Staphylococcus aureus esx gene deletion strain extracellular vesicles and preparation method and application thereof

Abstract

This invention relates to the fields of biomedicine and nanodelivery technology, and particularly to extracellular vesicles of a Staphylococcus aureus esx gene deletion strain, its preparation method, and its applications. This invention selects the Staphylococcus aureus esxA gene / esxB gene as the knockout target, obtaining Staphylococcus aureus esxA gene deletion strains / Staphylococcus aureus esxB gene deletion strains. Based on these strains, bacterial extracellular vesicles (BEVs) were prepared. These BEVs can effectively control the accumulation of toxic components while retaining membrane structure and vesicle release capacity. Furthermore, experimental verification shows that under the same culture conditions, the yield of BEVs increased by approximately 2-4 times with this gene deletion strain. This characteristic significantly improves the efficiency of large-scale BEV preparation, laying the foundation for its industrial application.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and nanodelivery technology, and in particular to an extracellular vesicle of a Staphylococcus aureus strain with the esx gene deletion, its preparation method, and its application. Background Technology

[0002] Bacterial extracellular vesicles (BEVs) are natural nanoscale carriers with excellent biocompatibility, membrane fusion capability, and delivery efficiency. Extracellular vesicles (SaEVs) produced by Staphylococcus aureus can carry a variety of active ingredients, including proteins, nucleic acids, and small molecule drugs, showing potential as a drug delivery system. However, BEVs produced by wild-type Staphylococcus aureus carry multiple virulence factors that may trigger strong immune responses and cytotoxicity, thus limiting their application in clinical drug delivery.

[0003] Currently, the common method for preparing biovesicles (BEVs) involves culturing wild-type Staphylococcus aureus in media such as LB or TSB to the logarithmic growth phase, followed by extraction of BEVs via ultracentrifugation combined with membrane filtration or density gradient centrifugation. However, these vesicles are often rich in virulence proteins, whose virulence components may lead to host cell apoptosis or trigger a strong immune response. For example, existing literature reports that wild-type SaEVs, due to carrying multiple bioactive molecules (such as enzymes, lipoproteins, toxins, DNA, and RNA), exhibit high cytotoxicity and immunogenicity, particularly when applied in vivo, potentially causing severe inflammatory responses and leading to systemic toxicity. This issue has become a major obstacle to the practical application of Staphylococcus aureus BEVs as drug delivery carriers. Therefore, reducing toxicity and increasing BEV yield is one of the key directions for developing Staphylococcus aureus BEV delivery systems.

[0004] It is evident that existing technologies face problems such as high toxicity, low yield, and unstable delivery efficiency of Staphylococcus aureus BEVs, and there is still a lack of an engineered solution that can both increase EV yield and significantly reduce toxicity and enhance biosafety. Summary of the Invention

[0005] The purpose of this invention is to provide a Staphylococcus aureus esx gene deletion strain extracellular vesicles, its preparation method, and its applications, to solve the problems existing in the prior art. This invention provides a Staphylococcus aureus esx gene deletion strain with high BEV production and low toxicity to host cells.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a Staphylococcus aureus esx gene deletion strain, obtained by knocking out the esx gene of Staphylococcus aureus using homologous recombination technology; the esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.24.

[0008] This invention provides a method for constructing the above-mentioned Staphylococcus aureus esx gene deletion strain, comprising the following steps:

[0009] (1) Extraction of genomic DNA from Staphylococcus aureus Newman strain;

[0010] (2) Homologous arms of the Staphylococcus aureus esx gene were obtained by PCR amplification;

[0011] (3) The fusion fragment of the upstream and downstream homologous arms of the Staphylococcus aureus esx gene was obtained by PCR amplification;

[0012] (4) The fusion fragment and pKOR1 plasmid are recombined to construct the homologous recombination plasmid pKOR1-esx;

[0013] (5) Electroporate the homologous recombinant plasmid pKOR1-esx into the wild-type Staphylococcus aureus to obtain a Staphylococcus aureus esx gene deletion strain;

[0014] Preferably, in step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.2; the primer pair used for PCR amplification of the downstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.5 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.6; the primer pair used for PCR amplification of the downstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.7 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.8.

[0015] In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.12.

[0016] This invention provides a method for preparing extracellular vesicles from a Staphylococcus aureus strain with the esx gene deletion, the method comprising the following steps:

[0017] (1) Extraction of genomic DNA from Staphylococcus aureus Newman strain;

[0018] (2) Homologous arms of the Staphylococcus aureus esx gene were obtained by PCR amplification;

[0019] (3) The fusion fragment of the upstream and downstream homologous arms of the Staphylococcus aureus esx gene was obtained by PCR amplification;

[0020] (4) The fusion fragment and pKOR1 plasmid are recombined to construct the homologous recombination plasmid pKOR1-esx;

[0021] (5) Electroporate the homologous recombinant plasmid pKOR1-esx into the wild-type Staphylococcus aureus to obtain a Staphylococcus aureus esx gene deletion strain;

[0022] (6) The Staphylococcus aureus strain with the esx gene deletion was subjected to ultracentrifugation and filtration to obtain Staphylococcus aureus extracellular vesicles.

[0023] Preferably, in step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.2; the primer pair used for PCR amplification of the downstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.5 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.6; the primer pair used for PCR amplification of the downstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.7 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.8.

[0024] In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.12.

[0025] This invention provides extracellular vesicles of Staphylococcus aureus esx gene deletion strain obtained by the above preparation method.

[0026] This invention provides the application of the above-mentioned Staphylococcus aureus esx gene deletion strain extracellular vesicles in any of the following:

[0027] (1) Preparation of drug delivery carriers;

[0028] (2) Vaccine preparation;

[0029] (3) Preparation of functional drugs;

[0030] (4) Production of extracellular vesicles of Staphylococcus aureus strain with esx gene deletion;

[0031] (5) Prepare products for the production of extracellular vesicles of Staphylococcus aureus esx gene deletion strain.

[0032] This invention provides a drug delivery system comprising the above-mentioned extracellular vesicles of Staphylococcus aureus esx gene deletion strain and an exogenous drug;

[0033] The exogenous drugs include proteins, nucleic acids, or small molecule drugs.

[0034] This invention provides the application of the esx gene in promoting the secretion of extracellular vesicles in Staphylococcus aureus. By knocking out the esx gene in Staphylococcus aureus, the effect of promoting the secretion of extracellular vesicles in Staphylococcus aureus is achieved.

[0035] The esx gene includes either the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO. 23; and the nucleotide sequence of the esxB gene is shown in SEQ ID NO. 24.

[0036] This invention provides a method for promoting the secretion of extracellular vesicles in Staphylococcus aureus, comprising the steps of knocking out the esx gene in Staphylococcus aureus, and then subjecting the resulting strain to ultracentrifugation and filtration to obtain extracellular vesicles of Staphylococcus aureus; wherein the esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO. 23; and the nucleotide sequence of the esxB gene is shown in SEQ ID NO. 24.

[0037] The present invention discloses the following technical effects:

[0038] This invention selects the *Staphylococcus aureus* esxA / esxB gene (ESAT-6-like secretion system, esx system) as the knockout target. The esx system is a type III secretion system of *Staphylococcus aureus*, widely involved in the efflux of virulence proteins and host cell penetration. Deletion of the esx system significantly inhibits bacterial invasiveness and immune activation potential, but has little impact on the survival and basic metabolism of the strain. This invention provides a *Staphylococcus aureus* esx gene deletion strain (*Staphylococcus aureus* esxA gene deletion strain / *Staphylococcus aureus* esxB gene deletion strain), and *Staphylococcus aureus* BEVs were prepared based on these strains. These BEVs can effectively reduce the accumulation of toxic components while retaining membrane structure and vesicle release capacity. Meanwhile, this invention experimentally verified that, under the same culture conditions, the yield of *Staphylococcus aureus* esxA gene deletion strain / *Staphylococcus aureus* esxB gene deletion strain BEVs was approximately 2-4 times higher than that of wild-type *Staphylococcus aureus*. This may be related to the mutual inhibition between the virulence regulation system and the vesicle release pathway. This characteristic significantly improves the efficiency of large-scale preparation of *Staphylococcus aureus* BEVs, laying the foundation for its industrial application.

[0039] Meanwhile, BEVs possess a variety of biological activities, playing a crucial role not only in bacterial self-regulation and interaction with host cells, but also demonstrating significant potential for development and application. The preparation strategy for Staphylococcus aureus esxA gene-deleted strains / Staphylococcus aureus esxB gene-deleted strains provided by this invention optimizes extraction efficiency while ensuring high yield, high purity, and low cytotoxicity. Therefore, based on this, genetic engineering can be used to enhance their immunogenicity, reduce their toxicity, and stimulate innate and adaptive immune responses, thus giving them vaccine development potential. Furthermore, as nanoscale particles, Staphylococcus aureus BEVs have good diffusion capacity and bioavailability and can carry exogenous substances. Through surface modification and the design and addition of functional ligands to enhance their targeting, they can serve as drug delivery carriers.

[0040] In summary, this invention provides new technical means and platforms for the preparation of novel vaccines for various infectious diseases, the delivery of specific drugs, and anti-tumor treatment through genetic engineering and the creation of BEVs with specific targeting capabilities. Attached Figure Description

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0042] Figure 1 Transmission electron microscope image of Newman wild-type BEVs; scale bar is 500 nm; arrows indicate Newman wild-type BEVs;

[0043] Figure 2 Transmission electron microscope image of Newman wild-type BEVs; scale bar is 100 nm; arrows indicate Newman wild-type BEVs.

[0044] Figure 3 Transmission electron microscopy image of Staphylococcus aureus esxA gene deletion strain BEVs; scale bar is 500 nm; arrows indicate Staphylococcus aureus esxA gene deletion strain BEVs;

[0045] Figure 4 Transmission electron microscopy image of Staphylococcus aureus esxA gene deletion strain BEVs; scale bar is 100 nm; arrows indicate Staphylococcus aureus esxA gene deletion strain BEVs;

[0046] Figure 5Transmission electron microscopy image of Staphylococcus aureus esxB gene deletion strain BEVs; scale bar is 500 nm; arrows indicate Staphylococcus aureus esxB gene deletion strain BEVs;

[0047] Figure 6 Transmission electron microscopy image of Staphylococcus aureus esxB gene deletion strain BEVs; scale bar is 100 nm; arrows indicate Staphylococcus aureus esxB gene deletion strain BEVs;

[0048] Figure 7 Particle size-particle density distribution of Newman wild-type BEVs;

[0049] Figure 8 Particle size-particle density distribution of Staphylococcus aureus esxA gene deletion strain BEVs;

[0050] Figure 9 Particle size-particle density distribution of Staphylococcus aureus esxB gene deletion strain BEVs;

[0051] Figure 10 Bar chart showing protein concentrations in Newman wild-type BEVs, Staphylococcus aureus esxA gene deletion BEVs, and Staphylococcus aureus esxB gene deletion BEVs.

[0052] Figure 11 Bar chart showing the cytotoxicity of Newman wild-type BEVs, Staphylococcus aureus esxA gene deletion BEVs, and Staphylococcus aureus esxB gene deletion BEVs.

[0053] Figure 12 This is a BCA test standard curve. Detailed Implementation

[0054] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0055] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0056] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0057] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0058] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0059] Example 1

[0060] 1. Construction of Staphylococcus aureus esxA / esxB deletion strains

[0061] 1.1 Extraction of Staphylococcus aureus genomic DNA

[0062] Staphylococcus aureus Newman strain (kindly provided by Professor Yu Liquan of the College of Life Science and Technology, Heilongjiang Bayi Agricultural Reclamation University) was inoculated on Columbia blood agar medium for resuscitation and incubated statically in a constant temperature incubator at 37℃ and 5% CO2 for 24 hours. Single colonies were picked and transferred to 10 mL of TSB nutrient broth (Qingdao Haibo Biotechnology Co., Ltd.) and placed in a constant temperature shaking incubator at 220 rpm and 37℃ for 14 hours.

[0063] Take 1 mL of the above bacterial solution into an EP tube and centrifuge at 12000g to collect the bacterial cells.

[0064] Take 70 μL of lysozyme solution (the concentration of lysozyme in the solution is 50 mg / mL), add it to the above EP tube and mix by pipetting. This is to dissolve the cell wall of Staphylococcus aureus.

[0065] The EP tubes were incubated in a metal bath at 37°C for 1 hour. Since the cell walls of Staphylococcus aureus are relatively thick, the cell wall disruption time can be appropriately extended.

[0066] Take out the EP tube and add 20 μL of proteinase K solution (the concentration of proteinase K in the solution is 20 mg / ml) into the EP tube. Mix well by pipetting.

[0067] Use a pipette to add 220 μL of GB buffer to the EP tube, mix well by pipetting, and place it back in a metal bath for incubation at 70°C for 20 min.

[0068] After removing the EP tube, add 220 μL of anhydrous ethanol to the EP tube and mix thoroughly by blowing.

[0069] Transfer all the mixed liquid in the EP tube into a centrifuge column, then place the centrifuge column into a collection tube, and centrifuge at 12000 rpm for 30 seconds. After centrifugation, discard the waste liquid in the collection tube.

[0070] Add 500 μL of GD buffer to the centrifuge column and centrifuge at 12,000 rpm for 30 seconds. After centrifugation, discard the waste liquid in the collection tube.

[0071] Add 600 μL of LPW buffer to the centrifuge column and centrifuge at 12,000 rpm for 30 seconds. After centrifugation, discard the waste liquid in the collection tube. Repeat this step twice.

[0072] Place the centrifuge column in the centrifuge again and centrifuge at 12,000 rpm for 2 minutes. After centrifugation, discard the waste liquid in the collection tube, then open the centrifuge column and let it stand at room temperature for about 20 minutes to allow the inner membrane of the centrifuge column to dry.

[0073] Place the above centrifuge column into a new EP tube, add 125 μL of elution buffer to the centrifuge column, let it stand at room temperature for 2-5 minutes, and then centrifuge at 12000 rpm for 2 minutes. After centrifugation, discard the centrifuge column. The liquid in the EP tube is the extracted Staphylococcus aureus DNA.

[0074] 1.2 Amplification and fusion PCR reaction of upstream and downstream homologous fragments of esxA / esxB genes

[0075] Using the extracted Staphylococcus aureus genomic DNA as a template, the upstream and downstream homologous fragments of the target gene were amplified respectively. The amplification primers are shown in Table 1. The target fragments were then excised and recovered.

[0076] Add 1.5 μL each of upstream and downstream homologous fragments (SEQ ID NO.17-SEQ ID NO.20, as shown in Table 4) (total DNA mass approximately 600 ng) to a 50 μL system, along with 25 μL of 2×Pfu PCR Master-Mix and 18 μL of ultrapure water for complementary extension to form a full-length fusion PCR product (intermediate product, whose nucleotide sequences are shown in SEQ ID NO.21-SEQ ID NO.22, as shown in Table 4). The amplification system and procedure are shown in Tables 2 and 3.

[0077] Add 2 μL each of esxA primer (esxA-UF: TTACGGGCAAGGTTCAGACC, SEQ ID NO.25; esxA-DR: GTTCTTGAACGGCATCAGCA, SEQ ID NO.26) and esxB primer (esxB-UF: AAGCAGATGGTGGCAAGGTT, SEQ ID NO.27; esxB-DR: TGGTCAGCCATCGGTTGTAC, SEQ ID NO.28) to the above intermediate product, and amplify the full-length fusion fragment according to the following reaction conditions: 94℃ for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 30 cycles; 72℃ for 7 min to obtain esxA fusion PCR product and esxB fusion PCR product. The nucleotides of esxA fusion PCR product are shown in SEQ ID NO.21; the nucleotides of esxB fusion PCR product are shown in SEQ ID NO.22.

[0078] Table 1. Detailed information about the primers.

[0079] name sequence SEQ ID NO. upstream homologous fragment of esxA-F TCGTGTGTCCATCTTTGGCA 1 upstream homologous fragment of esxA-R GTGAATAAAGACACCGGCGC 2 esxA downstream homologous fragment-F ACGTTGCTGAGTCTGGTTTGA 3 esxA downstream homologous fragment-R TCGCTGTATTGTGCTCGTCA 4 upstream homologous fragment of esxB-F GCAAAGAGAAATGGACGGCC 5 upstream homologous fragment of esxB-R TGTACGTCCTTTGCTGTGCT 6 esxB downstream homologous fragment -F TCGATACGATTGGGCGTGTT 7 esxB downstream homologous fragment-R TGGCAAATTCCGTACCCCAA 8 esxA fusion fragment-F TCGTGTGTCCATCTTTGGCA 9 esxA fusion fragment-R GTGAATAAAGACACCGGCGC 10 esxB fusion fragment-F GCAAAGAGAAATGGACGGCC 11 esxB fusion fragment-R TGTACGTCCTTTGCTGTGCT 12 pKORl-esxA-F TCGTGTGTCCATCTTTGGCA 13 pKORl-esxA-R GTGAATAAAGACACCGGCGC 14 pKORl-esxB-F GCAAAGAGAAATGGACGGCC 15 pKORl-esxB-R TGTACGTCCTTTGCTGTGCT 16

[0080] Table 2 Amplification System

[0081] Components Volume (μL) Upstream homologous fragments 1.5 Downstream homologous fragments 1.5 2×PfuPCRMaster—Mix 25 <![CDATA[ddH2O]]> 18 DNA template 4

[0082] Table 3 Amplification Procedure

[0083]

[0084] Table 4 Nucleotide sequence information

[0085]

[0086]

[0087]

[0088]

[0089] 1.3 Construction of homologous recombination plasmid pKOR1-esxA / esxB

[0090] Add 2 μL of BP Clonase™ II Enzyme Mix, 4 μL of fusion PCR product (approximately 300 ng of esxA or esxB fusion PCR product), 1 μL of pKOR1 plasmid (approximately 150 ng, kindly provided by Professor Yu Fangyou of Shanghai Pulmonary Hospital), and 3 μL of LTE buffer to a PCR tube. Mix well and incubate at 25°C for 18 h. Then, add 1 μL of 2 μg / μL proteinase K solution and incubate at 37°C for 30 min to stop the BP reaction, obtaining the BP reaction product. Transform the above BP reaction product into Escherichia coli DC10B competent cells (kindly provided by Professor Yu Fangyou of Shanghai Pulmonary Hospital). Spread all the transformed bacterial culture on LB agar plates containing ampicillin (100 μL / mL) and incubate overnight at 37°C. Subsequently, plasmids were extracted using a plasmid miniprep kit (Axygen, USA), and the obtained plasmids were verified by PCR. Primer information is shown in SEQ ID NO.13-SEQ ID NO.16, yielding knockout plasmids (pKORl-esxA and pKORl-esxB) with correct sequences. The PCR reaction conditions were as follows: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 2 min, 30 cycles; 72℃ for 7 min. The reaction system is shown in Table 5.

[0091] Table 5 Reaction System

[0092] Components Volume (μL) Mixtap enzyme 12.5μL Primers 0.5 μL × 2 (0.5 μL each of forward and reverse primers) plasmid template 1μL <![CDATA[ddH2O]]> 10.5μL

[0093] 1.4 Constructing a gene knockout strain of Staphylococcus aureus Newman strain

[0094] (1) Preparation of electrocompetent cells of Staphylococcus aureus Newman strain

[0095] 1) Pick a single colony of Staphylococcus aureus Newman strain using a disposable inoculation loop, add 5 mL of TSB liquid medium, and incubate overnight at 37°C with a shaking incubator at 220 rpm.

[0096] 2) The next day, add the mixture to 100 mL of fresh TSB broth at a ratio of 1:100, and place it in a 37°C, 200 rpm shaking incubator to allow the OD to develop. 600 It rose to around 1.0.

[0097] 3) Dispense the bacterial suspension into 50 mL sterile tubes, incubate on ice for 30 min, then centrifuge at 4°C and 4,500 rpm for 10 min. Carefully remove the supernatant with a pipette.

[0098] 4) Add 40 mL of pre-chilled 0.5 M sucrose solution to each centrifuge tube, vortex to mix, incubate on ice for 5 min, centrifuge at 4,500 rpm for 10 min at 4 °C, and carefully remove the supernatant with a pipette. Wash repeatedly 3 times with 0.5 M sucrose solution. Resuspend the precipitate with 1 mL of pre-chilled 0.5 M sucrose solution to obtain electrocompetent Staphylococcus aureus Newman strain bacteria. Aliquot 50 μL into each EP tube and store at -80 °C.

[0099] (2) Electroconversion

[0100] 1) Take about 0.5-1 μg of knockout plasmid pKOR1-esxA or pKOR1-esxB and mix it with 50 μL of Staphylococcus aureus Newman strain electrotransfer competent bacteria. After incubating on ice for 20 min, transfer it into a pre-cooled 0.2 cm electrotransfer cuvette and let it stand for 5-10 min for electrotransformation (voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω).

[0101] 2) After electroporation, 1 mL of TSB liquid medium was quickly added to the clean bench and the culture was incubated at 30°C and 150 rpm for 2 h. The transformed bacteria were then spread on TSB plates containing 10 μL / mL chloramphenicol and incubated at 30°C for 24 h.

[0102] (3) Screening and identification of deletion strains

[0103] 1) Inoculate single colonies that are PCR positive into 3 mL of TSB medium containing 10 μg / mL chloramphenicol (TSB). Cm10 In the culture, it was incubated overnight at 30°C.

[0104] 2) Take 50 mL of TSB Cm10 The culture medium was diluted with the bacterial solution obtained in step 1) at a volume ratio of 1:100 and cultured overnight at 42°C.

[0105] 3) Take 50 mL of TSB Cm5 The culture medium (TSB medium containing 5 μg / mL chloramphenicol) was diluted with the bacterial culture obtained in step 2) at a volume ratio of 1:100 and cultured overnight at 42°C.

[0106] 4) Dilute the bacterial solution obtained in step 3) and apply it to TSB. Cm10 Incubate overnight at 42°C on plates. Pick a single colony and incubate in 5 mL of TSB medium at 30°C overnight.

[0107] 5) Take 10g of the bacterial solution obtained in step 4). 4 Dilute 1-fold and spread onto TSB plates containing 1 μg / mL adehydrotetracycline (ATc), and incubate at 37°C for 24 h.

[0108] 6) Pick 50 colonies and inoculate them separately onto a regular TSB plate and a TSB plate. Cm10 Plates, incubate overnight at 37°C.

[0109] 7) Genomic DNA was extracted from 10 colonies that grew exclusively on TSB plates, using the Newman wild-type strain (Staphylococcus aureus Newman strain) genome as a control. PCR reaction conditions were: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 3 min, 30 cycles; 72℃ for 7 min. The PCR amplification system is shown in Table 2. If the Newman wild-type strain could amplify a DNA fragment of the target size, while the validated knockout strain could not amplify a DNA fragment of the target size, it indicates that the target gene has been successfully knocked out.

[0110] 2. Isolation and concentration of BEVs (extracellular vesicles) from wild-type Staphylococcus aureus, Staphylococcus aureus esxA gene deletion strain, and Staphylococcus aureus esxB gene deletion strain.

[0111] 2.1 Preparation of Newman wild-type strain, *Staphylococcus aureus* esxA gene deletion strain, and *Staphylococcus aureus* esxB gene deletion strain bacterial suspensions: The Newman wild-type strain, *Staphylococcus aureus* esxA gene deletion strain, and *Staphylococcus aureus* esxB gene deletion strain were inoculated onto Columbia blood agar medium for resuscitation and incubated statically at 37℃ and 5% CO2 for 24 h. Single colonies were picked and transferred to 10 mL of TSB nutrient broth (Qingdao Haibo Biotechnology Co., Ltd.) and incubated in a constant temperature shaking incubator at 37℃ and 220 rpm for 14 h. After 14 h of incubation, 4 mL of the obtained bacterial suspension was poured into 400 mL of TSB broth.

[0112] Shake well in nutrient broth, place in a 37℃, 5% CO2 constant temperature shaking incubator, and incubate at 220 rpm and 37℃ for 48 h.

[0113] 2.2. Sterilization and concentration of bacterial solution by centrifugation and filtration

[0114] The bacterial culture was centrifuged (7000×g for 5 min), and the supernatant was collected after centrifugation, discarding the precipitate. The supernatant was then filtered for the first time using a 0.22 μm filter membrane. The filtrate was enriched and concentrated using an ultrafiltration vessel (with a magnetic stirrer) to obtain concentrated solutions of different bacterial strains. The enrichment and concentration factor was 10-fold, the molecular weight cutoff was 100 kDa, the magnetic stirrer speed was 320-350 rpm, and a certain pressure was applied to the ultrafiltration vessel using a sterile nitrogen cylinder. The pressure indicator was that the drip rate of the waste liquid (liquid with a molecular weight less than 100 kDa) from the ultrafiltration vessel was 1 drop / 5-7 seconds.

[0115] 2.3 Obtaining BEVs precipitate by ultra-high speed centrifugation

[0116] Concentrated solutions of different strains were poured into separate ultracentrifuge tubes, and sterile PBS buffer was added to a final volume of 29.9 mL. The tubes were then balanced and subjected to a first ultracentrifugation (4°C, 100,000 × g for 4 h). After centrifugation, the supernatant was discarded, and the precipitate was resuspended in sterile PBS buffer and subjected to another ultracentrifugation (4°C, 100,000 × g for 1 h). After centrifugation, the supernatant was discarded, and the precipitate was resuspended in 1 mL of sterile PBS buffer. Any clumps of precipitate adhering to the tube walls were broken up using a disposable inoculation loop. The resuspended solutions were then filtered a second time to obtain BEVs of the Newman wild-type strain, the Staphylococcus aureus esxA gene deletion strain, and the Staphylococcus aureus esxB gene deletion strain, with a filter membrane particle size of 0.22 μm.

[0117] 3. BCA protein quantification method for determining BEV protein concentration

[0118] 25 μL of BEVs from the Newman wild-type strain, the Staphylococcus aureus esxA gene-deleted strain, and the Staphylococcus aureus esxB gene-deleted strain, along with 200 μL of BSA standard, were respectively added to the wells of a 96-well plate, with three replicates for each sample. 200 μL of BCA working solution was added to each well, mixed thoroughly, and incubated at 37°C for 30 min. After cooling to room temperature, the absorbance of each sample and the BSA standard was measured using a microplate reader in the range of 540-590 nm. A standard curve was plotted; the BCA standard curve is shown below. Figure 12 As shown, the standard curve is: Y = 0.3209X + 0.1018, R0 2 =09972. The protein concentration in the sample is calculated using a standard curve, such as... Figure 10 As shown.

[0119] 4. Observation of BEV morphological characteristics using transmission electron microscopy (TEM)

[0120] 20 μL of BEVs from Newman wild-type strain, Staphylococcus aureus esxA gene deletion strain, and Staphylococcus aureus esxB gene deletion strain were respectively dropped into a copper grid for electron microscopy and allowed to stand for 2 min. The mixture was then fixed with phosphotungstic acid solution for 10 min and allowed to air dry at room temperature. The samples were then observed and photographed under a transmission electron microscope.

[0121] 5. Nanoparticle Tracking Analysis (NTA) technology for analyzing BEV particle characteristics

[0122] BEVs from the Newman wild-type strain, the *Staphylococcus aureus* esxA gene deletion strain, and the *Staphylococcus aureus* esxB gene deletion strain were diluted 100-fold, 1000-fold, and 10000-fold with sterile PBS buffer. The sample inlet of the analyzer was rinsed with 10 mL of sterile buffer, and 1 mL of the diluted sample was loaded. Particle densities of 10-1 were selected. 6 -10 7 Data statistics and analysis were performed on the diluents within the specified range.

[0123] 6. CCK-8 assay for BEV cytotoxicity

[0124] With a density of 5×10 3 A549 cells at a controlled density were seeded into 96-well plates, with 1 mL of DMEM medium containing 10% FBS added to each well. The plates were incubated at 37°C and 5% CO2 for 24 h. BEVs from the Newman wild-type strain, the Staphylococcus aureus esxA gene deletion strain, and the Staphylococcus aureus esxB gene deletion strain were added to the same 96-well plates at concentration gradients of 10 μg / mL and 30 μg / mL, respectively, and labeled as: Nm-10 μg / mL group, Nm-30 μg / mL group, esxA deletion strain-10 μg / mL group, esxA deletion strain-30 μg / mL group, esxB deletion strain-10 μg / mL group, and esxB deletion strain-30 μg / mL group. Three replicates were set up for each sample. A control group without BEVs and a blank group without BEVs and cells were also included. The plates were incubated for another 24 h. Add 10 μL of CCK-8 reagent to each well, incubate at 37°C and 5% CO2 for 1 h, and then measure the absorbance (OD value) of each well using a microplate reader (450 nm wavelength). Calculate cell viability based on the OD values ​​of each group: Cell viability (%) = OD value of treatment group - OD value of blank group / OD value of control group - OD value of blank group.

[0125] 8. Results

[0126] Electron micrographs of Newman wild-type BEVs are shown below. Figure 1 and Figure 2 As shown in the figure, the electron micrograph of Staphylococcus aureus esxA gene deletion strain BEVs is as follows. Figure 3 and Figure 4 Electron micrograph of Staphylococcus aureus esxB gene deletion strain BEVs is shown below. Figure 5 and Figure 6 The results showed that the particle density of Staphylococcus aureus esxA gene deletion strain BEVs and Staphylococcus aureus esxB gene deletion strain BEVs was significantly higher than that of Newman wild-type strain BEVs.

[0127] The particle size-particle density distribution of Newman wild-type BEVs is shown in the figure. Figure 7 As shown in the figure. The results showed that the particle concentration of the Newman wild-type BEVs was 1.3E+10 Particles / mL, the average particle size was 141.2 nm, and the main particle size distribution range of the Newman wild-type BEVs was 79.6 nm to 212.1 nm.

[0128] The particle size-particle density distribution of Staphylococcus aureus esxA gene deletion strain BEVs is shown in the figure below. Figure 8 As shown in the figure. The results showed that the particle concentration of Staphylococcus aureus esxA gene deletion strain BEVs was 6.9E+10 Particles / mL, the average particle size was 148.4 nm, and the main particle size distribution range of Staphylococcus aureus esxA gene deletion strain BEVs was 81.0 nm-213.8 nm.

[0129] The particle size-particle density distribution of Staphylococcus aureus esxB gene deletion strain BEVs is shown in the figure below. Figure 9 As shown in the figure. The results showed that the particle concentration of Staphylococcus aureus esxB gene deletion strain BEVs was 2.9E+10 Particles / mL, the average particle size was 142.7 nm, and the particle size of Staphylococcus aureus esxB gene deletion strain BEVs mainly ranged from 83.5 nm to 209.3 nm.

[0130] The protein concentrations of Newman wild-type BEVs, Staphylococcus aureus esxA gene deletion BEVs, and Staphylococcus aureus esxB gene deletion BEVs are as follows: Figure 10 As shown in the figure. The results showed that the protein concentrations of Staphylococcus aureus esxA gene deletion strain BEVs and Staphylococcus aureus esxB gene deletion strain BEVs (1156.7 μg / mL and 633.2 μg / mL, respectively) were significantly higher than the protein concentration of Newman wild-type strain BEVs (256.5 μg / mL).

[0131] The cytotoxicity of Newman wild-type BEVs, Staphylococcus aureus esxA gene-deleted BEVs, and Staphylococcus aureus esxB gene-deleted BEVs was detected using CCK-8 assay. Results were presented as cell viability, such as... Figure 11As shown in the figure. The results showed that the cytotoxicity of *Staphylococcus aureus* esxA gene deletion strain BEVs and *Staphylococcus aureus* esxB gene deletion strain BEVs was not significantly different from that of Newman wild-type BEVs at different concentration gradients (10 μg / mL, 30 μg / mL). The cell survival rate was 95% in the Nm-10 μg / mL group; 99% in the Nm-30 μg / mL group; 96% in the esxA deletion strain-10 μg / mL group; 100% in the esxA deletion strain-30 μg / mL group; 99% in the esxB deletion strain-10 μg / mL group; and 99% in the esxB deletion strain-30 μg / mL group.

[0132] In summary, according to the Staphylococcus aureus gene knockout method and extracellular vesicle extraction method provided in this invention, Newman wild-type BEVs, Staphylococcus aureus esxA gene-deleted BEVs, and Staphylococcus aureus esxB gene-deleted BEVs can be obtained. The differences in morphological characteristics, average particle size, particle density, and protein content of Newman wild-type BEVs, Staphylococcus aureus esxA gene-deleted BEVs, and Staphylococcus aureus esxB gene-deleted BEVs were analyzed and compared using transmission electron microscopy, nanoparticle tracking analysis, and BCA protein quantification. The results showed that Newman wild-type BEVs, Staphylococcus aureus esxA gene-deleted BEVs, and Staphylococcus aureus esxB gene-deleted BEVs all exhibited a clear double-membrane spherical structure under transmission electron microscopy. Meanwhile, the average particle size of the three groups of BEVs was not significantly different. However, the average particle density of Staphylococcus aureus esxA / esxB gene-deleted BEVs was greater than that of Newman wild-type BEVs. The BCA protein quantification assay also showed that the protein concentration of Staphylococcus aureus esxA / esxB gene deletion strain BEVs was significantly higher than that of Newman wild-type strain BEVs. Furthermore, CCK-8 assays revealed that the cytotoxicity of Staphylococcus aureus esxA / esxB gene deletion strain BEVs was not significantly different from that of Newman wild-type strain BEVs at different concentration gradients.

[0133] The method described in this invention shows that the particle density and protein content of Staphylococcus aureus esxA / esxB gene deletion strain BEVs are significantly higher than those of Newman wild-type strain BEVs. This result is consistent with the results of electron microscopy. Furthermore, the obtained gene deletion strain has high purity of extracellular vesicles and low toxicity to host cells, which has the advantage of wide applicability.

[0134] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for preparing an extracellular vesicle of a Staphylococcus aureus esx gene deletion strain cell, characterized by, The preparation method includes the following steps: (1) Extraction of genomic DNA from Staphylococcus aureus Newman strain; (2) Homologous arms of the Staphylococcus aureus esx gene were obtained by PCR amplification; (3) The fusion fragment of the upstream and downstream homologous arms of the Staphylococcus aureus esx gene was obtained by PCR amplification; (4) The fusion fragment and pKOR1 plasmid are recombined to construct the homologous recombination plasmid pKOR1-esx; (5) Electroporate the homologous recombinant plasmid pKOR1-esx into the wild-type Staphylococcus aureus to obtain the Staphylococcus aureus esx gene deletion strain; (6) The Staphylococcus aureus strain with the esx gene deletion was subjected to ultracentrifugation and filtration to obtain Staphylococcus aureus extracellular vesicles; The esx gene is either the esxA gene or the esxB gene; In step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.2; the primer pair used for PCR amplification of the downstream homologous arm of the esxA gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.5 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.6; the primer pair used for PCR amplification of the downstream homologous arm of the esxB gene includes the upstream primer with the nucleotide sequence shown in SEQ ID NO.7 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.

8. In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

12.

2. Use of knocking out esx genes in promoting secretion of extracellular vesicles from Staphylococcus aureus, characterized in that, By knocking out the esx gene in Staphylococcus aureus, the secretion of extracellular vesicles in Staphylococcus aureus can be promoted. The esx gene is either the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.

24.

3. A method of promoting secretion of Staphylococcus aureus extracellular vesicles, characterized in that, The process includes knocking out the esx gene in Staphylococcus aureus and then performing ultracentrifugation and filtration on the resulting strain to obtain Staphylococcus aureus extracellular vesicles. The esx gene is either the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.24.

Images