Application of ribozyme MdRNS3a in breeding of apple comprehensive resistance
Patent Information
- Application Number
- CN202510613854.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2026-08-21
- Estimated Expiration
- 2045-05-13
AI Technical Summary
然而,该调控机制在多年生木本植物尤其是苹果属物种中,相关研究仍处于起步阶段
[0040]通过在苹果GL3组培苗和枝条上,利用VIGS(Virus-induced gene silencing)技术沉默苹果核糖核酸酶MdRNS3a,发现沉默MdRNS3a可增强苹果的抗病性,这将在防治苹果病害中发挥重要作用,同时为苹果的分子育种打下良好的基础。
Smart Images

Figure CN120555500B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular disease resistance technology, specifically to the comprehensive disease resistance application of apple ribonuclease MdRNS3a. Background Technology
[0002] Apple fungal diseases are a leading biological stressor threatening the sustainable development of the global apple industry, causing over 20% yield loss annually and billions of dollars in economic losses. This disease system primarily includes two infection types: foliar and branch-related. Early leaf drop is a typical example of a foliar disease, caused by a combination of three main pathogens. *Alternaria alternata* f. sp. *mali*, belonging to the genus *Alternaria* in the subphylum Deuteromycetes, secretes cytotoxins such as AM toxin, which rapidly damage leaf cell membrane structures, leading to protoplast disintegration. *Marssonina coronaria* (Ellis & Davis) Davis, belonging to the order *Discocephala* in the class Coelomycetes, is an obligate parasitic fungus. Its conidiophores are embedded under the epidermis of diseased leaves, emerging after maturation. In the early stages of infection, this pathogen forms pinpoint-sized brown spots on the leaf surface. As the disease progresses, the spots gradually expand into nearly circular structures with a grayish-white center, dark brown edges, and a surrounding green halo. In the later stages of development, black conidiophores appear scattered on the surface of the spots. When multiple spots merge, they can cause large-scale yellowing and leaf drop. Apple anthracnose leaf blight pathogen (Colletotrichum fructicola Prihastuti et al.) belongs to the genus *Colletotrichum* and has latent infection characteristics. It overwinters as mycelium on diseased branches and fruits, and its conidia spread rapidly under high temperature and humidity. It is highly pathogenic, rapidly multiplies, and secretes various extracellular enzymes that destroy cell walls. When the disease occurs, black pinpoint-sized spots first appear on the leaves, later expanding into irregular dark brown large spots. Due to its sudden onset of leaf drop, it can cause massive leaf drop in the orchard within a few weeks, reducing the tree's photosynthetic efficiency by 30%-50%, severely affecting fruit development and marketability.
[0003] In the field of apple branch and trunk diseases, *Botryosphaeria dothidea* (Moug.:Fr.) Ces. & De Not. and *Valsa mali* Miyabe et Yamada pose serious threats. *Botryosphaeria dothidea* typically infects branches and trunks in the high humidity of July and August, causing concentric ring-shaped lesions that gradually develop into ulcers, damaging the xylem vessels and affecting the transport of nutrients and water within the tree. Apple rot, on the other hand, is a highly destructive disease in my country's main apple-producing areas. Its pathogen disrupts the vascular system, leading to physiological dysfunction in the tree, and the mortality rate of infected plants can exceed 90% within three years. Currently, control measures mainly based on chemical agents are severely limited in effectiveness due to factors such as increasing pathogen resistance and ecological pressures. Therefore, in-depth research into the resistance mechanisms of host plants and the development of breeding programs based on molecular biology techniques have become important directions for the green control of apple branch and trunk diseases.
[0004] In recent years, breakthroughs have been made in the functional study of transfer RNA (tRNA)-derived small RNAs (tsRNAs) in the field of plant-pathogen interactions. Studies have found that specific endonucleases can mediate tRNA cleavage during plant-pathogen interactions, thereby generating tsRNAs with regulatory activity. Using the model plant Arabidopsis thaliana as a research subject, it has been confirmed that RNS3a, a member of the RNase T2 family, can negatively regulate plant disease resistance signaling pathways by generating 5′-tsRNAs. When the RNS3a gene is lost, the mutant plants show a significant increase in resistance to *Pseudomonas syringae*. However, research on this regulatory mechanism in perennial woody plants, especially *Malus* species, is still in its early stages. Currently, the specific mechanism of action of RNS3a homologous proteins in apple's resistance to fungal pathogen infection remains unclear, which seriously hinders the research and application of molecular design breeding technology for apple disease resistance based on the theory of tsRNA regulatory networks. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention aims to provide an application of the ribonuclease MdRNS3a in apple integrated resistance breeding. Based on a virus-induced gene silencing (VIGS) technology platform, this invention achieves specific silencing of the MdRNS3a gene in apple GL3 tissue culture seedlings and branches through Agrobacterium-mediated genetic transformation. In MdRNS3a-silenced lines, tsRNA biosynthesis is significantly inhibited, while the expression level of its downstream target gene MdTIR is upregulated 3-4 times. Phenotypic analysis shows that the transgenic materials exhibit significantly enhanced resistance to infection. This invention reveals the molecular mechanism by which MdRNS3a negatively regulates broad-spectrum disease resistance in apples through the tsRNAs-MdTIR regulatory axis, providing a patentable gene silencing target for creating new disease-resistant apple germplasm, and has significant application value in molecular design breeding of fruit trees.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] The application of a ribonuclease gene MdRNS3a in resistance to fungal infections is characterized by improving the resistance of apples to fungal infections by silencing the ribonuclease gene MdRNS3a in apple plants.
[0008] The nucleotide sequence of the ribonuclease gene MdRNS3a is shown in SEQ ID NO.1.
[0009] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
[0010] In the above technical solution, virus-induced gene silencing (VIGS) technology is used to target and silence the MdRNS3a gene. The specific experimental procedure is as follows:
[0011] (a) Construct a TRV viral vector containing the target sequence of the ribonuclease gene MdRNS3a, wherein the target sequence is the nucleotide fragment from position 1 to 300 of SEQ ID NO.1 (SEQ ID NO.4);
[0012] (b) The TRV viral vector from step (a) was transformed into Agrobacterium tumefaciens to obtain engineered bacteria;
[0013] (c) The engineered bacteria were introduced into apple plants by Agrobacterium infection to induce silencing of the MdRNS3a gene;
[0014] (d) Screening plants with silenced MdRNS3a gene significantly improved their overall resistance to apple.
[0015] Primers for detecting the expression of the above-mentioned ribonuclease gene MdRNS3a are characterized in that the sequences of the primers are shown in SEQ ID NO.2-3.
[0016] A target gene, characterized in that the nucleotide sequence of the target gene is as shown in SEQ ID NO.4 (i.e., nucleotides 1-300 in SEQ ID NO.1).
[0017] Primers for detecting the expression of the above-mentioned target genes are characterized in that the sequences of the primers are shown in SEQ ID NO.5-6.
[0018] A recombinant TRV viral vector (pTRV2-MdRNS3a), characterized in that the viral vector contains the target gene as described in claim 3, the nucleotide sequence of which is shown in SEQ ID NO.7.
[0019] The application of the above-mentioned recombinant TRV virus vector is characterized in that the recombinant TRV virus vector is used to improve the resistance of apple plants to fungal infection.
[0020] A method for improving the resistance of apple plants to fungal infections, characterized by comprising the following steps:
[0021] Step 1: Insert the apple ribonuclease gene MdRNS3a into the XbaI and KpnI restriction sites on the TRV2 vector, and transform it into E. coli DH5α to obtain a vector that silences the MdRNS3a gene.
[0022] Step 2: Extract plasmids from the silenced MdRNS3a gene vector obtained in Step 1;
[0023] Step 3: Transfer the plasmid obtained in Step 2 into Agrobacterium to prepare a transgenic Agrobacterium bacterial culture;
[0024] Step 4: Transfer the transgenic Agrobacterium tumefaciens solution obtained in Step 3 into apple leaves and branches.
[0025] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
[0026] The specific operation process of the above method is as follows:
[0027] S1: Total RNA was extracted from infected apples using the CTAB method;
[0028] S2: Reverse transcribe the total RNA extracted in S1 into cDNA;
[0029] S3: Using the reverse transcription template obtained in S2 and RT-PCR primers, clone the specific gene fragment described in claim 1;
[0030] S4: Insert the gene obtained in S3 into the two restriction sites of XbaI and KpnI on the TRV2 vector and transform it into E. coli DH5α.
[0031] S5: Extract plasmids from the silent gene vector constructed in S4 and TRV1.
[0032] S6: The plasmids extracted in S5 were transferred into Agrobacterium and plated onto solid YEP medium containing antibiotics. The plates were incubated upside down at 28°C for 24-48 hours. The antibiotics contained 50 mg / L Kana and 20 mg / L Rif.
[0033] S7: Select a single spot from Agrobacterium cultured in S6, add 2 ml of YEP liquid medium containing 50 mg / L Kana and 20 mg / L Rif, and incubate overnight at 28°C and 180 rpm.
[0034] S8: Take 80 μL of Agrobacterium cultured in S7, add 4 ml of YEP liquid medium containing 50 mg / L Kana, 20 mg / L Rif and 10 μM acetylsyl syringone, and incubate at 28℃ and 180 rpm for 12-16 h.
[0035] S9: Centrifuge the Agrobacterium cultured in S8 at 10000 rpm for 1 min at room temperature to remove the culture medium; suspend the above bacterial culture in 1-2 mL of suspension by vortexing; take 10 μL of the vortexed bacterial culture and add it to 990 μL of suspension to obtain a bacterial cell suspension, measure its OD600 using a spectrophotometer, and adjust the bacterial cell suspension to OD600. 600 =1.0, stand at room temperature for 2-5 hours; the above suspension includes: 10mM MES-KOH with pH adjusted to 5.2, 10mM MgCl2, and 100μM acetylsylgenone;
[0036] S10: Before use, vortex or pipette the suspended bacterial cells in the bacterial solution obtained in S9, mix them 1:1, and then use a 1mL syringe without a needle to draw up the above bacterial solution, avoiding the leaf veins. After making small holes in the apple leaf with the needle of the 1mL syringe, inject the bacterial solution into the leaf, injecting 1-2 holes in each leaf.
[0037] S11: Before use, the bacterial solution obtained from S9 is vortexed or pipetteed to suspend the bacterial cells, mixed 1:1, and then vacuumed to transfer the bacterial solution into the branches.
[0038] S12: Observe the leaves and branches after 12 and 10 days.
[0039] The beneficial effects of applying the ribonuclease MdRNS3a described in this invention in apple integrated resistance breeding are as follows:
[0040] By silencing the apple ribonuclease MdRNS3a in apple GL3 tissue culture seedlings and branches using VIGS (Virus-induced gene silencing) technology, it was found that silencing MdRNS3a can enhance the disease resistance of apples, which will play an important role in the prevention and control of apple diseases, and at the same time lay a good foundation for the molecular breeding of apples. Attached Figure Description
[0041] The present invention includes the following figures:
[0042] Figure 1 Figure 1. Experimental results of enhancing the resistance of the susceptible apple GL3 variety to silencing MdRNS3a to apple leaf spot, apple brown spot, and apple anthracnose leaf blight.
[0043] Figure 2 Figure 1 shows the experimental results of enhancing the resistance of the GL3 apple variety to ring rot and apple rot by silencing MdRNS3a. Detailed Implementation
[0044] The present invention will be further described in detail below with reference to the accompanying drawings.
[0045] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0046] The contents not described in detail in this specification are existing technologies known to those skilled in the art.
[0047] I. Construction of plant expression vector for MdRNS3a.
[0048] RNA was extracted from apple tissue culture leaves using the CTAB method. 500 ng of RNA was reverse transcribed into cDNA using the random primers and reverse transcription reagents provided with the Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNAPurge) reverse transcription kit. Using the cDNA as a template, upstream and downstream primers were used:
[0049] TRV2-RNS3a-F: 5'-TAAGGTTACCGAATTCTCTAGAATATGCTTTCCGGGATACTCCATATT-3'
[0050] TRV2-RNS3a-R: 5'-CGAGACGCGTGAGCTCGGTACCAGTCCTGAGAAACACAAAGAACCGA-3'
[0051] The specific sequence of MdRNS3a was obtained by PCR amplification. TRV2-MdRNS3a was constructed using VIGS (Virus-induced genesilencing) technology. The MdRNS3a gene specific sequence was ligated into the TRV2 vector using XbaI and KpnI restriction sites, and transformed into *E. coli* DH5α. The bacterial culture was then plated on LB agar plates containing kanamycin, and positive clones were screened by colony PCR. Sequencing and alignment of one positive clone confirmed that it indeed contained the MdRNS3a gene sequence with the correct reading frame, indicating that the recombinant plasmid was constructed correctly. This recombinant plasmid was named TRV2-MdRNS3a.
[0052] The specific steps are as follows:
[0053] Enzyme digestion reaction system:
[0054] Green Buffer (Thermo) 4μL
[0055] 2 μL each of XbaI and KpnI
[0056] 20 μL of recovered product
[0057] DEPC water was added to a final volume of 40 μL.
[0058] The above reaction system was placed in a 37°C water bath for 24 hours. The recovered products were then detected by agarose gel electrophoresis. Fragments of the correct size were selected and recovered using a recovery kit.
[0059] T4 ligase ligation system:
[0060]
[0061] The above reaction system was placed in a metal bath at 16°C, and after 24 hours, 20 μL of the above ligation system was transferred to Escherichia coli DH5α.
[0062] 3. Agarose gel recovery of the target fragment
[0063] Use the recovery kit, following the instructions in the kit's manual.
[0064] (1) Cut out the agarose containing the target sequence fragment, remove as much excess gel as possible, add 3 gel volumes of Buffer B2, and mix intermittently until the gel block is completely melted.
[0065] (2) Add 200 μL of isopropanol and mix well.
[0066] (3) Transfer the mixture to a column separation and purification column, centrifuge at 12,000×g for 60s, and discard the waste liquid in the collection tube.
[0067] (4) Add 300 μL of Buffer B2 to the purification column, centrifuge at 12,000 × g for 30 seconds, and discard the waste liquid in the collection tube.
[0068] (5) Add 500 μL Wash Buffer to the purification column, centrifuge at 12,000 × g for 30 s, and discard the waste liquid in the collection tube.
[0069] (6) Repeat once.
[0070] (7) After 2 minutes of air exposure, place it in a fume hood and blow it for 5 minutes.
[0071] (8) Take a new 1.5 mL centrifuge tube, place the purification column in the new 1.5 mL centrifuge tube, add 30 μL of TEBuffer preheated at 55 °C, place at room temperature for 2 min, and centrifuge at 12,000 × g for 60 s.
[0072] (9) Discard the adsorption column and store the recovered product in a -20°C refrigerator.
[0073] 4. Escherichia coli DH5α transformation process:
[0074] Add 10 μL of the ligated vector to 30 μL of *E. coli* DH5α, incubate on ice for 30 min, heat shock at 42°C for 30 s, incubate on ice for 2 min, then add 200 μL of liquid LB medium, place on a shaker at 37°C, shake at 200 rpm for 40-60 min, and centrifuge at 10,000 rpm for 1 min at room temperature. Aspirate 200 μL of the supernatant, suspend the bacterial cells in the remaining liquid, spread on LB+Amp solid medium, and incubate overnight at 37°C.
[0075] 5. Spot removal:
[0076] Single colonies after overnight culture were picked and placed in 200 μL of LB+Kana liquid medium and placed on a shaker at 37°C and shaken at 200 rpm for 3 hours.
[0077] 6. Bacterial PCR:
[0078]
[0079] The above system was subjected to 35 cycles: 95℃ for 3 min; 95℃ for 1 min; 58℃ for 30 s; 72℃ for 30 s; 72℃ for 10 min; 16℃ for 1 min.
[0080] Detection was performed using 1% agarose gel electrophoresis, followed by electrophoresis in 0.1% TAE buffer at 70-110V for approximately 15 minutes. Ethidium bromide staining was then performed, and the size of the PCR product fragments was determined under UV light. Bacterial suspensions with the correct band size were selected.
[0081] 2. Transform the TRV2-MdRNS3a cloning plasmid into Agrobacterium EHA105 using the freeze-thaw method.
[0082] 1. Plasmid extraction (Vazyme, FastPure Plasmid Mini Kit, DC201)
[0083] (1) Take 1-5 ml of overnight culture (12-16 h) and add it to a 2 ml centrifuge tube. Centrifuge at 10000 rpm for 1 min. Discard the culture medium and aspirate any remaining liquid.
[0084] (2) Add 250 μL of Buffer P1 (RNase A has been added) to the centrifuge tube and vortex to mix.
[0085] (3) Add 250 μL of Buffer P2 to step 2 and gently mix by inverting the container 8-10 times.
[0086] (4) Add 350 μL of Buffer P3 to step 3, immediately and gently invert the container 8-10 times, and centrifuge at 12000 rpm for 10 min.
[0087] (5) Place the FastPure DNA Mini Columns adsorption column into a 2ml Collection Tube. Carefully transfer the supernatant from step 4 into the adsorption column using a pipette, and centrifuge at 12000 rpm for 30 seconds. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube;
[0088] (6) Add 600 μL of Buffer PW2 (diluted with anhydrous ethanol) to the adsorption column. Centrifuge at 12000 rpm for 30 s. Discard the waste liquid and return the adsorption column to the collection tube;
[0089] (7) Repeat step 6;
[0090] (8) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 1 min to dry the adsorption column;
[0091] (9) Place the adsorption column into a new sterile 1.5 ml centrifuge tube. Add 30-100 μL of Elution Buffer to the center of the membrane on the adsorption column. Incubate at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min to elute the DNA;
[0092] (10) Discard the adsorption column and store the DNA product at -20℃.
[0093] 2. Agrobacterium-mediated transformation:
[0094] (1) Take a tube of prepared competent cells, thaw them completely on ice, and then gently suspend the cells.
[0095] (2) Add 5-10 μL of plant expression vector plasmid, mix gently, and place on ice for 30 min.
[0096] (3) Cold shock in liquid nitrogen for 1 min.
[0097] (4) Heat shock at 37℃ for 5 minutes, then place on ice for 2 minutes.
[0098] (5) Add 500 μL of YEP liquid culture medium and incubate at 28℃ and 140 rpm for 4-6 h with shaking.
[0099] (6) Centrifuge at 4000 rpm for 3 min at room temperature, remove about 400 μL of supernatant, and suspend the cells in the remaining culture medium.
[0100] (7) Spread the bacteria on solid YEP medium containing antibiotics (50 mg / L Kana, 20 mg / L Rif).
[0101] (8) Invert the plate at 28℃ for 24-48h.
[0102] III. Agrobacterium tumefaciens instantaneously infects the leaves of apple GL3 tissue culture seedlings.
[0103] Apple GL3 tissue culture seedlings were cultured in a light incubator at 25℃ and 50% humidity, with a day / night length of 16h / 8h and a light intensity of 200μmol·m⁻²·s⁻¹. When the plants had 5-6 true leaves, each plant was numbered, and one true leaf was collected and injected with Agrobacterium. The Agrobacterium injection method is described by Bai et al. (2011).
[0104] (1) Pre-culture: 2 mL of YEP liquid medium (50 mg / L Kana, 20 mg / L Rif), Agrobacterium plaque or glycerol bacteria, cultured overnight at 28°C and 180 rpm.
[0105] (2) This culture: 4 mL of YEP liquid medium (with the corresponding antibiotic and 10 μM acetylsalicylic acid), add 1 / 50 volume of bacterial solution (80 μL), and culture at 28℃ and 180 rpm for 12-16 h.
[0106] (3) Centrifuge at 10,000 rpm for 1 min at room temperature, remove the culture medium, and suspend the bacterial cells in 1-2 mL of suspension (vortex shaking is acceptable).
[0107] Add 10 μL of bacterial culture to 990 μL of suspension and measure the OD using a spectrophotometer. 600Adjust the bacterial suspension to OD600 = 1.0. Let it stand at room temperature for 2-5 hours.
[0108] Suspension: 10 mM MES-KOH (pH 5.2), 10 mM MgCl2, 100 μM acetylsylgenone.
[0109] (4) Before using the bacterial solution, vortex or pipette the suspended bacterial cells and draw up the bacterial solution with a 1mL syringe without a needle.
[0110] (5) Avoiding the leaf veins, make small holes in the leaf with a syringe needle, press the small holes with a syringe filled with bacterial solution, and press the small holes with the fingers of the other hand in the opposite direction of the leaf. Slowly apply force to inject the bacterial solution into the leaf. The color of the injected part will become lighter. Inject 1-2 holes in each leaf.
[0111] (6) Samples were taken for observation 12 days after Agrobacterium injection.
[0112] IV. Real-time PCR Reaction System and Procedure
[0113] MdRNS3a specific primers (F: GAATGGGAAAAGCACGGGAC (SEQ ID NO.2); R: CGATGATGTCTTGGCCGGAA (SEQ ID NO.3)) and MdTIR specific primers (F: TCACCTGCCCTTTTGGAAGC (SEQ ID NO.5); R: TATGGCCCCACGACATTTGA (SEQ ID NO.6)). Internal control MdACTIN: F: TGACCGAATGAGCAAGGAAATTACT; R: TACTCAGCTTTGGCAATCCACATC. Quantitative PCR was performed using SYBR Green premixed PCR solution (TIANGEN, FP121221) on an Applied Biosystems 7500. The PCR reaction program was as follows: 95℃, 15 min; 95℃, 10 s; 60℃, 30 s, for a total of 40 cycles. Results were obtained using 2... -ΔΔCt The method was used for statistical analysis (Livak and Schmittgen, 2001).
[0114] Test results are shown Figure 1 The expression level of MdRNS3a in GL3 tissue culture seedlings susceptible to disease, 12 days after transient silencing of MdRNS3a mediated by Agrobacterium-mediated transient silencing. WT represents GL3 tissue culture seedlings without transient infection; EV represents GL3 tissue culture seedlings with transient infection using an empty vector; TRV-RNS3a represents GL3 tissue culture seedlings with transient expression of silencing TRV2 vector. Figure 1C (expression level of the target gene MdTIR in Agrobacterium-mediated transient expression of susceptible GL3 tissue culture seedlings 12 days later) and Figure 2 The expression level of MdRNS3a in GL3 branches of the susceptible variety A (10 days after transient silencing of MdRNS3a by Agrobacterium-mediated vector) is shown in Figure 1. WT represents GL3 branches without transient infection; EV represents GL3 branches with transient infection using an empty vector; TRV-RNS3a represents GL3 branches with transient expression of the silenced TRV2 vector. Figure 2 The expression level of the target gene MdTIR in the branches of the susceptible GL3 variety mediated by Agrobacterium-mediated transient expression 10 days later.
[0115] from Figure 1 China A and Figure 2 As shown in Figure A, the relative expression level of MdRNS3a in the TRV-RNS3a treatment group was significantly reduced to 0.5 (WT = 1.0, EV = 1.0), indicating a gene silencing efficiency of 50%; there was no significant difference between EV and WT, excluding vector interference. Figure 1 C and Figure 2 As can be seen from C, in the TRV-RNS3a silencing group, the relative expression level of MdTIR was significantly increased to 3-4 times (WT=1.0, EV=1.0).
[0116] V. Detection of tsRNA using Northern blot method.
[0117] 5'-modified digoxigenin-labeled tsRNA and U6 probe (tsRVal_probe: CCGACTACACCACCCAGAC; U6 probe: CTCGATTTATGCGTGTCATCCTTGC) were synthesized. 60 μg of RNA (CTAB extracted) was added to 2× loading buffer, incubated at 95℃ for 5 min, then cooled to 4℃, and loaded onto a 15% polyacrylamide gel (containing 7M urea). Electrophoresis was performed at 100V for 3 h in 1×TBE buffer; electroporation was then performed on a nylon membrane at 300mA and 4℃ in 1×TBE buffer; crosslinking was performed at 1200mJ for 2 min. Pre-hybridization, hybridization, membrane washing, and signal detection were then performed using a digoxigenin hybridization detection kit (Mylab Corporation).
[0118] Test results are shown Figure 1 The figure shows the expression level of tsRNA in GL3 tissue culture seedlings of Agrobacterium-mediated transient silencing of MdRNS3a 12 days after detection by Northern Blot. WT represents GL3 tissue culture seedlings without transient infection; EV represents GL3 tissue culture seedlings with transient infection using an empty vector; TRV-RNS3a represents GL3 tissue culture seedlings with transient expression of the silenced TRV2 vector. Figure 2 The expression level of tsRNA in GL3 branches of the susceptible GL3 variety after 10 days of transient silencing of MdRNS3a by Agrobacterium-mediated DNA. WT represents GL3 branches without transient infection; EV represents GL3 branches with transient infection using an empty vector; TRV-RNS3a represents GL3 branches with transient expression using a silenced TRV2 vector.
[0119] from Figure 1 China B and Figure 2 As shown in Figure B, the band intensity of tsRNA in the TRV-RNS3a gene silencing group was significantly reduced compared with the untreated control group (WT) and the empty vector control group (EV), indicating that MdRNS3a has a positive regulatory effect on tsRNA expression.
[0120] 6. Inoculate apple leaves and branches with fungi.
[0121] (1) Culture the fungus in the dark on PDA medium for 7 days.
[0122] (2) Add 2 mL of sterile water, gently scrape off the spore suspension with a spreader, and put it into a 2 mL centrifuge tube.
[0123] (3) Use a 1mL syringe without a needle to draw up the spore suspension.
[0124] (4) After making small holes in the leaves and branches with a syringe needle, press the small holes with a syringe filled with bacterial solution and slowly inject the bacterial solution into them.
[0125] (5) Observe after two days of dark incubation.
[0126] (6) Use ImageJ software to calculate the area of lesions.
[0127] Test results are shown Figure 1 The images show the phenotypic diagrams and lesion area statistics of leaves from GL3 tissue culture seedlings susceptible to MdRNS3a transient silencing expression mediated by Agrobacterium-mediated transformation, 12 days after inoculation with ALT1, 48 hours later. WT represents GL3 tissue culture seedlings without transient infection; EV represents GL3 tissue culture seedlings with transient infection using an empty vector; TRV-RNS3a represents GL3 tissue culture seedlings with transient expression of the silenced TRV2 vector. Figure 2 Phenotypic images and lesion area statistics of GL3 branches of susceptible cultivar D and E (Gastrobacterium-mediated transient silencing of MdRNS3a expression, 10 days after inoculation with ALT1, 8 days later. WT represents GL3 branches without transient infection; EV represents GL3 branches with transient infection using an empty vector; TRV-RNS3a represents GL3 branches with transient expression of the silenced TRV2 vector).
[0128] from Figure 1 D, E and Figure 2 As shown in Figures D and E, the percentage of lesion area in the TRV-RNS3a silencing group was significantly reduced to approximately 10%. Combined with the upregulation of MdTIR expression and the decrease in tsRNA expression in the TRV-RNS3a silencing group, this indicates that MdRNS3a indirectly inhibits the transcriptional activity of the MdTIR gene by positively regulating tsRNA expression; and that silencing MdRNS3a can relieve the inhibitory effect of tsRNA on MdTIR, thereby activating the plant's disease resistance pathway and significantly improving resistance to pathogens.
[0129] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
[0130] The contents not described in detail in this specification are existing technologies known to those skilled in the art.
Claims
1. A ribonuclease gene MdRNS3a Its application in treating fungal infections is characterized by, The application silences the ribonuclease gene in apple plants. MdRNS3a Improve the antifungal properties of apples; The ribonuclease gene MdRNS3a The nucleotide sequence is shown in SEQ ID NO.1; The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
2. Used for detecting ribonuclease genes MdRNS3a The primer for expression is characterized by, The sequences of the primers are shown in SEQ ID NO.2-3.
3. A target gene, characterized in that, The nucleotide sequence of the target gene is shown in SEQ ID NO.
4.
4. Primers for detecting the expression of the target gene as described in claim 3, characterized in that, The sequences of the primers are shown in SEQ ID NO. 5-6.
5. A recombinant TRV viral vector, characterized in that, The viral vector contains the target gene as described in claim 3, and its nucleotide sequence is shown in SEQ ID NO.
7.
6. The application of the recombinant TRV viral vector as described in claim 5, characterized in that, The recombinant TRV virus vector is used to improve the resistance of apple plants to fungal infection. The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
7. A method for improving the resistance of apple plants to fungal infections, characterized in that, Includes the following steps: Step 1: Incorporate the apple ribonuclease gene MdRNS3a The XbaI and KpnI restriction enzyme sites were inserted into the TRV2 vector, and the vector was transformed into E. coli DH5α to obtain silence. MdRNS3a Gene vector; Step 2: Silence obtained in Step 1 MdRNS3a Gene vector plasmid extraction; Step 3: Transfer the plasmid obtained in Step 2 into Agrobacterium to prepare a transgenic Agrobacterium bacterial culture; Step 4: Transfer the transgenic Agrobacterium tumefaciens bacterial solution obtained in Step 3 into apple leaves and branches; The ribonuclease gene MdRNS3a The nucleotide sequence is shown in SEQ ID NO.1; The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
Citation Information
Patent Citations
Introducing silencing activity to dysfunctional RNA molecules and modifying their specificity against gene of interest
CN113906138A
Apple alternaria leaf spot effector gene and application thereof
CN118027163A