Lactic acid bacteria microcapsule, and preparation method and application thereof

Abstract

The present application belongs to the technical field of probiotic preparation, and relates to a lactic acid bacteria microcapsule, a preparation method and application thereof. The method comprises the following steps: uniformly mixing sodium alginate, modified montmorillonite and sterile water, adding prepared lactic acid bacteria seed liquid after cooling, fully mixing, forming an emulsion; using an extrusion method, spraying the emulsion into a calcium chloride solution, stirring and solidifying to obtain a microcapsule; then culturing the prepared microcapsule in a lactic acid bacteria liquid medium, and obtaining a lactic acid bacteria microcapsule after the culture is completed. The extrusion method and the coating and culturing process after single coating effectively protect the lactic acid bacteria, improve the stability of the lactic acid bacteria to a humid heat environment and the gastrointestinal tract resistance, and ensure the release performance of the lactic acid bacteria in the gastrointestinal tract. The present application solves the problem that the existing microcapsule coating technology cannot balance the improvement of the probiotic humid heat stability, gastrointestinal tract resistance and the guarantee of the good release performance of the probiotic in the gastrointestinal tract.

Description

Technical Field

[0001] This invention belongs to the field of probiotic product preparation technology, and relates to a lactic acid bacteria microcapsule, its preparation method and application. Background Technology

[0002] Maintaining gut health and ensuring normal growth in livestock and poultry is a pressing issue for the entire industry. In recent years, probiotics, represented by lactic acid bacteria, have received significant attention from livestock researchers due to their ability to inhibit pathogen proliferation and maintain gut health. In the food sector, probiotics are also gaining attention for their ability to maintain gut and liver health. To ensure host health, the number of live probiotics in food and feed must reach a sufficient concentration to effectively exert their effects. Moist heat processing is an important method in feed processing, primarily using heat (steam, hot water) and moisture (addition of water) to treat feed ingredients, improving their nutritional value, palatability, and processing performance. This method is widely used in the preparation of animal feed, such as feed for pigs, poultry, and aquatic animals. In actual production, various factors such as high temperature and moisture during food and feed processing, as well as gastric acid and digestive enzymes in the gastrointestinal tract, can seriously damage probiotics in products. Among them, high temperature and moisture during food and feed processing affect the stability of probiotics during processing and storage, and also reduce their colonization efficiency in the intestines. In addition, when probiotics enter the gastrointestinal tract, gastric acid inhibits their colonization and reproduction in the stomach, and the presence of digestive enzymes may reduce the efficiency of probiotics in exerting their effects in the intestines. These negative impacts ultimately limit the promotion and application of probiotics in the food and animal husbandry sectors.

[0003] To improve the survival rate and efficacy of probiotics in the gastrointestinal tract, various probiotic dosage forms have been developed, such as microcapsules and coated tablets. These dosage forms protect probiotics from stomach acid and digestive enzymes, enabling them to better colonize and function in the intestines. Under current microencapsulation technology, to enhance the protective effect of microcapsule coating on probiotics, multi-layer encapsulation with different coating materials is typically used to strengthen the protection of the probiotics within the microcapsules. For example, the invention patent application with publication number CN102178238A describes a method for preparing heat-resistant microcapsule probiotics, including the following steps: a. inoculating and fermenting probiotics; b. centrifuging the fermentation broth from step a at 4°C and 2500–4000 rpm to obtain wet probiotic cells; c. mixing 5–9% β-cyclodextrin and 3–8% hydroxypropyl methylcellulose (by weight of the wet probiotic cells) and dissolving them in hot water at 60–70°C, stirring until fully dissolved to obtain a solution, and then cooling the solution. d. Add probiotic wet cells to the solution for the first encapsulation, gently stir for 10 minutes to fully mix and obtain the first encapsulated material; e. Add 20-30% corn dextrin and 10-15% instant gum arabic (by weight percentage of probiotic wet cells) to the emulsion after mechanical emulsification and homogenization of the first encapsulated material, react for 40 minutes, and perform a second encapsulation to obtain a probiotic emulsion; f. Freeze-dry the probiotic emulsion to obtain probiotic microcapsule powder; g. Spray the probiotic microcapsule powder with lecithin using a fluidized bed. Although this patent application uses different coating materials for multi-layer encapsulation to improve the protective effect of microcapsule coating on probiotics, the multi-layer encapsulation will cause the probiotic microcapsule size to expand, affecting the colonization and function of probiotics in the intestine, and is also not conducive to the adhesion and release of probiotics.

[0004] In the microencapsulation process, to improve the stability of probiotics against moist heat or their gastrointestinal resistance, it is often necessary to increase the thickness or number of coating materials. However, this may lead to slow or incomplete release of probiotics in the gastrointestinal tract, affecting their normal physiological functions. On the other hand, reducing the amount of coating material to improve release performance can decrease the stability of probiotics during moist heat processing. In short, it is difficult to achieve a balance between improving the moist heat stability and gastrointestinal resistance of probiotics and ensuring their good release performance in the intestine. Summary of the Invention

[0005] To address the challenge of existing microencapsulation technologies failing to achieve a balance between improving the hygrothermal stability and gastrointestinal resistance of probiotics and ensuring optimal release performance in the gastrointestinal tract, this invention provides a method for preparing lactic acid bacteria microcapsules. This method employs a single-stage extrusion coating process followed by post-coating culture to effectively protect the lactic acid bacteria, thereby enhancing their stability in hygrothermal environments and gastrointestinal resistance, while simultaneously ensuring optimal release performance in the gastrointestinal tract.

[0006] In a first aspect, the present invention provides a method for preparing lactic acid bacteria microcapsules, comprising the following steps:

[0007] Step 1: Add sodium alginate and modified montmorillonite to sterile water and stir evenly to obtain a mixture; after cooling the mixture, add lactic acid bacteria seed liquid to form an emulsion; use an extrusion method to spray the emulsion into a calcium chloride solution and stir to solidify; after solidification, filter to obtain microcapsules; specifically, use a microcapsule granulator to extrude the emulsion into the calcium chloride solution.

[0008] Preparation of lactic acid bacteria seed culture: Lactic acid bacteria and culture medium are inoculated into MRS liquid culture medium at an inoculation rate of 1-2% by volume, and then incubated statically for 24-48 hours to obtain lactic acid bacteria seed culture;

[0009] The mass-to-volume ratio of sodium alginate to sterile water is 1%–3%; the mass-to-volume ratio of montmorillonite to sterile water is 1%–3%; the volume percentage of lactic acid bacteria seed liquid to sterile water is 0.2%–0.5%; the volume ratio of emulsion to calcium chloride solution is 1:8; and the concentration of calcium chloride solution is 150–300 mmol / L.

[0010] Step 2: Microcapsule culture: The microcapsules prepared in Step 2 are placed in a liquid culture medium for lactic acid bacteria and cultured for 24–72 hours; after the culture is completed, lactic acid bacteria microcapsules are obtained.

[0011] The weight ratio of the microcapsules to the volume ratio of the lactic acid bacteria liquid culture medium in step 2 is 1:5 to 1:15.

[0012] This invention uses sodium alginate (prebiotic) as the wall material to achieve lactic acid bacteria coating, and further adds modified montmorillonite as a carrier for adsorbing lactic acid bacteria and postbiotics produced by lactic acid bacteria cultivation. At the same time, the presence of modified montmorillonite can also enhance the structural stability of microcapsules during the emulsion solidification stage.

[0013] The preparation method of this invention co-immobilizes biofilm-forming lactic acid bacteria and their post-biotics within sodium alginate microcapsules, constructing lactic acid bacteria microcapsules co-immobilized with sodium alginate (prebiotics), biofilm-forming probiotics, and their post-biotics. The combination of prebiotics and biofilm-forming probiotics and their post-biotics in the lactic acid bacteria microcapsules can exert a synergistic effect, helping to further improve the biological efficacy of the lactic acid bacteria microcapsules. This allows for more complete and efficient utilization of various metabolites and strain components produced by the strains, maximizing the utilization of strain products. Furthermore, the synergistic effect of prebiotics, biofilm-forming probiotics, and post-biotics in the lactic acid bacteria microcapsules enhances the lactic acid bacteria's ability to resist interference from external physical and chemical factors. A single coating using the extrusion method can effectively protect the lactic acid bacteria, improving their stability and gastrointestinal resistance under humid heat processing conditions, while ensuring the release performance of the lactic acid bacteria in the gastrointestinal tract. Prebiotics refer to organic substances that are not digested and absorbed by the host but can selectively promote the metabolism and proliferation of beneficial bacteria in the body. In this invention, sodium alginate is used as a prebiotic. Metabiotics are metabolic products or cellular components secreted or produced by living microorganisms (usually probiotics) during their growth. In the microcapsule culture process of step 2 of this invention, lactic acid bacteria produce metabiotics through the accumulation of metabolic products and the release of cellular components. Bacterial biofilms refer to a large number of bacterial aggregates formed by bacteria adhering to a contact surface and secreting polysaccharide matrices, fibrin, lipid proteins, etc., encapsulating themselves within them. In the microcapsule culture process of step 2 of this invention, there is a crucial microcapsule culture stage. In this stage, lactic acid bacteria attach to the cross-linked backbone formed by sodium alginate and modified montmorillonite. Subsequently, the lactic acid bacteria begin to secrete extracellular polymers, and with the continuous proliferation and aggregation of cells, they gradually develop into a relatively stable and organized microbial aggregate, called a biofilm-coated probiotic.

[0014] The coating rate of lactic acid bacteria is a crucial factor affecting its production efficiency. This invention employs a method of first preparing coated lactic acid bacteria microcapsules, followed by cultivation to prepare the microcapsules. During cultivation, the lactic acid bacteria grow only within the microcapsules, ensuring complete coating. This is compared to the bacterial count of microcapsules that are first coated but not cultivated (10⁻⁶). 7 Compared to CFU / g, the number of microcapsules (wet weight) containing lactic acid bacteria after coating and then culturing (10) 10 The CFU / g ratio increased by two orders of magnitude.

[0015] Furthermore, the lactic acid bacteria mentioned in step 1 are selected from at least one of Lactobacillus plantarum, Lactobacillus rhamnosus, and Bifidobacterium. The lactic acid bacteria selected in this invention are all lactic acid bacteria with a high biofilm-producing capacity to ensure that the objectives of this invention are achieved.

[0016] Further, the modified montmorillonite mentioned in step 1 is selected from at least one of sodium-modified montmorillonite, calcified montmorillonite, and sodium-modified and chitosan-modified montmorillonite shells. Preferably, under pH 6.5 conditions, lactic acid bacteria have a high biofilm formation ability on the surface of sodium-modified, sodium-modified, and chitosan-modified montmorillonite.

[0017] Further, the lactic acid bacteria liquid culture medium mentioned in step 2 is an optimized MRS liquid culture medium. The optimized MRS liquid culture medium has the following composition: peptone 10 g / L, beef meal 2 g / L, yeast extract 4 g / L, glucose 5 g / L, dipotassium hydrogen phosphate 2 g / L, diammonium hydrogen citrate 2 g / L, sodium acetate 5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, Tween 80 g / L, and pH 5.7 ± 0.2. This invention, based on the MRS culture medium, effectively promotes the formation of lactic acid bacteria biofilm by reducing glucose and beef meal.

[0018] Furthermore, the lactic acid bacteria liquid culture medium in step 2 also contains an additive; the additive is selected from at least one of bile acids and mannose, and the mass concentration of the additive is 0.00025-0.004%. By adding an additive during cultivation, this invention can further enhance the biofilm potential of lactic acid bacteria.

[0019] Further, following step 2, step 3 is added: the lactic acid bacteria microcapsules obtained in step 2 are placed in a protective agent and stirred evenly; the protective agent is a mixed solution composed of trehalose, whey protein isolate, and glutamic acid, wherein the mass concentration of trehalose is 20-30 wt%, the mass concentration of whey protein isolate is 10-15 wt%, and the mass concentration of glutamic acid is 1-2 wt%. In this invention, the protective agent further enables the lactic acid bacteria microcapsules to dry and be stored at room temperature.

[0020] In a second aspect, the present invention provides lactic acid bacteria microcapsules prepared by the above-mentioned preparation method, wherein the cross-linking structure of sodium alginate and modified montmorillonite during the preparation process serves as the basic framework for biofilm formation in the lactic acid bacteria microcapsules; and the number of viable lactic acid bacteria in the lactic acid bacteria microcapsules decreases by only one order of magnitude after being treated at a conditioning temperature of 85°C and a conditioning moisture content of 15% for 1 min.

[0021] In a third aspect, the present invention provides the application of the above-mentioned lactic acid bacteria microcapsules in the preparation of probiotic products.

[0022] Furthermore, the probiotic product is a probiotic additive.

[0023] The beneficial effects of the present invention through the above technical solution are as follows:

[0024] (1) The present invention adopts a single coating and post-coating culture process by extrusion method to effectively protect lactic acid bacteria, improve the stability of lactic acid bacteria in humid and hot environment and gastrointestinal resistance, and at the same time ensure the release performance of lactic acid bacteria in gastrointestinal tract.

[0025] (2) This invention achieves the co-immobilization of prebiotics (microcapsule wall material) with biofilm-forming lactic acid bacteria and their post-biotics. Based on the lactic acid bacteria coating achieved by sodium alginate microcapsules, modified montmorillonite is used as a carrier to aggregate and immobilize lactic acid bacteria and post-biotics produced by lactic acid bacteria culture, thereby co-immobilizing biofilm-forming lactic acid bacteria and their post-biotics in sodium alginate microcapsules, constructing lactic acid bacteria microcapsules co-immobilized with sodium alginate (prebiotics), biofilm-forming probiotics (biofilm-forming probiotics), and their post-biotics. The combination of prebiotics and biofilm-forming probiotics and their post-biotics in the lactic acid bacteria microcapsules can exert a synergistic effect, which helps to further improve their biological efficacy, so that various metabolites and strain components produced by the strains can be utilized more fully and efficiently, maximizing the utilization of fermentation strain products. In addition, the combination of prebiotics, biofilm-coated probiotics, and postbiotics in lactic acid bacteria microcapsules enhances the ability of lactic acid bacteria to resist interference from external physical and chemical factors. This allows for effective protection of lactic acid bacteria with a single extrusion coating, resulting in better stability and gastrointestinal resistance of lactic acid bacteria under humid and hot processing conditions, while also ensuring the release performance of lactic acid bacteria in the gastrointestinal tract.

[0026] (3) Based on the use of sodium alginate as a wall material to achieve lactic acid bacteria coating, this invention further adds modified montmorillonite, which has the function of aggregating lactic acid bacteria and adsorbing postbiotics of lactic acid bacteria, to construct microcapsules co-immobilized with sodium alginate (prebiotic), biofilm-coated probiotics and their postbiotics. This is different from the hollow microspheres of sodium alginate microcapsules or pectin that have been reported. The main difference is that during the cultivation process, probiotics in hollow microcapsules prepared by sodium alginate microcapsules or pectin are prone to excessive accumulation on the outside of the microcapsule, thereby inhibiting the immobilization of probiotics and biofilm formation inside. However, the microcapsules constructed by this invention, which are cross-linked with sodium alginate and cationic modified montmorillonite, are conducive to the uniform distribution of lactic acid bacteria and the uniform growth of biofilm within the microcapsule. This may be related to the change in the microcapsule structure. The addition of modified montmorillonite makes the interior of the sodium alginate gel microspheres porous. The change in the microcapsule structure promotes more uniform dispersion of lactic acid bacteria within the microcapsule, and at the same time, it promotes more uniform delivery of nutrients to the interior of the microcapsule to a certain extent.

[0027] (4) After adding the protective agent and drying at room temperature, the lactic acid bacteria count in the lactic acid bacteria microcapsules prepared by the present invention reaches the level before drying. Attached Figure Description

[0028] Figure 1 These are morphological diagrams of the microcapsules prepared in Comparative Example 1 and the microcapsules prepared in Example 1.

[0029] Figure 2 The diagram shows the morphological structure of the microcapsules prepared in Comparative Example 2 and Example 2 (A) and the microcapsules on SYTO9-labeled probiotics (B).

[0030] Figure 3 The microcapsules prepared in Example 3 are the lactic acid bacteria colony-forming units (A) and lactic acid bacteria survival rate (B) after conditioning at a conditioning temperature of 85°C and a conditioning moisture content of 15%.

[0031] Figure 4 The survival rate of bacteria in the microcapsules prepared in Example 3 after exposure to simulated gastric fluid (0-2h) and simulated intestinal fluid (2-5h);

[0032] Figure 5 The microcapsules prepared in Comparative Example 3 and Example 3 were released into the mouse intestine.

[0033] Figure 6 The survival rate of bacteria in the microcapsules prepared in Example 3 after drying at 37°C for 12 hours;

[0034] Figure 7 The effect of the protective agent on the survival of lactic acid bacteria after the microcapsules are dried;

[0035] Figure 8 This is a comparative graph showing the effects of different mass concentrations of modified montmorillonite (1 mg / mL, 5 mg / mL, 10 mg / mL, 15 mg / mL) on the growth of Lactobacillus rhamnosus (A) and biofilm formation (B).

[0036] Figure 9 This is a fluorescence image of the immobilization and biofilm distribution of Lactobacillus rhamnosus on sodium-modified montmorillonite;

[0037] Figure 10 This is a fluorescence image of the immobilization and biofilm distribution of Lactobacillus rhamnosus by chitosan-modified montmorillonite;

[0038] Figure 11 This is a comparison of the effects of MRS and optimized culture medium on the growth of Lactobacillus rhamnosus (A) and biofilm formation (B);

[0039] Figure 12 This is a comparison graph showing the effect of inoculum concentration on the growth of Lactobacillus rhamnosus (A) and biofilm formation (B) under MRS and optimized MRS liquid culture conditions;

[0040] Figure 13 This is a comparison of the effects of bile salt concentration on the growth of Lactobacillus rhamnosus (A) and biofilm formation (B) under MRS and optimized MRS liquid culture conditions. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Unless otherwise specified, all conditions in the following examples were performed under standard conditions or conditions recommended by the manufacturer. Raw materials and reagents whose manufacturers are not specified are all commercially available products.

[0043] Microcapsule granulator model: Buqi B-390 microcapsule granulator.

[0044] I. Source of raw materials:

[0045] (1) Source of montmorillonite:

[0046] Both calcium-based montmorillonite and sodium-based montmorillonite were purchased from Inner Mongolia Ningcheng Tianyu Bentonite Technology Co., Ltd. They are designated as Ca-MMT (calcified montmorillonite) and Na-MMT (sodium-based montmorillonite), respectively.

[0047] The chitosan modification of sodium montmorillonite is performed as follows:

[0048] S1: Accurately weigh 1g of Na-MMT and add it to a 250ml Erlenmeyer flask, then add 20ml of deionized water. Stir magnetically for 30min at 500rpm to prepare a Na-MMT aqueous solution.

[0049] S2: Weigh 0.2–0.4 g of chitosan and add it to 20 mL of 0.5–1% glacial acetic acid solution. Adjust the pH to 5.0–6.0 and mix by shaking for 30 min to obtain a chitosan solution with a mass percentage of 1–2%. Slowly add the above chitosan solution to Na-MMT aqueous solution and mix by shaking at 50℃ for 8 h. Collect the solid particles by centrifugation and dry them at 75℃ for 6 h. After pulverizing, pass the mixture through a 200-mesh sieve to obtain sodium-modified chitosan-modified montmorillonite, denoted as CS-MMT (sodium-modified and chitosan co-modified montmorillonite).

[0050] (2) Source of lactic acid bacteria:

[0051] The Lactobacillus plantarum, Lactobacillus rhamnosus (LGG), and Bifidobacterium used in the following examples were purchased from the China Industrial Microbial Culture Collection Center.

[0052] (3) MRS medium: MRS medium was purchased from Qingdao Haibo.

[0053] The composition of MRS liquid culture medium is as follows:

[0054] Peptone 10g / L, beef meal 8g / L, yeast powder 4g / L, glucose 20g / L, dipotassium hydrogen phosphate 2g / L, diammonium hydrogen citrate 2g / L, sodium acetate 5g / L, magnesium sulfate 0.2g / L, manganese sulfate 0.04g / L, Tween 80 1g / L, pH 5.7±0.2.

[0055] The optimized MRS liquid culture medium composition is as follows: peptone 10 g / L, beef meal 2 g / L, yeast extract 4 g / L, glucose 5 g / L, dipotassium hydrogen phosphate 2 g / L, diammonium hydrogen citrate 2 g / L, sodium acetate 5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, Tween 80 1 g / L, pH 5.7 ± 0.2. This is referred to as the optimized medium.

[0056] II. Preparation and application of microcapsules;

[0057] Comparative Example 1: Lactic acid bacteria microcapsules with sodium alginate as the wall material

[0058] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, Lactobacillus rhamnosus was inoculated into sterile MRS liquid culture medium at a volume ratio of 2% of Lactobacillus rhamnosus bacterial culture to culture medium, and then incubated at 37°C for 24 hours.

[0059] (2) Preparation of microcapsules: 1g of sodium alginate was added to 100mL of sterile distilled water and magnetically stirred for 60min at 600rpm to obtain a 1% sodium alginate aqueous solution; then 0.2mL of Lactobacillus rhamnosus seed solution obtained in step (1) was added and magnetically stirred for 15min at 600rpm to obtain an emulsion; the emulsion was extruded into a 150mmol / L calcium chloride solution using a Buqi B-390 microcapsule granulator and solidified by stirring at 200-400rpm in a magnetic stirrer for 30min. After solidification, the microcapsules were obtained by filtration through a 500-mesh filter. The nozzle diameter of the Buqi B-390 microcapsule granulator is 450μm. The volume ratio of the emulsion to the calcium chloride solution is 1:8.

[0060] Comparative Example 2: Lactic acid bacteria microcapsules with sodium alginate as the wall material + microcapsule culture

[0061] The difference from Comparative Example 1 is that step (3) is added after step (2).

[0062] Step (3): Microcapsule culture: Then weigh 10g of lactic acid bacteria microcapsules prepared in step (2), place them in 50mL of optimized culture medium, and incubate at 37℃ for 24h. Collect the lactic acid bacteria microcapsules with biofilm.

[0063] Comparative Example 3: Multilayer-coated microcapsules of lactic acid bacteria and chitosan with sodium alginate as the wall material

[0064] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a volume ratio of 2% of bacterial culture to culture medium, and then incubated at 37°C for 24 hours.

[0065] (2) Preparation of microcapsules: 1g of sodium alginate was added to 100ml of sterile distilled water and magnetically stirred for 60min at 600rpm to obtain a 1% sodium alginate aqueous solution. 100mL of the *Lactobacillus rhamnosus* seed culture obtained in step (1) was weighed, centrifuged at 3000rpm for 15min, and the precipitate was collected. The precipitate was then added to the above sodium alginate aqueous solution and magnetically stirred for 15min at 600rpm to obtain an emulsion. The emulsion was sprayed into a 150mmol / L calcium chloride solution using a Buqi B-390 microcapsule granulator by extrusion and solidified by stirring at 200-400rpm in a magnetic stirrer for 30min. After solidification, the microcapsules were obtained by filtration through a 500-mesh filter. The nozzle diameter of the Buqi B-390 microcapsule granulator was 450μm. The volume ratio of the emulsion to the calcium chloride solution was 1:8.

[0066] (3) Multilayer coating of microcapsules: The microcapsules prepared in step (2) were added to a 0.4% chitosan aqueous solution and magnetically stirred for 15 min to prepare sodium alginate + chitosan microcapsules; 100 mL of phosphate buffer was added for washing, and the chitosan + sodium alginate microcapsules were added to a 1% sodium alginate aqueous solution and magnetically stirred for 15 min to prepare sodium alginate + chitosan + sodium alginate microcapsules; then the sodium alginate + chitosan + sodium alginate microcapsules were added to a 0.4% chitosan aqueous solution and magnetically stirred for 15 min to prepare sodium alginate + chitosan multilayer coated microcapsules.

[0067] Example 1: Lactic acid bacteria microcapsules with sodium alginate as the wall material and montmorillonite added.

[0068] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37℃ for 24h.

[0069] (2) Preparation of microcapsules: 1g sodium alginate and 1g sodium montmorillonite were added to 100mL of sterile water and magnetically stirred for 60min at 600rpm to obtain a mixture. After cooling, 0.2mL of the lactic acid bacteria seed solution obtained in step (1) was added and magnetically stirred for 15min at 600rpm to form an emulsion. The emulsion was extruded into a 150mmol / L calcium chloride solution using a Buqi B-390 microcapsule granulator and solidified by stirring at 200-400rpm in a magnetic stirrer for 30min. After solidification, the microcapsules were obtained by filtration through a 500-mesh filter. The nozzle diameter of the Buqi B-390 microcapsule granulator is 450μm. The volume ratio of the emulsion to the calcium chloride solution is 1:8.

[0070] Depend on Figure 1 The results showed that, compared with the hollow spherical sodium alginate microcapsules (Comparative Example 1), the microcapsules prepared in Example 1 had a more uniform internal structure and no hollow structure. This may be related to the fact that sodium alginate carries a negative charge while cationic modified montmorillonite carries a positive charge, thus generating an interaction.

[0071] Example 2: Lactic acid bacteria microcapsules with sodium alginate as the wall material and montmorillonite added + microcapsule culture

[0072] The difference from Example 1 is that step (3) is added after step (2).

[0073] Step (3): Microcapsule culture: Subsequently, 10g of the lactic acid bacteria microcapsules prepared in step (2) were weighed and placed in 50mL of optimized culture medium. The microcapsules were then incubated at 37℃ for 24h, and the resulting microcapsules with biofilms were collected. Modified montmorillonite and sodium alginate can serve as carriers to aggregate and immobilize lactic acid bacteria, thus providing a basis for the adhesion of lactic acid bacteria to their surface and the formation of biofilms. The lactic acid bacteria adsorbed on montmorillonite were cultured in the culture medium. This adsorption provided a relatively stable attachment site for the lactic acid bacteria, which then began to utilize the nutrients in the culture medium for growth and reproduction. During growth, the lactic acid bacteria secreted extracellular polymers such as extracellular polysaccharides and proteins. These extracellular polymers formed a protective and adhesive matrix on and around the surface of the lactic acid bacteria cells. This matrix enables multiple lactic acid bacteria cells to adhere together more firmly to the montmorillonite surface and the surrounding culture medium. Over time, more lactic acid bacteria cells aggregate and are encapsulated by extracellular polymers, gradually forming biofilm-coated probiotics with complex structures and functions. Therefore, the microcapsules, when cultured again, form lactic acid bacteria microcapsules with internal biofilms. The microcapsules were observed under an optical microscope; after staining with 5 μmol / L SYTO9 fluorescent dye for 15 min, they were then observed using a fluorescence inverted microscope.

[0074] Depend on Figure 2 A shows that the lactic acid bacteria in the biofilm-bearing microcapsules prepared in Comparative Example 2 exhibit a biofilm-bearing aggregated structure, but the biofilm is relatively small; while the biofilm-bearing lactic acid bacteria in the microcapsules prepared in Example 2 have a darker color and larger diameter. Therefore, compared with Comparative Example 2, the composite system formed by montmorillonite and sodium alginate used in Example 2 is more conducive to the formation of biofilm-bearing lactic acid bacteria. Furthermore, Figure 2 As shown in Figure B, in the biofilm-bearing lactic acid bacteria microcapsules prepared in Comparative Example 2, the lactic acid bacteria mainly aggregated on the outer side of the microcapsules, which is currently considered a key factor restricting the quality of biofilm-bearing microcapsules. However, in the biofilm-bearing lactic acid bacteria microcapsules prepared in Example 2 of this invention, the composite system formed by sodium alginate and montmorillonite resulted in more dispersed biofilm-bearing lactic acid bacteria with larger diameters. Therefore, compared to Comparative Example 2, the wall material of the composite system formed by montmorillonite and sodium alginate in Example 2 of this invention is more conducive to the uniform growth and immobilization of biofilm-bearing probiotics within the microcapsules.

[0075] In summary, compared with Comparative Example 2 using sodium alginate as the wall material, Example 2 of this invention, using a composite system of cationic modified montmorillonite and sodium alginate as the wall material, is more conducive to the immobilization of lactic acid bacteria and the formation of biofilm-like structures. Generally, lactic acid bacteria within sodium alginate microcapsules exhibit a structure with a higher concentration on the outside and a relatively smaller concentration inside. This external aggregation is a key factor restricting the formation of biofilm-like microcapsules. In this invention, the sodium alginate and montmorillonite composite system reduces the excessive concentration of lactic acid bacteria on the outside of the microcapsules. On the one hand, this may be related to changes in the microcapsule structure, which promotes more uniform dispersion of lactic acid bacteria within the microcapsules and, to some extent, facilitates more uniform delivery of nutrients to the interior of the microcapsules. On the other hand, the cationic modified montmorillonite in this invention has an aggregation effect on negatively charged lactic acid bacteria, which is also more conducive to the immobilization of lactic acid bacteria and the formation of biofilms.

[0076] Based on the use of sodium alginate as a prebiotic wall material to achieve lactic acid bacteria coating, this invention further adds modified montmorillonite, which has the function of aggregating lactic acid bacteria and adsorbing postbiotics of lactic acid bacteria, to ensure that the postbiotic components produced by lactic acid bacteria are effectively retained in the microcapsules, thus constructing microcapsules co-immobilized with sodium alginate (prebiotic), biofilm-coated probiotics and their postbiotics.

[0077] This invention achieves the co-immobilization of prebiotics (microcapsule wall material) with biofilm-forming lactic acid bacteria and their post-biotics. Its effects are mainly reflected in three aspects: 1) The combination of biofilm-forming probiotics, sodium alginate wall material, and modified montmorillonite provides multi-layer protection for probiotics against environments such as humid heat processing and gastric acid and bile salts in the animal gastrointestinal tract; 2) The combination of prebiotics and biofilm-forming probiotics helps to provide a suitable nutrient source for probiotic colonization in the intestine; 3) The combination of prebiotics and biofilm-forming probiotics and their post-biotics can exert a synergistic effect, which helps to further improve their biological efficacy, so that the various metabolites and strain components produced by the strain can be utilized more fully and efficiently, and the fermentation strain products can be maximized.

[0078] Example 3:

[0079] The difference between the preparation method of the microcapsules in this embodiment and that in Example 2 is that bile salts and mannose were added in step 3.

[0080] Step (3): Lactic acid bacteria microcapsules: Microcapsule culture: Subsequently, weigh 10g of lactic acid bacteria microcapsules prepared in step (2), place them in 50mL of optimized culture medium, add 0.1mg of bile salts and 0.25g of mannose to the 50mL culture medium, and incubate at 37℃ for 24h. Collect the lactic acid bacteria microcapsules with biofilm.

[0081] Example 4: Antibacterial effect of lactic acid bacteria microcapsules on Escherichia coli

[0082] Experimental subjects: Lactic acid bacteria microcapsules prepared in Example 3, lactic acid bacteria microcapsules prepared in Comparative Example 2, and Lactobacillus rhamnosus bacterial solution.

[0083] Microcapsules have an antibacterial effect on Escherichia coli:

[0084] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37℃ for 24h.

[0085] (2) Preparation of the decapsulation solution: Weigh 0.65g of citric acid and 2.23g of disodium hydrogen phosphate and add them to 100mL of distilled water. Then adjust the pH to 7.2 to obtain the decapsulation solution.

[0086] (3) Weigh 1g of the lactic acid bacteria microcapsules prepared in Example 3 and the lactic acid bacteria microcapsules prepared in Comparative Example 2 into sterile centrifuge tubes, then add 1mL of decapsulation solution. After complete decapsulation, centrifuge to collect the precipitate, add 0.1mL of phosphate buffer to wash, and obtain the decapsulated microcapsule products of Example 3 and Comparative Example 2. The decapsulated microcapsule product of Example 3 consists of bacterial solution + sodium alginate + montmorillonite and its adsorbed biotics; the decapsulated microcapsule product of Comparative Example 2 consists of bacterial solution + sodium alginate.

[0087] (4) Take 1 mL of Lactobacillus rhamnosus seed culture obtained in step (1), centrifuge and discard the supernatant, add 0.1 mL of phosphate buffer and wash to obtain Lactobacillus rhamnosus bacterial culture group;

[0088] (5) Add 100 μL of Lactobacillus rhamnosus bacterial culture, 100 μL of the uncapsulated microcapsule product of Example 3, and 100 μL of the uncapsulated microcapsule product of Comparative Example 2 to a culture medium coated with enterotoxin-producing Escherichia coli, and measure the diameter of the inhibition zone.

[0089] As shown in Table 1, compared with the *Lactobacillus rhamnosus* bacterial culture group and the lactic acid bacteria microcapsules prepared in Comparative Example 2, the lactic acid bacteria microcapsules prepared in Example 3 have a significant inhibitory effect on enterotoxin-producing *Escherichia coli*. This indicates that the lactic acid bacteria microcapsules prepared in this invention have antibacterial capabilities in the environment and exhibit good stability, which may be related to the biofilm-forming probiotics and their adsorbed metabiotics in the sodium alginate + montmorillonite microcapsules.

[0090] Table 1. Effect of sodium alginate + montmorillonite-coated microcapsules on the antibacterial effect of enterotoxigenic Escherichia coli.

[0091] Diameter of the inhibition zone (mm) Unobservable Unobservable 10mm

[0092] Example 5: Probiotic survival rate of lactic acid bacteria microcapsules after high-temperature treatment

[0093] The seed culture obtained in step (1) of Example 3 is designated as the bacterial culture group; the microcapsules obtained in step (2) of Example 3 are designated as the uncultured group; and the lactic acid bacteria microcapsules obtained in step (3) of Example 3 are designated as the cultured group. The multi-layer coated microcapsules obtained in step (3) of Comparative Example 3 are designated as the multi-layer coated group.

[0094] Methods for determining the high-temperature tolerance of microcapsules:

[0095] (1) After centrifuging 10 mL of bacterial solution (3000 rpm for 15 min), Lactobacillus rhamnosus bacterial solution precipitate was obtained (still referred to as bacterial solution group). 10 g of microcapsules from the uncultured group, cultured group, and multi-layer coated group were also taken. Subsequently, the sterile centrifuge tubes of the bacterial solution group, uncultured group, cultured group, and multi-layer coated group were placed in a feed pellet mill and treated for 1 min in a humid heat environment with a conditioning temperature of 85℃ and a conditioning moisture content of 15%.

[0096] (2) Preparation of decapsulation solution: Weigh 0.65g citric acid and 2.23g disodium hydrogen phosphate and add them to 100mL distilled water. Then adjust the pH to 7.2 to obtain decapsulation solution; (3) Then place 1g of uncultured microcapsules, cultured microcapsules and multilayer coated microcapsules treated in step 1 into 10mL of decapsulation solution. After decapsulation is complete, the decapsulated uncultured microcapsule products, decapsulated cultured microcapsule products and decapsulated multilayer coated microcapsule products are obtained.

[0097] (4) Add the uncapsulated products obtained in step (3) to MRS solid culture medium for plating and counting. Figure 3 Results A indicate that, compared to the bacterial culture group where no surviving *Lactobacillus rhamnosus* was detected after high-temperature treatment, the uncultured group showed a certain degree of improved *Lactobacillus rhamnosus* survival rate at high temperatures. Compared to the uncultured group, the bacterial count in the cultured group increased approximately 1000-fold after high-temperature treatment; furthermore, compared to Comparative Example 3, the cultured group exhibited a higher surviving bacterial count at high temperatures. Figure 3 As shown in Figure B, the survival rates of the bacterial culture group and the uncultured group after high-temperature treatment were 0% (no *Lactobacillus rhamnosus* detected) and less than 0.1%, respectively, while the survival rate of *Lactobacillus rhamnosus* in the cultured group was over 25%. Furthermore, compared to the lactic acid bacteria microcapsules of Comparative Example 3, the lactic acid bacteria microcapsules prepared in the cultured group of Example 3 exhibited a higher survival rate of *Lactobacillus rhamnosus* within the microcapsules at high temperatures. The lactic acid bacteria microcapsules obtained by the microcapsule preparation method of this invention ensure the survival rate of lactic acid bacteria under moist heat processing conditions, and their stability is also improved.

[0098] Example 5: Effect of extrusion method on the high-temperature tolerance of probiotics in Lactobacillus anhydride microcapsules

[0099] (1) Lactic acid bacteria microcapsules prepared in Example 3;

[0100] (2) Microcapsules were prepared by endogenous emulsification as shown below:

[0101] S1: Aqueous phase preparation: 1g sodium alginate, 1g sodium montmorillonite, 0.48g calcium carbonate, and 60mL distilled water were magnetically stirred at 600rpm for 60min to obtain a mixture; after cooling, 0.2mL of Lactobacillus rhamnosus seed culture was added and thoroughly mixed to obtain the aqueous phase.

[0102] S2: Oil phase preparation: Add surfactant to 300 mL of oil phase (liquid paraffin) with a surfactant concentration of 0.2%. The surfactant used is Span 80 or Tween 80. Stir magnetically at 600 rpm for 60 min to obtain the oil phase.

[0103] S3: Slowly add the aqueous phase S1 to the oil phase S2 and stir magnetically for 20 minutes at 1000 rpm to obtain a mixture;

[0104] S4: Add 0.3 mL of acetic acid to the mixture obtained in S3, and stir magnetically at 500 rpm for 20 min;

[0105] S5: After completing (4), let it stand to allow the microcapsules to settle to the bottom layer. Recover the upper oil phase, leaving the microcapsules;

[0106] S6: Curing and Washing: The microcapsules prepared above were added to 300 mL of calcium chloride solution (150 mmol / L) and stirred for 30 min at 400 rpm. After curing, the microcapsules were filtered through a 500-mesh sieve to obtain the microcapsules.

[0107] S7: The microcapsules were then placed in an optimized culture medium and incubated at 37°C for 24 hours. The microcapsules were then collected. The weight ratio of the microcapsules to the volume of the culture medium was 1:5.

[0108] (3) Microcapsules were prepared by electrospray ionization as shown below:

[0109] 1g of sodium alginate and 1g of sodium montmorillonite were added to 60mL of sterile water and magnetically stirred at 600rpm for 60min to obtain a mixture. After cooling, 0.2mL of lactic acid bacteria seed culture was added, and the mixture was magnetically stirred at 600rpm for 15min to form an emulsion. Droplets were generated under an 8kV high static voltage, and a collection tank containing 150mmol / L calcium chloride solution was used for stirring and solidification at 400rpm for 30min. After solidification, the mixture was filtered through a 500-mesh sieve to obtain microcapsules. The microcapsules were then placed in an optimized culture medium and incubated at 37℃ for 24h before being collected. The weight ratio of the microcapsules to the volume of the culture medium was 1:5. The volume ratio of the emulsion to the calcium chloride solution was 1:8.

[0110] Methods for determining the high-temperature tolerance of microcapsules:

[0111] (1) Weigh 10g of the lactic acid bacteria microcapsules prepared in Example 3, the microcapsules prepared by endogenous emulsification method, and the microcapsules prepared by electrospray method and place them in sterile centrifuge tubes. Then place the sterile centrifuge tubes containing the microcapsules in a feed pellet mill and treat them for 1 min in a humid heat environment with a conditioning temperature of 85°C and a conditioning moisture content of 15%.

[0112] (2) Preparation of decapsulation solution: Weigh 0.65g citric acid and 2.23g disodium hydrogen phosphate and add them to 100mL distilled water. Then adjust the pH to 7.2 to obtain decapsulation solution; (3) Then place 1g of the three types of microcapsules in step (1) into 10mL of decapsulation solution. After decapsulation is complete, obtain the lactic acid bacteria microcapsule product prepared in Example 3 after decapsulation, the microcapsule product prepared by endogenous emulsification after decapsulation, and the microcapsule product prepared by electrospray method after decapsulation;

[0113] (4) Add the uncapsulated products obtained in step (3) to MRS solid culture medium for plate counting.

[0114] As shown in Table 2, compared with the endogenous emulsification method and the electrospray method, the lactic acid bacteria microcapsules prepared by the extrusion method in Example 3 exhibit better tolerance under conditioning conditions of 85°C and 15% moisture for 1 min. On the one hand, the microcapsule preparation method of this invention helps to form more regular microcapsules, which facilitates the uniform transfer of nutrients within the microcapsules, thereby promoting the growth of biofilm-coated probiotics. On the other hand, the extrusion method of this invention, under external pressure, helps to form denser microcapsules, which helps to reduce temperature conduction.

[0115] Table 2. Effect of extrusion method on the high temperature resistance of sodium alginate-montmorillonite composite microcapsules

[0116]

[0117] Example 6: Survival rate of probiotics in simulated gastrointestinal fluid after lactic acid bacteria microcapsules were placed in the fluid.

[0118] The seed culture obtained in step (1) of Example 3 is designated as the bacterial culture group; the microcapsules obtained in step (2) of Example 3 are designated as the uncultured group; and the lactic acid bacteria microcapsules obtained in step (3) of Example 3 are designated as the cultured group.

[0119] The simulated gastric juice formula is as follows: 47.2mM NaCl, 6.9mM KCl, 25mM NaHCO3, 0.9mM KH2PO4, 0.5mM (NH4)2CO3, 0.1mM MgCl2(H2O)6, pepsin (porcine source) 2000U / mL, pH adjusted to 2.0.

[0120] The simulated intestinal fluid formula is as follows: 38.4mM NaCl, 6.8mM KCl, 85mM NaHCO3, 0.8mM KH2PO4, 0.33mM MgCl2(H2O)6, 0.1% pancreatic enzyme and 1.5g / L bile salts, with the pH adjusted to 7.0.

[0121] Determination of the survival rate of lactic acid bacteria microcapsules in simulated gastrointestinal fluid:

[0122] (1) Weigh 1g of uncultured microcapsules and cultured microcapsules and place them in sterile centrifuge tubes respectively; weigh 1mL of Lactobacillus rhamnosus seed solution into a sterile centrifuge tube, then centrifuge at 3000rpm for 10min, remove the supernatant and retain the precipitate; then add 2mL of simulated gastric juice and treat for 2h, and take samples to obtain the bacterial solution group, uncultured microcapsules and cultured microcapsules after simulated gastric acid treatment; then centrifuge the three groups treated with gastric acid (centrifuge at 3000rpm for 10min), and place them in 2mL of simulated intestinal juice for 3h again, and further centrifuge the three groups treated with simulated intestinal juice (centrifuge at 3000rpm for 10min) to obtain the bacterial solution group, uncultured microcapsules and cultured microcapsules after simulated gastric acid + simulated intestinal juice treatment;

[0123] (2) Preparation of the decapsulation solution: Weigh 0.65g of citric acid and 2.23g of disodium hydrogen phosphate and add them to 100mL of distilled water. Then adjust the pH to 7.2 to obtain the decapsulation solution.

[0124] (3) The Lactobacillus rhamnosus bacterial solution obtained in step (1) after simulating gastric acid + simulating intestinal fluid, the uncultured group microcapsules, and the cultured group microcapsules were placed in 10mL of uncapsulation solution to uncapsulate completely.

[0125] (4) Add the uncapsulated products obtained in step (3) to MRS solid culture medium for plate counting.

[0126] Depend on Figure 4 The results showed that the survival rates of *Lactobacillus rhamnosus* capsules in the bacterial culture group and the uncultured group were 0 (not detected) and less than 0.1%, respectively. In contrast, the survival rate of *Lactobacillus rhamnosus* capsules in the cultured group was 43.5% after 2 hours of gastric fluid treatment and 41.05% after 3 hours of intestinal fluid treatment. This indicates that the lactic acid bacteria microcapsules prepared in this invention exhibit good resistance in the gastrointestinal tract.

[0127] Example 7: Release and colonization of lactic acid bacteria microcapsules in the mouse intestine

[0128] The microcapsules prepared in Example 3 and Comparative Example 3 were used in the experiment.

[0129] (1) Five-week-old male SPF-grade C57BL / 6 mice (purchased from Nanjing Jicui Pharmaceutical Biotechnology Co., Ltd.) were selected. The mice were randomly divided into three groups, and administered physiological saline, lactic acid bacteria microcapsules prepared in Comparative Example 3, and lactic acid bacteria microcapsules prepared in Example 3, respectively, via gavage. These groups were designated as the blank control group, the multi-layer coated group, and the single-layer coated group. The multi-layer coated group and the single-layer coated group contained 10... 9 Mice were administered microcapsule doses of CFU / d via gavage; the control group was administered physiological saline via gavage. Cecal contents were collected from mice on the morning of the 13th day.

[0130] (2) Extract DNA from the chyme using the TIANamp Bacteria DNAkit kit. Follow the kit instructions for specific steps to prepare the DNA template.

[0131] (3) Detection was performed using a Jena real-time PCR instrument. The PCR reaction used a 20 μL system. This included 10 μL of UltraSYBRMixture (2X), 1 μL of 10 μmol / L upstream and downstream primers, 2 μL of genomic DNA template, and then replenished with deionized water to a final volume of 20 μL. The PCR conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing for 40 s, 72℃ extension for 30 s, for a total of 40 cycles; and a final extension at 72℃ for 30 s. Fluorescence signal acquisition was performed at 72℃. After the reaction, a melting curve was established between 65 and 95℃, with the temperature increasing in increments of 0.5℃ every 5 s. The primer sequences for *Lactobacillus rhamnosus* are shown below: upstream primer: ATGTCCGTGACGAAAGCGAT; downstream primer: TTGTTCGCTGACAAACGCAG.

[0132] Depend on Figure 5 The results showed that, under the condition of equal bacterial concentration administered via gavage, the single-layer coated group (Example 3) significantly increased the amount of bacteria released from mouse digesta compared to the multi-layer coated group (Comparative Example 3). These studies indicate that the single-layer coated group (Example 3) has a better release effect in the mouse intestine.

[0133] Example 8: Survival of probiotics in lactic acid bacteria microcapsules after room temperature drying

[0134] The microcapsules obtained in step (2) of Example 3 are designated as the uncultured group; the lactic acid bacteria microcapsules obtained in step (3) of Example 3 are designated as the cultured group.

[0135] Room temperature drying experiment:

[0136] (1) Weigh 10g of uncultured microcapsules and cultured microcapsules respectively and place them in sterile centrifuge tubes. Then place the sterile centrifuge tubes containing the microcapsules in a vacuum drying oven, control the temperature at 37℃, control the pressure at -0.05MPa, and dry for 12h to obtain dried uncultured microcapsules and cultured microcapsules.

[0137] (2) Preparation of the decapsulation solution: Weigh 0.65g of citric acid and 2.23g of disodium hydrogen phosphate and add them to 100mL of distilled water. Then adjust the pH to 7.2 to obtain the decapsulation solution.

[0138] (3) Then weigh 1g of the uncultured microcapsules and cultured microcapsules from step (1) and after drying, place them in 10mL of decapsulation solution, and wait for complete decapsulation to obtain the decapsulated uncultured microcapsule product and the decapsulated cultured microcapsule product.

[0139] (4) Add the uncapsulated products obtained in step (3) to MRS solid culture medium for plate counting.

[0140] Depend on Figure 6 The results showed that, compared with the lactic acid bacteria microcapsules prepared in Comparative Example 2, the lactic acid bacteria microcapsules prepared in Example 3 had a 51-fold increase in the number of surviving bacteria under room temperature drying conditions. This improved the stability of the lactic acid bacteria during room temperature drying.

[0141] Example 9: Effect of protectants on the survival of probiotics in lactic acid bacteria microcapsules after room temperature drying

[0142] The microcapsules obtained in step (2) of Example 3 are designated as the uncultured group; the lactic acid bacteria microcapsules obtained in step (3) of Example 3 are designated as the cultured group.

[0143] The effect of protectants on the survival of microencapsulated lactic acid bacteria dried at room temperature:

[0144] (1) Weigh 1g of uncultured microcapsules and cultured microcapsules respectively and place them in sterile centrifuge tubes. Then add 5mL of protective agent and mix well to obtain uncultured microcapsules coated with protective agent and cultured microcapsules coated with protective agent.

[0145] The preparation method of the protective agent is as follows: Weigh 30g of trehalose, 15g of whey protein isolate and 1.5g of glutamic acid respectively and add them to 100mL of distilled water, and mix well;

[0146] (2) Place the uncultured microcapsules, cultured microcapsules, and uncultured and cultured microcapsules coated with protective agent obtained in step (1) into a vacuum drying oven, control the temperature at 37°C, control the pressure at -0.05MPa, and dry for 12 hours.

[0147] (4) Preparation of the decapsulation solution: Weigh 0.65g of citric acid and 2.23g of disodium hydrogen phosphate and add them to 100mL of distilled water. Then adjust the pH to 7.2 to obtain the decapsulation solution.

[0148] (5) Subsequently, 1g of dried microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, microcapsules containing a protective agent, and dried microcapsules containing a non-cultured group and microcapsules containing a protective agent were weighed and placed in 10mL of decapsulation solution. After complete decapsulation, the decapsulated products were obtained respectively.

[0149] (6) Add the uncapsulated products obtained in step (5) to MRS solid culture medium for plate counting.

[0150] Depend on Figure 7 The results showed that for both uncultured and cultured microcapsules, the addition of the protectant significantly increased the number of viable bacteria after drying at room temperature, reaching a level comparable to that before drying.

[0151] This is mainly related to the following factors: 1) Biomembranes are primarily composed of polysaccharides and proteins. The presence of polysaccharides and proteins helps to increase their glass transition temperature, ensuring that probiotics remain in a glassy or near-glassy state at room temperature, thus guaranteeing their survival under dry conditions at room temperature. 2) Based on the preparation of sodium alginate + montmorillonite immobilized microcapsules, this invention further adds trehalose and whey protein isolate, which have high glass transition temperatures, to the microcapsules. This further ensures that probiotics remain in a glassy state at room temperature. Furthermore, under drying conditions, cell membrane damage is the main factor causing probiotic death during drying. Trehalose can replace water molecules in the cell structure, thereby maintaining cell membrane integrity. Combined with glutamic acid, which has antioxidant functions, this further improves the stability and survival rate of probiotics during drying and subsequent storage.

[0152] II. Factors influencing probiotic growth and biofilm formation

[0153] 1. Effects of modified montmorillonite on probiotic growth and biofilm formation

[0154] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37℃ for 24h.

[0155] (2) 0.2 mL of *Lactobacillus rhamnosus* bacterial suspension was inoculated into 24-well plates containing 1 mL of culture medium at a ratio of 2% (bacterial suspension to culture medium volume). Four groups were set up. 0, 5 mg, 10 mg, and 15 mg of calcium-based montmorillonite, sodium-based montmorillonite, and chitosan-modified montmorillonite were added respectively to prepare culture solutions with concentrations of 0, 5, 10, and 15 mg / mL of calcium-based montmorillonite, sodium-based montmorillonite, and chitosan-modified montmorillonite. The solutions were then incubated statically at 37°C for 24 h. The OD600 value was detected using a microplate reader.

[0156] (3) After completing step (2), remove the upper suspension and wash the airborne bacteria at the bottom twice with PBS buffer. Add 150 μL of methanol to the culture plate and let it stand for 10 min to fix. Add 0.1 mL of 1% crystal violet solution for staining for 5 min, wash with PBS and dry. Add 500 μL of acetic acid (33%) to each well to fully dissolve the biofilm. Finally, place the 24-well culture plate into a multi-functional microplate fluorescence reader to determine the OD595 nm value.

[0157] (4) After completing step (3), montmorillonite was incubated with 0.2 mL of 5 μmol / L DAPI and 0.2 mL of 5 μmol / L FITC-ConA for 15 min and observed under a fluorescence microscope.

[0158] DAPI is a nucleic acid dye used to detect probiotics; FITC-ConA is a reagent for identifying polysaccharides in probiotic biofilms. Further fluorescent labeling was performed using the nucleic acid dye DAPI and the biofilm dye FITC-ConA. The merged image is an overlay.

[0159] Depend on Figure 8 Results A show that modified montmorillonite inhibits the growth of *Lactobacillus rhamnosus* to some extent in solutions with concentrations ranging from 5 to 15 mg / mL. However, Figure 8 As shown in B, Ca-MMT and CS-MMT at concentrations of 10 mg / mL, and Na-MMT, Ca-MMT, and CS-MMT at concentrations of 15 mg / mL can all promote the production of Lactobacillus rhamnosus biofilm.

[0160] from Figure 9 The fluorescence images of sodium-modified montmorillonite (Na-MMT) alone and Lactobacillus rhamnosus after co-culturing with sodium-modified montmorillonite (Na-MMT+LGG) show that Na-MMT has the ability to promote the colonization of Lactobacillus rhamnosus on the surface of sodium-modified montmorillonite and the formation of biofilm.

[0161] from Figure 10The fluorescence images of sodium-modified montmorillonite and chitosan-modified montmorillonite (CS-MMT) alone, and the fluorescence images of Lactobacillus rhamnosus after co-culturing with sodium-modified montmorillonite and chitosan-modified montmorillonite (CS-MMT+LGG) show that CS-MMT+LGG has the ability to promote the colonization of Lactobacillus rhamnosus on the surface of chitosan-modified montmorillonite and the formation of biofilm.

[0162] 2. Effects of culture medium composition on the growth and biofilm formation of Lactobacillus rhamnosus

[0163] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37°C for 24 hours.

[0164] (2) The MRS medium was formulated using a commercially available formula; the optimized medium was prepared by reducing the glucose content by 15 g / L and the beef meal content by 6 g / L compared to the MRS medium.

[0165] (3) 20 μL of Lactobacillus rhamnosus bacterial suspension was inoculated into 24-well plates containing 1 mL of culture medium at a ratio of 2% of bacterial suspension to culture medium volume. 500 μL of MRS medium and optimized medium were added respectively, and the plates were then incubated at 37℃ for 24 h. The OD600 value was detected using an ELISA reader.

[0166] (4) After completing step (3), remove the suspension and wash the airborne bacteria at the bottom twice with PBS buffer. Add 150 μL of methanol to the culture plate and let it stand for 10 min to fix. Add 0.1 mL of 1% crystal violet solution for staining for 5 min, wash with PBS, and dry. Add 500 μL of acetic acid (33%) to each well to fully dissolve the biofilm. Finally, place the 24-well culture plate into a multi-functional microplate fluorescence reader to determine the OD595 value.

[0167] OD600 is an important indicator of microbial growth. Crystal violet staining is an important method for detecting biofilm formation. For example... Figure 11 As shown, compared with the classic lactic acid bacteria culture medium MRS, the optimized culture medium can reduce the OD600 of Lactobacillus rhamnosus, which is to some extent unfavorable to the growth of Lactobacillus rhamnosus, but significantly increase the OD595, which means that the optimized culture medium has a significant effect on improving the biofilm formation ability of Lactobacillus rhamnosus.

[0168] 3. Effects of inoculum size on the growth and biofilm formation of Lactobacillus rhamnosus

[0169] (1) Seed culture preparation: After resuscitation, Lactobacillus rhamnosus was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37℃ for 24h.

[0170] (2) The MRS medium uses a commercially available formula; the medium is optimized.

[0171] (3) Lactobacillus rhamnosus bacterial suspension was inoculated into 24-well plates at different bacterial suspension-to-culture medium volume percentages of 0.125%, 0.25%, 0.5%, 1%, 2%, and 4%, respectively. 500 μL of MRS medium and optimized medium were added, and the plates were then incubated statically at 37°C for 24 h. The OD600 value was detected using a microplate reader.

[0172] (4) After completing step (3), remove the suspension and wash the airborne bacteria at the bottom twice with PBS buffer. Add 150 μL of methanol to the culture plate and let it stand for 10 min to fix. Add 1% crystal violet solution for staining for 5 min, wash with PBS, and dry. Add 500 μL of acetic acid (33%) to each well to fully dissolve the biofilm. Finally, place the 24-well culture plate into a multifunctional microplate fluorescence reader to determine the OD595 nm value.

[0173] Inoculation concentration significantly affects the growth and biofilm formation of *Lactobacillus rhamnosus*. For example... Figure 12 As shown in Figure A, in MRS medium, seed culture containing bacteria at a volume percentage of 0.50%–4% promoted the growth of *Lactobacillus rhamnosus*. Specifically, compared to the group with a seed culture volume percentage of 0.125%, seed culture containing 0.5%, 1%, 2%, and 4% significantly increased the OD600 value of *Lactobacillus rhamnosus*. In optimized medium, seed culture containing bacteria at a volume percentage of 0.25%–4% promoted the growth of *Lactobacillus rhamnosus*. Specifically, compared to the group with 0.125% seed culture, seed culture containing 0.25%, 0.5%, 1%, 2%, and 4% significantly increased the OD600 value of *Lactobacillus rhamnosus*. Furthermore, as... Figure 12 As shown in B, in MRS medium, compared with the seed culture group with a bacterial culture volume percentage of 0.125%, the seed culture groups with bacterial culture volume percentages of 0.25%, 0.5%, 1%, and 2% had no significant effect on the OD595 value of *Lactobacillus rhamnosus*. However, when the bacterial culture volume percentage exceeded 4%, it significantly reduced the OD595 value of *Lactobacillus rhamnosus*. In the optimized medium, compared with the seed culture group with a bacterial culture volume percentage of 0.125%, the seed culture groups with bacterial culture volume percentages of 0.25%, 0.5%, 1%, and 2% significantly increased the OD595 value of *Lactobacillus rhamnosus*. However, when the added concentration exceeded 4%, it significantly reduced the OD595 value of *Lactobacillus rhamnosus*.

[0174] 4. Effects of bile salt concentration on probiotic growth and biofilm formation

[0175] (1) Seed culture preparation: After the Lactobacillus rhamnosus was revived, it was inoculated into sterile MRS medium at a bacterial culture volume ratio of 2% to culture medium, and then incubated at 37°C for 24 hours.

[0176] (2) The MRS medium was formulated using a commercially available formula; the optimized medium was prepared by reducing the glucose content by 15 g / L and the beef meal content by 6 g / L compared to the MRS medium.

[0177] (3) Weigh 0.025g, 0.05g, 0.1g, 0.4g and 0.8g of porcine bile salts respectively, and add them to 100mL of MRS medium and optimized medium to prepare MRS medium and optimized medium with different concentrations of porcine bile salts, with concentration gradients of 0.00025g / ml, 0.0005g / ml, 0.001g / ml, 0.004g / ml and 0.008g / ml.

[0178] (4) Add 10 μl of Lactobacillus rhamnosus culture to 1 mL of MRS medium and optimized medium containing different concentrations of porcine bile salts prepared in step (3), inoculate into 24-well plates, and incubate at 37°C for 24 h; use an enzyme-linked immunosorbent assay (ELISA) reader to detect the OD600 value.

[0179] (5) After completing step (4), remove the suspension and wash the airborne bacteria at the bottom twice with PBS buffer. Add 150 μL of methanol to the culture plate and let it stand for 10 min to fix. Add 1% crystal violet solution for staining for 5 min, wash with PBS, and dry. Add 500 μL of acetic acid (33%) to each well to fully dissolve the biofilm. Finally, place the 24-well culture plate into a multifunctional microplate fluorescence reader to determine the OD595 value.

[0180] like Figure 13 As shown in Figure A, regardless of whether it was MRS medium or the optimized medium, bile salt concentration in the range of 0.00025%-0.004% had no significant effect on the growth of *Lactobacillus rhamnosus*. However, when the bile salt concentration reached 0.008%, it inhibited the OD600 of *Lactobacillus rhamnosus* to some extent. Figure 13 As shown in B, under MRS medium conditions, bile salt concentrations of 0.0005%, 0.001%, 0.002%, 0.004%, and 0.008% all promoted biofilm formation (OD595) in *Lactobacillus rhamnosus* compared to 0.00025%. However, under optimized medium conditions, bile salt concentrations of 0.002% and 0.004% both promoted biofilm (OD595) formation compared to 0.00025%.

[0181] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A method for preparing lactic acid bacteria microcapsules, characterized in that, Includes the following steps: Step 1: Add sodium alginate and modified montmorillonite to sterile water and stir until homogeneous to obtain a mixture; after cooling the mixture, add lactic acid bacteria seed culture to form an emulsion; the modified montmorillonite is selected from at least one of sodium-modified montmorillonite, calcified montmorillonite, and sodium-modified and chitosan-modified montmorillonite; the lactic acid bacteria are selected from Lactobacillus rhamnosus; the mass-volume ratio of sodium alginate to sterile water is 1%–3%; the mass-volume ratio of modified montmorillonite to sterile water is 1%–3%; The emulsion was sprayed into a calcium chloride solution using an extrusion method, stirred and solidified, and then filtered to obtain microcapsules. Step 2: Microcapsule culture: The microcapsules prepared in Step 1 are placed in a lactic acid bacteria liquid culture medium for culture. After culture, lactic acid bacteria microcapsules are obtained. The lactic acid bacteria liquid culture medium is an optimized MRS liquid culture medium, which has the following composition: peptone 10 g / L, beef meal 2 g / L, yeast powder 4 g / L, glucose 5 g / L, dipotassium hydrogen phosphate 2 g / L, diammonium hydrogen citrate 2 g / L, sodium acetate 5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, Tween 80 1 g / L, pH 5.7 ± 0.

2.

2. The method for preparing lactic acid bacteria microcapsules according to claim 1, characterized in that, The volume percentage of the lactic acid bacteria seed liquid to sterile water is 0.2-0.5%; the volume ratio of the emulsion to the calcium chloride solution is 1:8, and the concentration of the calcium chloride solution is 150-300 mmol / L. The weight ratio of the microcapsules to the volume ratio of the lactic acid bacteria liquid culture medium in step 2 is 1:5 to 1:

15.

3. The method for preparing lactic acid bacteria microcapsules according to claim 1, characterized in that, The lactic acid bacteria liquid culture medium in step 2 also contains additives; the additives are selected from at least one of bile acids and mannose.

4. The method for preparing lactic acid bacteria microcapsules according to claim 1, characterized in that, After step 2, add step 3: place the lactic acid bacteria microcapsules obtained in step 2 into a protective agent and stir evenly; the protective agent is a mixed solution composed of trehalose, whey protein isolate and glutamic acid, wherein the mass concentration of trehalose is 20-30 wt%, the mass concentration of whey protein isolate is 10-15 wt%, and the mass concentration of glutamic acid is 1-2 wt%.

5. Lactic acid bacteria microcapsules obtained by the preparation method according to any one of claims 1-4.

6. The application of the lactic acid bacteria microcapsules according to claim 5 in the preparation of probiotic products.

7. The application according to claim 6, characterized in that, The probiotic product is a probiotic additive.

Images