System constructed based on sVCAM-1 biosensing probe and used for evaluating heart rehabilitation effect

The detection of sVCAM-1 levels in serum samples by sVCAM-1 biosensing probe based on a pyrene-doped metal organic framework has solved the complexity and cost of evaluation of exercise therapy effects in the prior art, and achieved high sensitivity and accuracy assessment of cardiac rehabilitation effects.

CN120539418APending Publication Date: 2025-08-26TIANJIN CHEST HOSPITAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510456605.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-04-11
Filing Date
2025-04-12
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

The existing methods of evaluating the effect of exercise therapy rely on traditional physiological indicators, and have shortcomings such as low sensitivity, complex operation, high cost, requiring professional personnel to operate and complex sample preprocessing, making it difficult to accurately evaluate the effect of exercise therapy in patients with cardiovascular disease.

Method used

The sVCAM-1 biosensing probe based on a pyrene-doped metal organic frame is used to detect the sVCAM-1 level in the serum sample to evaluate the cardiac rehabilitation effect. It has the advantages of simple operation, low cost, no sample pretreatment, and low professionalism requirements for operators.

Benefits of technology

It has achieved high sensitivity, accuracy, reproducibility and stability evaluation of cardiac rehabilitation effects, with a wide detection range and extremely low detection limits, and can effectively evaluate the effectiveness of exercise therapy in patients with cardiovascular disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005355657060000011
    Figure HDA0005355657060000011
  • Figure HDA0005355657060000012
    Figure HDA0005355657060000012
  • Figure HDA0005355657060000021
    Figure HDA0005355657060000021
Patent Text Reader

Abstract

The invention provides an application of an sVCAM-1 biosensing probe in preparation of a product for evaluating a heart rehabilitation effect, and also provides a system for evaluating the heart rehabilitation effect, which is constructed based on the sVCAM-1 biosensing probe. The sVCAM-1 biosensing probe is an optical biosensing probe based on a pyrene doped metal organic framework, and the sVCAM-1 biosensing probe evaluates the heart rehabilitation effect by detecting the level of sVCAM-1 in a serum sample. Evaluation of the heart rehabilitation effect refers to evaluation of the movement intervention rehabilitation effect of coronary heart disease, senile myocardial infarction, arrhythmia or valvular heart disease. The sVCAM-1 level is detected by adopting a biosensing method so as to evaluate the heart rehabilitation effect, and the method has the advantages of accurate detection result, high sensitivity, simplicity in operation, low cost, no need of sample pretreatment and low professional requirement on operators.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical detection technology, and in particular relates to the application of an sVCAM-1 biosensor probe in the preparation of a product for evaluating cardiac rehabilitation effects. At the same time, a system for evaluating cardiac rehabilitation effects constructed based on the sVCAM-1 biosensor probe is proposed. Background Art

[0002] Cardiovascular disease (CVD) includes coronary heart disease (CHD), myocardial infarction (MI) in the elderly, arrhythmias or valvular heart disease. Cardiovascular disease is one of the leading causes of death and disability worldwide. Due to the complex pathology and multifactorial nature of cardiovascular disease, its effective management requires a comprehensive intervention strategy. In recent years, exercise therapy has become an indispensable non-drug treatment for cardiovascular disease rehabilitation, significantly improving patients' cardiovascular function and quality of life. However, the therapeutic effect of exercise therapy is highly dependent on exercise intensity: insufficient exercise has little improvement effect, while excessive exercise may increase the burden on the heart and even lead to adverse outcomes.

[0003] Currently, the evaluation of the effects of exercise therapy relies primarily on traditional physiological indices, such as heart rate, blood pressure, electrocardiogram, and cardiopulmonary function tests. Furthermore, the efficacy of exercise therapy varies among individuals, making precise evaluation methods crucial. Although these indices can reflect basic cardiovascular status, they have limitations in assessing the underlying biological mechanisms associated with cardiovascular disease. Consequently, increasing attention has focused on the use of biomarkers, such as inflammatory responses and cell adhesion, to assess the effects of exercise therapy.

[0004] Vascular cell adhesion molecule-1 (VCAM-1) is expressed on endothelial cells through transcriptional induction, activating endothelial signaling pathways, triggering morphological changes, and promoting leukocyte migration. sVCAM-1, the soluble form of VCAM-1, has been shown to be associated with multiple cardiovascular risk factors, and its levels decrease with treatment. Detection of sVCAM-1 provides a quantifiable basis for evaluating the anti-inflammatory effects of exercise therapy and can effectively assess improvements in endothelial function, making it an important tool for assessing the effectiveness of exercise therapy in patients with cardiovascular disease.

[0005] Currently, many methods are available for quantifying sVCAM-1, such as enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance (SPR), surface-enhanced Raman scattering (SERS), and electrochemical impedance spectroscopy (EIS). However, these methods have drawbacks such as low sensitivity, complex operation, high cost, the need for specialized personnel, and complex sample pretreatment. Therefore, the development of a highly sensitive, simple, low-cost method that does not require sample pretreatment is crucial for promoting clinical intervention and management of cardiovascular disease and developing more effective exercise-based interventions. Summary of the Invention

[0006] In view of this, in order to solve the above technical problems, the present invention proposes an application of an sVCAM-1 biosensor probe in the preparation of a product for evaluating the effect of cardiac rehabilitation, and also proposes a system for evaluating the effect of cardiac rehabilitation based on the sVCAM-1 biosensor probe. The present invention adopts a biosensor method to detect the sVCAM-1 level, thereby evaluating the effect of cardiac rehabilitation. While the detection results are accurate and highly sensitive, it has the advantages of simple operation, low cost, no need for sample pretreatment, and low professional requirements for operators.

[0007] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0008] Application of an sVCAM-1 biosensor probe in the preparation of a product for evaluating cardiac rehabilitation effects.

[0009] In some preferred application embodiments of the present invention, the product is a reagent, a kit, a reagent composition or a chip.

[0010] In some preferred application embodiments of the present invention, the evaluation of cardiac rehabilitation effect is the evaluation of rehabilitation effect of coronary heart disease, senile myocardial infarction, arrhythmia or valvular heart disease.

[0011] In some preferred application embodiments of the present invention, the evaluation of cardiac rehabilitation effect is the evaluation of the rehabilitation effect of coronary heart disease, senile myocardial infarction, arrhythmia or valvular heart disease through exercise therapy intervention.

[0012] In some preferred application embodiments of the present invention, the sVCAM-1 biosensor probe evaluates cardiac rehabilitation effects by detecting the level of sVCAM-1 in serum samples.

[0013] In some preferred application embodiments of the present invention, the detection range of the sVCAM-1 biosensor probe for sVCAM-1 is 2 ng / mL to 50 μg / mL, and the detection limit is 0.62 ng / mL.

[0014] In some preferred application embodiments of the present invention, the sVCAM-1 biosensing probe is an optical biosensing probe based on a pyrene-doped metal-organic framework.

[0015] In some preferred embodiments of the present invention, the sVCAM-1 biosensor probe is prepared by the following method:

[0016] S1. Prepare DMF solutions of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid respectively;

[0017] S2. Mix the three solutions prepared in S1, sonicate, dissolve, and react at 100-120°C;

[0018] S3. After the reaction is completed, the generated product is washed several times and then dried to obtain a pyrene-doped metal-organic framework composite material PCA-UiO-66;

[0019] S4. Disperse the PCA-UiO-66 obtained in S3 in deionized water and add a FAM-labeled aptamer. The sequence of the FAM-labeled aptamer is: 5'-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3' (SEO ID NO: 1). After the incubation, centrifuge, wash multiple times, and resuspend in ultrapure water to obtain an sVCAM-1 biosensor probe, denoted as Apt@PCA-UiO-66.

[0020] The prepared pyrene-doped metal-organic framework composite PCA-UiO-66 does not have covalent bonds to restrict the diffusion of PCA. Instead, it is mainly restricted by π-π bonds and steric hindrance. PCA is not rigidly fixed within the PCA-UiO-66 framework. However, due to the strong hydrophobicity of pyrenecarboxylic acid, it does not easily leave UiO-66 in aqueous solution, achieving flexible and stable confinement of PCA within the PCA-UiO-66 framework. This feature can greatly reduce the background signal of the entire system, making PCA-UiO-66 very suitable as a substrate material for the preparation of biosensor probes. Due to its phosphate backbone, the aptamer has a negative potential and pi-bonds in aqueous solution, while the more neutral potential of PCA-UiO-66 is conducive to the adsorption of the aptamer. When the aptamer is adsorbed on the MOF, the "flexible" PCA inside the MOF forms a new π-π stack with the aptamer. However, because the aptamer is still adsorbed on the MOF surface, the PCA is not released prematurely. When the target protein (sVCAM-1) is present, the target protein strips the aptamer off the surface of the MOF, and the aptamer is released into the solution along with pyrenecarboxylic acid. Pyrenecarboxylic acid restores its ground state fluorescence, and the concentration of the protein (sVCAM-1) can be quantified by quantifying the ground state fluorescence of pyrenecarboxylic acid.

[0021] In some preferred application embodiments of the present invention, in S1, the mass ratio of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid is 1-4:5:0.1-1; in the DMF solution of zirconium oxychloride, the mass ratio of zirconium oxychloride to DMF is 1-4:90-100; in the DMF solution of terephthalic acid, the mass ratio of terephthalic acid to DMF is 5:90-100; and in the DMF solution of 1-pyrenecarboxylic acid, the mass ratio of 1-pyrrolidinecarboxylic acid to DMF is 0.1-1:90-100.

[0022] In some preferred application embodiments of the present invention, in S2, the reaction time is 20 to 30 hours.

[0023] In some preferred application embodiments of the present invention, in S3, the generated product is washed three times with DMF and ethanol respectively.

[0024] In some preferred application embodiments of the present invention, in S4, the concentration of PCA-UiO-66 dispersed in deionized water is 500-1000 μg / mL; the concentration of the FAM-labeled aptamer is 200-500 nM; and the incubation time is 50-90 min.

[0025] In some preferred application embodiments of the present invention, the detection method of the sVCAM-1 biosensor probe product is as follows: after mixing the undiluted serum sample with the suspension of the sVCAM-1 biosensor probe, incubating for 40 minutes, the fluorescence signal in the supernatant is measured using a microplate reader at an excitation wavelength of 360 nm.

[0026] The second aspect of the present invention provides a system for evaluating cardiac rehabilitation effects based on sVCAM-1 biosensor probes.

[0027] In some preferred embodiments of the system for evaluating cardiac rehabilitation effects of the present invention, the sVCAM-1 biosensor probe is an optical biosensor probe based on a pyrene-doped metal-organic framework.

[0028] The sVCAM-1 biosensor probe is prepared by the following method:

[0029] S1. Prepare DMF solutions of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid respectively; wherein the mass ratio of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid is 1-4:5:0.1-1; in the DMF solution of zirconium oxychloride, the mass ratio of zirconium oxychloride to DMF is 1-4:90-100; in the DMF solution of terephthalic acid, the mass ratio of terephthalic acid to DMF is 5:90-100; in the DMF solution of 1-pyrenecarboxylic acid, the mass ratio of 1-pyrrolidinecarboxylic acid to DMF is 0.1-1:90-100;

[0030] S2. Mix the three solutions prepared in S1, sonicate, dissolve, and react at 100-120°C for 20-30h;

[0031] S3. After the reaction is completed, the generated product is washed three times with DMF and ethanol respectively to obtain the pyrene-doped metal-organic framework composite material PCA-UiO-66;

[0032] S4. Disperse the PCA-UiO-66 obtained in S3 in deionized water at a concentration of 500-1000 μg / mL, and add a FAM-labeled aptamer at a concentration of 200-500 nM; the sequence of the FAM-labeled aptamer is: 5'-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3' (SEO ID NO: 1); incubate for 50-90 min, centrifuge, wash multiple times, and resuspend in ultrapure water to obtain an sVCAM-1 biosensor probe.

[0033] Compared with the prior art, the use of the sVCAM-1 biosensor probe in the preparation of a product for evaluating cardiac rehabilitation effects and the system for evaluating cardiac rehabilitation effects constructed based on the sVCAM-1 biosensor probe have the following advantages:

[0034] (1) The present invention uses a biosensor method to detect sVCAM-1 levels and then evaluate cardiac rehabilitation effects. Compared with existing enzyme-linked immunosorbent assays and other methods, the present invention is simpler to operate, less expensive, and requires less professional expertise from operators. At the same time, it can ensure high sensitivity and accuracy of the test results.

[0035] (2) The present invention uses an optical biosensor probe based on a pyrene-doped metal-organic framework (Apt@PCA-UiO-66) as an sVCAM-1 biosensor probe, which can bind to the biomarker sVCAM-1 in the detection sample with high affinity and high specificity, and has excellent selectivity and anti-interference ability, ensuring the accuracy of the detection results;

[0036] (3) The present invention uses the prepared optical biosensor probe based on pyrene-doped metal-organic framework (Apt@PCA-UiO-66) as the sVCAM-1 biosensor probe, which has good reproducibility and stability, as well as a wide detection range (2 ng / mL to 50 μg / mL) and an extremely low detection limit (0.62 ng / mL). BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1Comprehensive characterization of PCA-UiO-66: Figure 1 A is the TEM image of PCA-UiO-66; Figure 1 B is the TEM image of UiO-66; Figure 1 C is the SEM image of PCA-UiO-66; Figure 1 D is the SEM image of UiO-66; Figure 1 E is the XPS spectra of PCA-UiO-66 and UiO-66; Figure 1 F is the C1s spectrum of PCA-UiO-66; Figure 1 G is the O1s spectrum of PCA-UiO-66; Figure 1 H is the Zr 3d spectrum of PCA-UiO-66; Figure 1 I is the XRD pattern of PCA-UiO-66 and UiO-66 and the standard XRD pattern; Figure 1 J is the FTIR spectra of PCA-UiO-66 and UiO-66; Figure 1 K is the zeta potential value of PCA-UiO-66 and UiO-66; Figure 1 L is the thermogravimetric analysis and derivative thermogravimetric analysis curves of PCA-UiO-66 and UiO-66;

[0038] Figure 2 For the optical performance test of PCA-UiO-66: Figure 2 A is the excitation spectrum and emission spectrum of PCA-UiO-66; Figure 2 B is the emission spectra of PCA-UiO-66, PCA, and UiO-66; Figure 2 C is the digital image of UiO-66 and PCA-UiO-66 before and after centrifugation under 360 nm UV light; Figure 2 D is the confocal laser scanning microscopy (CLSM) image of PCA-UiO-66; Figure 2 E is the optical microscopy (OM) image of PCA-UiO-66; Figure 2 F is the confocal laser scanning microscopy (CLSM) image of UiO-66; Figure 2 G is the optical microscope (OM) image of UiO-66;

[0039] Figure 3 Feasibility verification and performance analysis of Apt@PCA-UiO-66: Figure 3 A is the fluorescence measurement after Apt@PCA-UiO-66 was added to the blank test sample and the test sample with 1000 ng / mL sVCAM-1; Figure 3 B is the XRD pattern of the test sample before and after PCA-UiO-66 detection of 1000 ng / mL sVCAM-1; Figure 3 C is the fluorescence measurement of PCA suspension with 200 μM aptamer added and PCA suspension without aptamer added; Figure 3 DE is the fluorescence spectrum of Apt@PCA-UiO-66 detecting sVCAM-1 at concentrations ranging from 2 ng / mL to 50 μg / mL; Figure 3 F is the calibration curve; Figure 3 G is the specificity of Apt@PCA-UiO-66 for sVCAM-1; Figure 3 H is the reproducibility of Apt@PCA-UiO-66 on sVCAM-1; Figure 3 I is the long-term stability of Apt@PCA-UiO-66;

[0040] Figure 4 Optimization of parameters for Apt@PCA-UiO-66 preparation and incubation with protein: Figure 4 A is the optimization of aptamer concentration; Figure 4 B is the optimization of the incubation time between aptamer and PCA-UiO-66; Figure 4 C is the optimization of the incubation time of sVCAM-1 protein and Apt@PCA-UiO-66;

[0041] Figure 5 For human serum sample analysis: Figure 5 A is the heat map of sVCAM-1 fluorescence signals in different groups detected by ELISA; Figure 5 B is the heat map of sVCAM-1 fluorescence signals in different groups detected by sVCAM-1 biosensor probe; Figure 5 C shows the expression levels of sVCAM-1 in human serum from different groups detected by sVCAM-1 biosensor probe and ELISA; Figure 5 D is the relevance of ELISA to this study; Figure 5 E is the analysis of sVCAM-1 expression levels in serum of different groups; Figure 5 F is the reduction of sVCAM-1 levels in patients after treatment, presented in absolute value and percentage. DETAILED DESCRIPTION

[0042] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which this invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are conventional biochemical reagents; the experimental methods described, unless otherwise specified, are conventional methods.

[0043] The present invention will be described in detail below with reference to the embodiments and accompanying drawings.

[0044] Example 1

[0045] Preparation of sVCAM-1 biosensor probe

[0046] S1, 210mg of zirconium oxychloride was dissolved in 30mL DMF to obtain a DMF solution of zirconium oxychloride; 500mg of terephthalic acid was dissolved in 10mL DMF to obtain a DMF solution of terephthalic acid; 100mg of 1-pyrenecarboxylic acid was dissolved in 10mL DMF to obtain a DMF solution of 1-pyrenecarboxylic acid;

[0047] S2: Mix the three solutions prepared in S1, sonicate for 1 h, transfer to a 100 mL polytetrafluoroethylene container, and react at 120 °C for 24 h;

[0048] S3. After the reaction is completed, the generated product is washed three times with DMF and ethanol respectively, and dried to obtain the pyrene-doped metal-organic framework composite material PCA-UiO-66;

[0049] S4. PCA-UiO-66 was dispersed in deionized water and a FAM-labeled aptamer was added. The concentration of PCA-UiO-66 was 500 μg / mL, the sequence of the aptamer was: 5'-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3', and the concentration of the aptamer was 200 nM. After incubation for 50 minutes, the mixture was centrifuged at 10,000 rpm for 10 minutes, washed three times, and resuspended in ultrapure water to obtain the sVCAM-1 biosensor probe, designated as Apt@PCA-UiO-66.

[0050] 1. Performance test of the pyrene-doped metal-organic framework composite material PCA-UiO-66 prepared in Example 1:

[0051] Figure 1 AB are TEM images of PCA-UiO-66 and the parent material UiO-66. It can be seen that both show a uniformly distributed morphology with an average particle size of about 200 nm.

[0052] Figure 1 CD is the SEM image of PCA-UiO-66 and the parent material UiO-66. It can be seen that PCA-UiO-66 shows good particle morphology and clear surface structure, indicating that the synthesis is successful and the crystal quality is high.

[0053] Figure 1 E is the XPS spectra of PCA-UiO-66 and parent material UiO-66, showing the binding energy peaks related to Zr3d, C 1s, and O1s in the two nanomaterials.

[0054] Figure 1 F is the C1s spectrum of PCA-UiO-66, which can be decomposed into two peaks at 284.8 eV and 288.98 eV, which are attributed to C–C / C=C and O=C–OH bonds, respectively.

[0055] Figure 1 G is the O1s spectrum of PCA-UiO-66, showing three peaks at 530.69 eV, 532.08 eV, and 533.75 eV, which correspond to C=O, Zr–O, and C–O bonds, respectively.

[0056] Figure 1 H is the Zr 3d spectrum of PCA-UiO-66. It can be seen that the binding energy peaks at 183.03 eV and 185.48 eV are related to the Zr 3d5 / 2 and Zr 3d3 / 2 states, reflecting the presence of Zr(IV).

[0057] Figure 1 I is the X-ray diffraction pattern. It can be seen that the XRD patterns of PCA-UiO-66 and the parent material UiO-66 are consistent with the standard XRD model; all 2θ peaks, especially at 7.4°, 8.5° and 25.4°, match the diffraction peaks of the UiO-66 parent material, confirming that the crystal structure of UiO-66 is successfully retained in the PCA-UiO-66 synthetic material.

[0058] Figure 1 J is the FTIR spectra of PCA-UiO-66 and UiO-66. It can be seen that the FTIR spectra of MOFs show sharp peaks in the range of 1400–1710 cm-1. These peaks are attributed to the stretching vibrations of C=C and C=O bonds. These peaks come from the presence of benzene rings and carboxyl groups in the two samples. The band at 1710 cm-1 is related to the free carboxyl groups present on the MOF surface; the absorption peaks at 1585 cm-1 and 1390 cm-1 correspond to the asymmetric and symmetric stretching vibrations of the coordinated carboxylate groups, respectively.

[0059] In summary, Figure 1 AJ could demonstrate that the direct introduction of PCA during the synthesis process did not interfere with the normal formation of the UiO-66 framework.

[0060] Figure 1As shown by K, zeta potential measurements in aqueous solution show that the potential of PCA-UiO-66 is closer to neutral compared to UiO-66, demonstrating the successful encapsulation of PCA. The shift in the potential of PCA-UiO-66 closer to neutral is attributed to the introduction of 1-pyrenecarboxylic acid (PCA). PCA has strong hydrophobicity and π-π stacking ability, thus reducing the exposure of negative charges. In addition, when PCA is incorporated into UiO-66, its carboxyl groups coordinate with the metal nodes, replacing some of the original terephthalic acid ligands in UiO-66. This replacement also reduces the density of surface negative charges and brings the zeta potential closer to neutral. This closer-to-neutral potential makes it easier for aptamers with negative potentials and piezoelectric bonds to adsorb in aqueous solution.

[0061] Figure 1 L is the thermogravimetric analysis and derivative thermogravimetric analysis curves of PCA-UiO-66 and the parent material UiO-66. To examine the thermal stability of PCA-UiO-66 and UiO-66, thermogravimetric analysis was performed from room temperature to 800°C. The TGA curves (solid line) and derivative thermogravimetric curves (DTG, dashed line) of the two samples show a three-step mass loss. The first significant mass loss (about 5%) occurs around 70°C and is attributed to the removal of organic solvent molecules in the MOF pores. The second mass loss occurs at approximately 200°C and is attributed to the dehydration reaction of Zr clusters, resulting in the conversion of Zr6O4(OH)4 to Zr6O6. At this time, the chemical composition of UiO-66 is believed to be Zr6O6(BDC)6. The third large mass loss occurs at 580°C. For both UiO-66 and PCA-UiO-66, it is related to the decomposition of terephthalic acid into CO, CO2, and ZrO2. Notably, the DTG curve of PCA-UiO-66 exhibits an additional small peak at 320°C, attributed to the decomposition of PCA. Calculations indicate that PCA accounts for approximately 5% of the total weight of PCA-UiO-66. At 876°C, the residual masses of PCA-UiO-66 and UiO-66 are 41.2% and 45.45%, respectively, corresponding to total mass losses of 58.8% and 54.55%, respectively.

[0062] In summary, Figure 1 AL showed that the structural and chemical integrity of UiO-66 in the prepared PCA-UiO-66 was preserved, confirming the successful integration of PCA without destroying the framework or performance of the material.

[0063] Figure 2 AB shows that when PCA-UiO-66 is dispersed in ultrapure water and measured under 360nm excitation, its excitation spectrum is centered at approximately 500nm ( Figure 2 A); and the excitation and emission spectra of PCA in water ( Figure 2Compared to the previous results (B), the excitation band shifts from 400 to 500 nm; this new excitation band is attributed to intramolecular π-π stacking interactions arising from the overlap of pyrene units. The complete disappearance of the ground-state PCA excitation indicates that PCA in PCA-UiO-66 is completely quasi-molecular. This phenomenon can be explained by the "close-packing effect," whereby the spatial confinement of the MOF structure forces the pyrene units into close proximity, forming a quasi-molecular state. Unlike prior art MOFs, where pyrene is confined by strong bonds (e.g., covalent bonds), PCA in PCA-UiO-66 is primarily confined by weaker bonds, resulting in a certain degree of flexibility. Due to the limited solubility of PCA in water, its free form is generally retained within the MOF. This was confirmed by subjecting PCA-UiO-66 to multiple rounds of washing and centrifugation. Fluorescence analysis revealed virtually no fluorescence in the supernatant, confirming the stability of the prepared PCA-UiO-66. PCA presents a combination of "flexibility" and "stability" within MOFs, making it an inspiring material for sensor design.

[0064] Figure 2 C shows that PCA-UiO-66 exhibits bright green fluorescence under 360 nm UV light, while UiO-66 does not; Figure 2 DE shows confocal and bright-field images of PCA-UiO-66; Figure 2 FG shows the corresponding images of UiO-66. Compared with UiO-66, the fluorescence within the structure of PCA-UiO-66 is strong and concentrated, and there is almost no fluorescence in the background, which further confirms that all PCA molecules are effectively encapsulated within the MOF.

[0065] 2. Performance test of the sVCAM-1 biosensor probe (Apt@PCA-UiO-66) prepared in Example 1:

[0066] Figure 3 Figure A shows the fluorescence measurements of the prepared Apt@PCA-UiO-66 after addition to a blank test sample and a test sample containing 1000 ng / mL sVCAM-1. In the absence of sVCAM-1, the pyrenecarboxylic acid in Apt@PCA-UiO-66 exists exclusively in the excimer state. In the presence of sVCAM-1, the number of peaks corresponding to the monomeric and excimer states in the fluorescence spectrum increases, and the fluorescence intensity of monomeric PCA increases, indicating that more PCA transitions from the excimer state to the monomeric state. Furthermore, the enhanced excimer fluorescence is consistent with the fluorescence properties of PCA in solution, indicating that excimer states are self-assembled at high concentrations.

[0067] Figure 3Figure B shows the XRD patterns of the prepared PCA-UiO-66 before and after testing a sample with 1000 ng / mL sVCAM-1. The XRD patterns show no significant changes, indicating that the PCA-UiO-66 remained intact during the test and did not undergo structural degradation. The release of PCA from the MOF was not due to structural breakdown of the MOF itself. Furthermore, zeta potential analysis revealed a significant decrease after testing, indicating that some PCA had left the MOF, exposing more negatively charged sites.

[0068] In order to verify that during the interaction between PCA-UiO-66 and the aptamer, the π-π stacking between the aptamer and PCA in the MOF not only enables the aptamer to remove PCA from PCA-UiO-66 after recognition, but also enhances the solubility of PCA and promotes its release from PCA-UiO-66. The emission intensity of the PCA suspension with 200 μM aptamer added and the PCA suspension without aptamer added was measured using a microplate reader under 360 nm excitation, as shown in Figure 2. Figure 3 As shown in Figure C, the suspension with 200 μM aptamer added showed higher fluorescence intensity, proving that the aptamer enhanced the solubility and dispersibility of PCA.

[0069] In summary, Figure 3 AC can prove that the prepared Apt@PCA-UiO-66 can be used as a fluorescent biosensor probe for detecting sVCAM-1.

[0070] like Figure 3 As shown in Figures DE, the ability of the prepared Apt@PCA-UiO-66 to detect sVCAM-1 at different concentrations (2 ng / mL to 50 μg / mL) was evaluated by fluorescence test. It can be seen that with the increase of sVCAM-1 concentration, the fluorescence peak of monomeric PCA is significantly enhanced, and the peak of PCA corresponding to the quasi-molecular state is slightly increased, which is consistent with the dispersion characteristics of PCA in solution. Figure 3 The fluorescence intensity at F, 390 nm showed a strong linear relationship with the concentration of sVCAM-1, and the fitted linear equation was Y = 2.824*X + 212, R 2 =0.9995. Based on the slope of the linear fit, the limit of detection (LOD) was 0.62 ng / mL (3σ / k), and the limit of quantification (LOQ) was 2.05 ng / mL (10σ / k). The concentration of sVCAM-1 in human serum typically ranges from 100 ng / mL to 5000 ng / mL, thus meeting the requirements for non-destructive detection in human serum samples.

[0071] Specific detection: In practical applications, other proteins in serum, such as soluble intercellular adhesion molecule-1 (sICAM-1), interleukin-6 (IL-6), C-reactive protein (CRP), human serum albumin (HSA) and tumor necrosis factor-α (TNF-α), as well as metal ions such as Cu 2+ and Zn 2+ , which may interfere with the test results. Therefore, the selectivity and anti-interference ability of the Apt@PCA-UiO-66 biosensor probe prepared in Example 2 for detecting hemolytic vascular cell adhesion molecule-1 (sVCAM-1) were systematically evaluated. Figure 3 As shown in Figure G, at a concentration of 1000 ng / mL, the fluorescence intensity of sVCAM-1 was significantly higher than that of other non-target proteins at the same concentration. Furthermore, in the mixed group (sVCAM-1 / sICAM-1 / IL-6 / CRP / TNF-α), the fluorescence signal was almost identical to that of the sVCAM-1 alone group. These results demonstrate that the developed biosensor probe exhibits excellent selectivity for sVCAM-1 in complex detection environments and can effectively resist interference from other proteins, making it suitable for the detection of sVCAM-1 in complex systems.

[0072] Reproducibility test: Five parallel experiments were conducted on the Apt@PCA-UiO-66 biosensor probe prepared in Example 2 to detect 1000 ng / mL sVCAM-1. The results are as follows: Figure 3 As shown in Figure H, the relative standard deviation (RSD) of the fluorescence response was 3.78%, indicating good reproducibility.

[0073] Stability testing: The long-term stability of the Apt@PCA-UiO-66 biosensor probe prepared in Example 2 was evaluated by measuring the fluorescence response of the probe to 1000 ng / mL sVCAM-1 over time. The probe was stored at 4°C and tested on days 1, 7, 14, 21, and 28. Figure 3 The results shown in I show that the fluorescence response only decreased slightly after 14 days, maintaining 84.64% and 75.31% of the initial signal intensity, respectively. These results indicate that the biosensor probe has good stability during long-term detection of sVCAM-1.

[0074] 3. Optimization of preparation parameters for the pyrene-doped metal-organic framework-based biosensor probe Apt@PCA-UiO-66

[0075] On the basis of Example 2, the difference from Example 2 is that samples with aptamer concentrations of 300nM, 400nM, 500nM, 600nM, 700nM, and 800nM were prepared respectively;

[0076] On the basis of Example 2, the difference from Example 2 is that the incubation time of the samples is adjusted to 60 min, 75 min, 90 min, 105 min, and 120 min respectively.

[0077] The samples prepared in Example 2 and above were transferred to a 96-well plate and the fluorescence intensity was measured using a microplate reader under 494 nm excitation. The measurement results are shown in FIG. Figure 4 As shown in A, when the fluorescence intensity begins to increase linearly, it means that the MOF surface is completely occupied by the aptamer. Therefore, the aptamer concentration of 200 nM is the optimal concentration, and the aptamer concentration range is selected as 200-500 nM as the applicable range; after incubation for 50 minutes, 200 nM FAM-labeled aptamer completely occupies the binding sites of MOF, and the optimized incubation time is 50 minutes as the optimal time, and the incubation time is selected as 50-90 minutes as the applicable range.

[0078] Example 2

[0079] Optimal incubation time for detection of 1000 ng / mL sVCAM-1 by the biosensor probe Apt@PCA-UiO-66

[0080] 1000 ng / mL of sVCAM-1 protein was added to Apt@PCA-UiO-66 prepared in Example 1, and fluorescence emission was detected using 360 nm excitation light. The time point when the fluorescence intensity no longer increased was determined as the optimal detection time. The results are shown in FIG. Figure 4 As shown in C, the optimal detection time is 40 min of incubation.

[0081] Example 3

[0082] Detection of the rehabilitation effect of exercise intervention therapy in patients with cardiovascular disease (CVD) using sVCAM-1 biosensor probe

[0083] This study was conducted at Tianjin Chest Hospital and included patients with cardiovascular disease (CVD). The study protocol was approved by the local ethics committee (2023KY-025-01), and all participants provided written informed consent before enrollment. Patients received adaptive postural balance cardiac rehabilitation exercises (APBCRE), an intervention based on published methods.

[0084] The study included two clinical assessments: one before and one month after the exercise intervention. The intervention lasted four weeks, with three training sessions per week, for a total of 12 exercise sessions. Each assessment included a cardiopulmonary exercise test (CPET).

[0085] The primary outcome measure was cardiorespiratory endurance, assessed by oxygen uptake (VO2) at the anaerobic threshold (AT). Secondary outcomes included end-diastolic filling rate (EDFR), stroke volume (SV), and systemic vascular resistance index (SVRI).

[0086] Patient inclusion criteria:

[0087] The study subjects were patients with cardiovascular disease (CVD) who met the following inclusion criteria: age ≥18 years; confirmed CVD, including coronary heart disease (CHD), elderly myocardial infarction (MI), arrhythmia, or valvular heart disease; no history of percutaneous coronary intervention (PCI), or at least one week after surgery; no history of coronary artery bypass grafting (CABG), or at least one month after surgery.

[0088] Exclusion criteria: patients with abnormal blood pressure response; acute heart failure; unstable angina; acute myocarditis; congenital heart disease; musculoskeletal diseases that seriously affect exercise capacity[5].

[0089] Cardiopulmonary function evaluation index measurement: Cardiopulmonary exercise test (CPET) was performed using the Oxycon Mobile cardiopulmonary function measurement system (JAEGER-CareFusion, Germany). All subjects were tested using a personalized ramp protocol, with VO2 data collected at rest and during the AT phase. AT was defined using the V-slope method.

[0090] Serum Sample Collection: 10 mL of venous blood was collected from each patient before and after the exercise intervention. After the blood sample was allowed to rest at room temperature for 60 minutes, it was centrifuged at 3000 rpm for 10 minutes (4°C) to collect serum and immediately freeze it at -80°C.

[0091] Serum sample testing: Serum soluble vascular cell adhesion molecule-1 (sVCAM-1) levels were measured using the prepared sVCAM-1 biosensor probe and enzyme-linked immunosorbent assay (ELISA). The ELISA assay was performed using a kit from Elabscience according to the manufacturer's instructions. The sVCAM-1 biosensor probe assay involved incubating 100 μL of undiluted serum sample with the sVCAM-1 biosensor probe in a 96-well plate for 40 minutes. The fluorescence signal in the supernatant was measured using a microplate reader at an excitation wavelength of 360 nm.

[0092] Results: The sVCAM-1 levels in serum samples of patients before and after the intervention were measured by sVCAM-1 biosensor probe biosensor method and enzyme-linked immunosorbent assay (ELISA). Figure 5As shown in AB, it can be seen that this method has good consistency with the traditional method; Figure 5 As shown in Figures C and D, the fluorescence response values ​​of sVCAM-1 in serum samples showed no significant difference between the sVCAM-1 biosensor probe biosensor method and the ELISA method, indicating that the sVCAM-1 biosensor probe biosensor method has comparable sensitivity to ELISA in detecting sVCAM-1 in clinical samples. The performance of the sVCAM-1 biosensor probe is highly correlated with the ELISA-based detection results, further verifying its reliability and clinical practicality.

[0093] Further analysis of clinical samples showed that APBCRE therapy can effectively reduce the level of sVCAM-1 in CVD patients, and the difference between the two groups before and after intervention was statistically significant (p = 0.0118) ( Figure 5 E); The reduction of sVCAM-1 level in each patient was analyzed in absolute value and percentage. Figure 5 As shown in Figure F, the mean sVCAM-1 level in patients decreased by 467.50 ng / mL, a 30.54% decrease compared to pre-treatment levels. Given the established association between decreased sVCAM-1 levels and improved patient outcomes, these results suggest that therapy has a positive effect on patient outcomes.

[0094] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of sVCAM-1 biosensor probe in the preparation of products for evaluating cardiac rehabilitation effects.

2. The use according to claim 1, characterized in that: The product is a reagent, a kit, a reagent composition or a chip.

3. The use according to claim 2, characterized in that: The evaluation of cardiac rehabilitation effect is the evaluation of the rehabilitation effect of coronary heart disease, senile myocardial infarction, arrhythmia or valvular heart disease; preferably, the evaluation of cardiac rehabilitation effect is the evaluation of the rehabilitation effect of coronary heart disease, senile myocardial infarction, arrhythmia or valvular heart disease through exercise therapy intervention.

4. The use according to claim 1, characterized in that: The sVCAM-1 biosensor probe evaluates the cardiac rehabilitation effect by detecting the level of sVCAM-1 in serum samples; preferably, the detection range of the sVCAM-1 biosensor probe for sVCAM-1 is 2 ng / mL to 50 μg / mL, and the detection limit is 0.62 ng / mL.

5. The use according to any one of claims 1 to 4, characterized in that: The sVCAM-1 biosensor probe is an optical biosensor probe based on a pyrene-doped metal organic framework.

6. The use according to claim 5, characterized in that The optical biosensing probe based on pyrene-doped metal-organic framework is prepared by the following method: S1. Prepare DMF solutions of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid respectively; S2. Mix the three solutions prepared in S1, sonicate, dissolve, and react at 100-120°C; S3. After the reaction is completed, the generated product is washed several times and then dried to obtain a pyrene-doped metal-organic framework composite material PCA-UiO-66; S4. Disperse the PCA-UiO-66 obtained in S3 in deionized water and add a FAM-labeled aptamer. The sequence of the FAM-labeled aptamer is: 5'-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3'. After the incubation, centrifuge, wash multiple times, and resuspend in ultrapure water to obtain an sVCAM-1 biosensor probe, denoted as Apt@PCA-UiO-66.

7. The use according to claim 6, characterized in that: In S1, the mass ratio of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid is 1-4:5:0.1-1; in the DMF solution of zirconium oxychloride, the mass ratio of zirconium oxychloride to DMF is 1-4:90-100; in the DMF solution of terephthalic acid, the mass ratio of terephthalic acid to DMF is 5:90-100; in the DMF solution of 1-pyrenecarboxylic acid, the mass ratio of 1-pyrrolidinecarboxylic acid to DMF is 0.1-1:90-100; In said S2, the reaction time is 20 to 30 hours; In S3, the generated product was washed three times with DMF and ethanol respectively; In the S4, the concentration of PCA-UiO-66 dispersed in deionized water is 500-1000 μg / mL; the concentration of the FAM-labeled aptamer is 200-500 nM; and the incubation time is 50-90 min.

8. The use according to claim 1, characterized in that The detection method of the sVCAM-1 biosensor probe product is as follows: after mixing the undiluted serum sample with the suspension of the sVCAM-1 biosensor probe, incubating for 40 minutes, the fluorescence signal in the supernatant is measured using a microplate reader at an excitation wavelength of 360 nm.

9. A system for evaluating cardiac rehabilitation effects based on sVCAM-1 biosensor probe.

10. The system for evaluating cardiac rehabilitation effects according to claim 9, characterized in that: The sVCAM-1 biosensor probe is an optical biosensor probe based on a pyrene-doped metal organic framework.