, characterized in that, The nucleic acid comprises the gene sequence of the human type III collagen α1 chain and coenzyme combination as described in claim 1.

5. A carrier, characterized in that, The vector contains the nucleic acid as described in claim 4.

6. A host cell, characterized in that, The host cell contains the vector as described in claim 5 or its genome is integrated with the nucleic acid as described in claim 4.

Images