A biosensor for detecting GREM1 mRNA based on DNA nanoflower nucleic acid and its application

Abstract

The application discloses a biosensor for detecting GREM1 mRNA based on DNA nanoflower nucleic acid and application thereof, and belongs to the field of sensors.The biosensor comprises DNA nanoflower nucleic acid and F chains combined with the DNA nanoflower nucleic acid; wherein the DNA nanoflower nucleic acid is formed by RCA reaction amplification of a circular template formed by phosphorylation padlock probes and connection probes.The biosensor designed in the application realizes efficient detection of low-abundance target GREM1 mRNA, the detection method provided has good analysis performance, and has the advantages of simple operation, low detection limit, high specificity and the like, can make up for the defects and deficiencies of existing detection methods of GREM1 mRNA, and provides a new way for detection of GREM1 mRNA and diagnosis and prognosis of related diseases.

Description

Technical Field

[0001] This invention relates to the field of sensors, and in particular to a biosensor for detecting GREM1 mRNA based on DNA nanoflower nucleic acid and its applications. Background Technology

[0002] DNA molecules and their self-assembly capabilities can be used to prepare three-dimensional structures, forming DNA nanoflowers (DNFs) through rolling circle amplification (RCA) reactions. The simplicity of DNF structures, ease of assembly, strong nuclease stability, and readily absorbed by cells make them highly promising carriers for biotechnological applications. Compared to other types of DNA nanostructures, DNFs overcome many of the challenges faced by linear oligonucleotides as biosensing reagents, making them promising for a wide range of applications in biotechnology, biosensing, and targeted delivery.

[0003] The GREM1 gene, also known as the Drm gene, was first screened from differentially expressed genes in rat fibroblasts. As a member of the BMP antagonist family, it is a secreted protein primarily found in stromal cells. Similar to other BMP antagonists, GREM1 has a cysteine ​​residue. BMP family members such as BMP-2, BMP-4, and BMP-7 can bind to the secreted glycosylated protein encoded by GREM1, thereby exerting an antagonistic effect. Numerous studies have confirmed that GREM1 is widely expressed in various cancer stromal cells, leading to increased stemness in tumor cells and enhancing their invasiveness. However, current methods for detecting GREM1 in cancer are relatively limited. Accurate detection of GREM1 expression levels is urgent and necessary for disease prevention and prognosis.

[0004] Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is currently a widely used standard method for mRNA detection. While it mitigates some of the disadvantages of Western blotting, such as its time-consuming and low-sensitivity nature, its sample processing is cumbersome, its instrument requirements are high, and the presence of non-specific amplification can affect the accuracy of the results. These disadvantages significantly limit its practical application. Therefore, developing a sensitive strategy for detecting GREM1 mRNA would be highly beneficial for drug screening, treatment, and patient prognosis assessment. Summary of the Invention

[0005] The purpose of this invention is to provide a biosensor for detecting GREM1 mRNA based on DNA nanoflower nucleic acid and its application, in order to solve the problems existing in the prior art. By using the combination of DNF and hairpin F strand nucleic acid to construct a biosensor, it is possible to achieve efficient detection of low-abundance target GREM1 mRNA. The detection method provided has the advantages of good analytical performance, simple operation, low detection limit and high specificity, providing a new approach for the detection of GREM1 mRNA and the diagnosis and prognosis of related diseases.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a biosensor for detecting GREM1 mRNA based on DNA nanoflower nucleic acid, the biosensor comprising DNA nanoflower nucleic acid and the F strand bound thereto;

[0008] The DNA nanoflower nucleic acid is amplified by an RCA reaction from a circular template formed by a phosphorylated padlock probe and a linker probe. The nucleotide sequence of the linker probe is shown in SEQ ID NO.1, the nucleotide sequence of the phosphorylated padlock probe is shown in SEQ ID NO.2, and the nucleotide sequence of the F chain is shown in SEQ ID NO.3.

[0009] Preferably, the 28th position of the 5' end of the F chain is modified with a quenching group, and the 3' end is modified with a fluorescent group.

[0010] The present invention also provides a method for constructing the aforementioned biosensor, comprising the following steps:

[0011] DNA nanoflower nucleic acid was obtained by amplifying a circular template formed by a phosphorylated padlock probe and a connecting probe via an RCA reaction.

[0012] The biosensor was prepared by incubating the DNA nanoflower nucleic acid with the F chain for self-assembly.

[0013] Preferably, the molar ratio of phosphorylated padlock probe to ligation probe in the RCA reaction amplification system is 1:1, and the reaction conditions are incubation at 16°C in a metal bath for more than 8 hours.

[0014] Preferably, the molar ratio of the DNA nanoflower nucleic acid to the F chain is 1:2, and the incubation conditions for self-assembly are 35-38℃ for 1.5-2.5h.

[0015] The present invention also provides a kit for detecting GREM1 mRNA based on DNA nanoflower nucleic acid, including the aforementioned biosensor.

[0016] The present invention also provides a method for in vitro detection of GREM1 mRNA for non-diagnostic purposes, comprising the following steps:

[0017] The biosensor, the test solution, and the Mg-containing... 2+ After mixing with buffer and incubation, the fluorescence intensity was detected, and the content of GREM1 mRNA in the test solution was calculated according to the standard curve.

[0018] Preferably, the concentration of the biosensor is 0.5 nM-1 nM; the Mg 2+ The concentration is 1-6 mM, more preferably Mg 2+ The concentration was 5 nM.

[0019] Preferably, the incubation temperature is 35-38°C and the incubation time is 1.5-2.5 hours; more preferably, the incubation temperature is 37°C and the incubation time is 2 hours.

[0020] The present invention also provides the application of the biosensor in the preparation of a kit for detecting GREM1 mRNA.

[0021] The present invention discloses the following technical effects:

[0022] The biosensor disclosed in this invention can be prepared simply by binding the isothermal amplification product (DNF) of a circular template to the hairpin F strand, making the preparation process straightforward. This biosensor enables highly efficient detection of the low-abundance target GREM1 mRNA, with a detection limit of 0.92 fM. The detection method of this invention exhibits excellent analytical performance and boasts advantages such as simple operation, low detection limit, and high specificity. It can overcome the deficiencies and limitations of existing GREM1 mRNA detection methods, providing a new approach for the detection of GREM1 mRNA and the diagnosis and prognosis of related diseases. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a schematic diagram illustrating the construction process and detection principle of the biosensor of the present invention;

[0025] Figure 2 This illustrates the effect of GREM1 mRNA concentration on the analytical performance of the biosensor in Example 2.

[0026] Figure 3 This is a linear relationship between the logarithm of GREM1 mRNA concentration and fluorescence intensity in Example 2;

[0027] Figure 4 Mg in Example 3 2+ The effect of concentration on the analytical performance of biosensors;

[0028] Figure 5 This illustrates the effect of reaction time on the analytical performance of the biosensor in Example 4.

[0029] Figure 6 The results are the specific detection results of the biosensor in Example 5;

[0030] Figure 7 The fluorescence intensity detection results for different GREM1 mRNA concentrations in Example 6;

[0031] Figure 8 This is the standard curve for the biosensor in Example 6. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] The construction process and detection principle of the biosensor of this invention are as follows: Figure 1 As shown, the sequence of components involved is as follows:

[0038] Primer chain (5'-3'):

[0039] CCTCCTCCTCCCCCCTCCTC, SEQ ID NO.1;

[0040] Template chain (5'-3'):

[0041] P-AGGAGGAGGAGGA GGGGGGGGGAGGAGGAGGAGGAGGA GGAGGAGGGGGGG, SEQ ID NO.2;

[0042] F chain (5'-3'):

[0043] TCCTCCTCCTCCCCCCCCCCAAAAAAAA(BHQ1)AAACGGAGCGCTCAGGTATTTGC GCTCCGTTT(FAM), SEQ ID NO. 3.

[0044] In this reaction, the same bolded portions of the Primer and Template chains are complementary, resulting in a cyclic template. The underlined portion of the Template chain is complementary to the underlined portion of the F chain. The 'P' at the 5' of the Template chain represents a phosphate group modification. The 3' of the F chain is modified with a FAM green fluorescent group, and a BHQ1 quencher group is inserted at the center position.

[0045] The reaction process during biosensor detection is as follows:

[0046] In the absence of a target, the F chain in DNF is in a stable structure, and the fluorescence is in a quenched state. When the target GREM1 mRNA is present, the GREM1 mRNA chain binds to the 5' end (bases 38-57) of the F chain in DNF. The conformation of the F chain changes from a hairpin structure to a single-stranded structure. The fluorophore separates from the quenching group, and the GREM1 mRNA is completely bound to the 5' end (bases 38-57) of the F chain. The fluorophore is exposed, thereby emitting a fluorescent signal.

[0047] The sequence (5'-3') of the above GREM1 mRNA target is as follows:

[0048] CGGAGCGCAAATACCTGAAG (SEQ ID NO. 4).

[0049] The GREM2 mRNA sequence (5'-3') used in the following embodiments of the present invention is as follows:

[0050] ATCCCCTCGCCTTACAAGGA (SEQ ID NO. 5).

[0051] Example 1: Construction of Biosensors

[0052] Preparation of S1.Circle template

[0053] The nucleotide sequences shown in SEQ ID NO. 1-2 were synthesized. A 60 μL reaction system was prepared by adding 6 μL of a 100 μM phosphorylated padlock probe (template chain), 6 μL of a 100 μM ligation probe (primer chain), and 6 μL of 10×T4 DNA ligase reaction buffer to 42 μL of ultrapure water. The system was then incubated at 95°C for 5 min and allowed to cool naturally to room temperature. Next, 3 μL of 400 U / μL T4 DNA ligase was added, and the mixture was incubated overnight (at least 8 h) at 16°C in a metal bath to catalyze the ligation reaction. After the reaction, the reaction product was treated at 65°C for 10 min to inactivate the T4 DNA ligase. After cooling to room temperature, 2 μL of Exo I and Exo III were added at 37°C and the mixture was incubated for 8 h to digest any remaining single-stranded ligation probes and phosphorylated padlock probes. After inactivation at 85℃ for 10 min, the sample was cooled to room temperature to obtain a circle template, which was then stored in a refrigerator at 4℃ for later use.

[0054] S2. Construction of Biosensor DNF

[0055] The F chain shown in SEQ ID NO.3 was synthesized, and a quenching group BHQ1 was modified at position 28 of its 5' end, and a fluorescent group FAM was modified at its 3' end. In a 30 μL reaction system containing 1.5 μL of 10 μM cyclic template, 1.5 μL of 10×Phi29 polymerase reaction buffer, 1.5 μL of 10 U / μL 10×Phi29 polymerase, 1.5 μL of 10 mM dNTP, and 1 μL of 30 mM F chain were added, respectively. The mixture was incubated at 37 °C for 2 h, and the polymerization reaction was stopped by standing at 65 °C for 10 min to obtain DNF. Finally, the prepared DNF structure was washed three times in ultrapure water, centrifuged at 10000 rpm for 5 min, resuspended, and stored at 4 °C for later use.

[0056] Example 2: Effect of GREM1 mRNA concentration on the analytical performance of biosensors

[0057] Take the DNF prepared in Example 1 and determine the concentrations of GREM1 mRNA at different concentrations according to the following steps:

[0058] Take 6 EP tubes and add 30 μL of the detection system to each: DNF (3 μL, initial concentration 10 nM), 10×NEBuffer buffer (3 μL), and GREM1 mRNA (3 μL, final concentrations of 0 nM, 100 fM, 1 pM, 10 pM, 100 pM, and 1 nM, respectively). Make up the volume to 30 μL with ddH2O. Incubate the detection system at 37°C for 1 h. Record the fluorescence intensity at 520 nm using a 488 nm excitation wavelength.

[0059] The results are as follows Figure 2 As shown in the figure, the fluorescence intensity increases significantly with increasing GREM1 mRNA concentration. This indicates that the prepared biosensor DNF is sensitive to changes in GREM1 mRNA concentration and can be used for quantitative detection of GREM1 mRNA concentration. Within the concentration range of 100 fM to 1 nM, the logarithm of GREM1 mRNA concentration shows a good linear relationship with fluorescence intensity (see figure). Figure 3 The logarithm of its concentration has a good linear relationship with the fluorescence intensity.

[0060] Example 3: Mg 2+ Impact on the analytical performance of biosensors

[0061] Take the DNF prepared in Example 1 and determine the Mg content according to the following steps. 2+ Optimal concentration:

[0062] Take six EP tubes and add 30 μL of the detection system to each tube: DNF (3 μL, initial concentration 10 nM), 10×NEBuffer 2 buffer (3 μL), GREM1 mRNA (3 μL, initial concentration 2 nM), and 3 μL of MgCl2 at different concentrations (final concentrations of 0 mM, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 10 mM, and 15 mM, respectively). Make up the volume to 30 μL with ddH2O water. Incubate at 37℃ for 90 min. Record the fluorescence intensity at 520 nm using a 488 nm excitation wavelength.

[0063] The results are as follows Figure 4 As shown in the figure, it can be seen that with the increase of Mg in the detection system... 2+ As the concentration of Mg increases, the fluorescence intensity gradually increases, but the increase in absorbance becomes less significant after the concentration reaches 5 mM. Therefore, 5 mM Mg was selected. 2+ The concentration is the optimal concentration.

[0064] Example 4: The effect of reaction time on the analytical performance of biosensors

[0065] Take the DNF prepared in Example 1 and determine the optimal reaction time according to the following steps:

[0066] Take 6 EP tubes and add 30 μL of the detection system to each tube: DNF (3 μL, original concentration 10 nM), 10×NEBuffer 2 buffer (3 μL), GREM1 mRNA (3 μL, original concentration 2 nM) and MgCl2 (3 μL, original concentration 50 mM). Add ddH2O water to each tube to make up to 30 μL. Incubate at 37℃ for 30 min, 60 min, 90 min, 120 min, 150 min and 180 min respectively, and record the fluorescence intensity at 520 nm using a 488 nm excitation wavelength.

[0067] The results are as follows Figure 5 As shown in the figure, the fluorescence intensity gradually increases with time, and reaches an equilibrium state at 120 min, where it no longer changes. Therefore, 120 min is selected as the optimal reaction time for the system.

[0068] Example 5: Detection specific to biosensors

[0069] The DNF prepared in Example 1 was used to determine its detection specificity according to the following steps:

[0070] Take three EP tubes and use them to detect GREM1 mRNA, GREM2 mRNA (a homolog of GREM1), and a mixed solution of GREM1 mRNA and GREM2 mRNA, respectively.

[0071] The detection system consisted of: DNF (3 μL, 10 nM), 10×NE Buffer 2 (3 μL), MgCl2 (3 μL, initial concentration 50 mM), GREM1 mRNA (3 μL, initial concentration 2 nM), or GREM2 mRNA (3 μL, initial concentration 2 nM), or a mixture of GREM1 mRNA and GREM2 mRNA (3 μL, molar ratio 1:1, initial concentration 2 nM), with the final volume brought to 30 μL using ddH2O. The system was incubated at 37 °C for 120 min. Fluorescence intensity at 520 nm was recorded using a 488 nm excitation wavelength.

[0072] The results are as follows Figure 6 As shown in the figure, the fluorescence intensity of the GREM1 mRNA group and the Mixed group increased significantly, while the GREM2 mRNA group, which is homologous to GREM1, did not show significant changes. Therefore, the DNF prepared in Example 1 has good specificity.

[0073] Example 6: Detection of the detection limit of a biosensor

[0074] Take the DNF prepared in Example 1 and detect GREM1 mRNA according to the following steps:

[0075] Six EP tubes were used, and 30 μL of the following detection system was added to each tube: DNF (3 μL, initial concentration 10 nM), 10×NEBuffer 2 buffer (3 μL), GREM1 mRNA (3 μL, final concentrations of 0 nM, 100 fM, 1 pM, 10 pM, 100 pM, and 1 nM, respectively), and MgCl2 (3 μL, initial concentration 50 mM). The tubes were incubated at 37 °C for 120 min. The fluorescence intensity at 520 nm was recorded using a 488 nm excitation wavelength. The results are shown below. Figure 7 As shown, fluorescence intensity increases with increasing concentration. A standard curve was constructed based on GREM1 mRNA concentration and fluorescence intensity, and the results are as follows. Figure 8 As shown, the limit of detection (LOD) is 0.92 fM.

[0076] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a biosensor in the preparation of a kit for detecting GREM1 mRNA, characterized in that, The biosensor includes DNA nanoflower nucleic acid and the F chain bound thereto; The DNA nanoflower nucleic acid is amplified by an RCA reaction from a circular template formed by a phosphorylated padlock probe and a linker probe. The nucleotide sequence of the linker probe is shown in SEQ ID NO.1, the nucleotide sequence of the phosphorylated padlock probe is shown in SEQ ID NO.2, and the nucleotide sequence of the F chain is shown in SEQ ID NO.

3. The 28th position of the 5' end of the F chain is modified with a quenching group, and the 3' end is modified with a fluorescent group.

2. A method for constructing a biosensor, characterized in that, Includes the following steps: DNA nanoflower nucleic acid was obtained by amplifying a circular template formed by a phosphorylated padlock probe and a connecting probe via an RCA reaction. The biosensor was prepared by incubating the DNA nanoflower nucleic acid with the F chain for self-assembly. The nucleotide sequence of the ligation probe is shown in SEQ ID NO.1, the nucleotide sequence of the phosphorylated padlock probe is shown in SEQ ID NO.2, and the nucleotide sequence of the F chain is shown in SEQ ID NO.

3. The 28th position of the 5' end of the F chain is modified with a quenching group, and the 3' end is modified with a fluorescent group.

3. The construction method as described in claim 2, characterized in that, In the RCA reaction amplification system, the molar ratio of phosphorylated padlock probe to ligation probe is 1:1, and the reaction conditions are incubation at 16℃ in a metal bath for more than 8 hours.

4. The construction method as described in claim 2, characterized in that, The molar ratio of the DNA nanoflower nucleic acid to the F chain is 1:2, and the incubation conditions for self-assembly are 35-38℃ for 1.5-2.5 h.

5. A kit for detecting GREM1 mRNA based on DNA nanoflower nucleic acid, characterized in that, Includes a biosensor; the biosensor includes DNA nanoflower nucleic acid and the F chain bound thereto; The DNA nanoflower nucleic acid is amplified by an RCA reaction from a circular template formed by a phosphorylated padlock probe and a linker probe. The nucleotide sequence of the linker probe is shown in SEQ ID NO.1, the nucleotide sequence of the phosphorylated padlock probe is shown in SEQ ID NO.2, and the nucleotide sequence of the F chain is shown in SEQ ID NO.

3. The 28th position of the 5' end of the F chain is modified with a quenching group, and the 3' end is modified with a fluorescent group.

6. A method for in vitro detection of GREM1 mRNA for non-diagnostic purposes, characterized in that, Includes the following steps: Biosensor, test solution and Mg-containing 2+ After mixing with buffer and incubation, the fluorescence intensity was detected, and the content of GREM1 mRNA in the test solution was calculated according to the standard curve. The biosensor includes DNA nanoflower nucleic acid and the F chain bound thereto; The DNA nanoflower nucleic acid is amplified by an RCA reaction from a circular template formed by a phosphorylated padlock probe and a linker probe. The nucleotide sequence of the linker probe is shown in SEQ ID NO.1, the nucleotide sequence of the phosphorylated padlock probe is shown in SEQ ID NO.2, and the nucleotide sequence of the F chain is shown in SEQ ID NO.

3. The 28th position of the 5' end of the F chain is modified with a quenching group, and the 3' end is modified with a fluorescent group.

7. The method as described in claim 6, characterized in that, The concentration of the biosensor is 100 fM-1 nM, and the Mg... 2+ The concentration is 1-6 mM.

8. The method as described in claim 6, characterized in that, The incubation temperature is 35-38℃, and the time is 1.5-2.5h.

Images