Application of ibwrky26 protein and its coding gene in regulating resistance to soft rot of ipomoea batatas

Abstract

This invention discloses the application of the IbWRKY26 protein and its encoding gene in regulating sweet potato soft rot resistance, belonging to the field of plant genetic engineering technology. This invention provides the application of the IbWRKY26 protein in any of the following: (1) its application in regulating sweet potato soft rot; (2) its application in preparing products that regulate sweet potato soft rot; (3) its application in breeding soft rot-resistant sweet potatoes; (4) its application in cultivating soft rot-resistant sweet potatoes; the amino acid sequence of the IbWRKY26 protein is shown in SEQ ID NO.2. Experimental verification of this invention shows that, compared to the wild type, sweet potatoes overexpressing the IbWRKY26 gene exhibit significantly improved soft rot resistance. The IbWRKY26 protein and its encoding gene provided by this invention have significant theoretical and practical value in the study of sweet potato soft rot resistance.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the IbWRKY26 protein and its encoding gene in regulating resistance to sweet potato soft rot. Background Technology

[0002] Sweet potatoes are high-yielding, highly adaptable to different environments, and contain a large amount of starch. They can be used not only as an important food source but also as animal feed, industrial raw material, and a new energy source. Sweet potatoes are an excellent source of nutrients, including vitamins, potassium, iron, calcium, and minerals. They also have medicinal value due to their anti-cancer, anti-diabetic, and anti-inflammatory activities, making them very popular.

[0003] Soft rot is a common disease of sweet potatoes during storage, mainly caused by Rhizopus stolonifer. This fungus invades the plant through wounds on the tubers and root pores, secreting various decomposing enzymes into the plant tissue. These enzymes rapidly break down the mucilage and other components in the tuber cells, leading to tissue collapse and rotting. The disease spreads quickly, often causing the entire sweet potato cellar to rot, resulting in severe economic losses. Therefore, breeding disease-resistant sweet potato varieties is one of the important measures to solve this problem.

[0004] WRKY transcription factors are one of the largest transcription factor families in higher plants. Family members share similar structural features and contain at least one highly conserved DNA-binding region. The N-terminus of this region is typically a WRKY domain composed of the WRKYGQK (SEQ ID NO. 7) heptapeptide sequence, while the C-terminus is a zinc finger structure composed of C2H2 or C2HC. The regulatory role of WRKY transcription factors in plant defense responses is complex. They typically exert their resistance function by directly transcribing and regulating downstream resistance genes, such as defense enzymes, secondary metabolites, and resistance genes. They exhibit both positive and negative regulatory effects in resistance responses against different pathogens. However, the role of WRKY transcription factors in sweet potato soft rot resistance has not yet been reported. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the IbWRKY26 protein and its encoding gene in regulating sweet potato soft rot resistance, thereby addressing the problems existing in the prior art. Increasing the activity of the IbWRKY26 protein or increasing the expression level of its encoding gene can improve sweet potato resistance to soft rot.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the use of the IbWRKY26 protein in any of the following:

[0008] (1) Application in controlling sweet potato soft rot;

[0009] (2) Application in the preparation of products that regulate sweet potato soft rot;

[0010] (3) Application in breeding sweet potatoes resistant to soft rot;

[0011] (4) Application in the cultivation of sweet potatoes resistant to soft rot;

[0012] The amino acid sequence of the IbWRKY26 protein is shown in SEQ ID NO.2. SEQ ID NO.2 of this invention consists of 549 amino acid residues.

[0013] Preferably, increasing the expression level of IbWRKY26 protein in sweet potatoes can enhance the resistance of sweet potatoes to soft rot.

[0014] As an additional option, the amino acid sequence of the IbWRKY26 protein of the present invention can be a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.2; it can also be a protein derived from SEQ ID NO.2 that is associated with plant soft rot and has undergone substitution and / or deletion and / or addition of one or more amino acid residues.

[0015] This invention provides the application of the gene encoding the bWRKY26 protein, IbWRKY26, in any of the following:

[0016] (1) Application in controlling sweet potato soft rot;

[0017] (2) Application in the preparation of products that regulate sweet potato soft rot;

[0018] (3) Application in breeding sweet potatoes resistant to soft rot;

[0019] (4) Application in the cultivation of sweet potatoes resistant to soft rot;

[0020] The nucleotide sequence encoding the gene IbWRKY26 is shown in SEQ ID NO.1. SEQ ID NO.1 of this invention consists of 1650 nucleotides.

[0021] Preferably, overexpression of the gene encoding IbWRKY26 in sweet potato can improve the resistance of sweet potato to soft rot.

[0022] As an additional embodiment, the nucleotide sequence encoding the gene IbWRKY26 described in this invention can be a nucleic acid molecule whose coding region is SEQ ID NO.1; it can be a DNA molecule that hybridizes under stringent conditions with a nucleic acid molecule identical to SEQ ID NO.1 or whose coding region is SEQ ID NO.1 and encodes the IbWRKY26 protein; or it can be a DNA molecule that has 75% or more homology with a nucleic acid molecule identical to SEQ ID NO.1 or whose coding region is SEQ ID NO.1 and encodes the IbWRKY26 protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; or it can be RNA, such as mRNA or hnRNA, etc.

[0023] In this invention, those skilled in the art can readily employ known methods, such as directed evolution and point mutation, to mutate the nucleotide sequence of the gene encoding IbWRKY26. Artificially modified nucleotides having 75% or higher homology to the nucleotide sequence of the protein IbWRKY26 isolated in this invention, as long as they encode the IbWRKY26 protein and are associated with plant soft rot, are all nucleotide sequences derived from and equivalent to those of this invention.

[0024] As used herein, the term "homology" refers to sequence similarity to a native nucleic acid sequence. "Homology" includes nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher homology to the nucleotide sequence shown in SEQ ID NO. 1 of this invention. Homology can be evaluated visually or using computer software. Using computer software, homology between two or more sequences can be expressed as a percentage (%), which can be used to evaluate homology between related sequences.

[0025] This invention provides the use of biological materials containing the encoding gene IbWRKY26 in any of the following:

[0026] (1) Application in controlling sweet potato soft rot;

[0027] (2) Application in the preparation of products that regulate sweet potato soft rot;

[0028] (3) Application in breeding sweet potatoes resistant to soft rot;

[0029] (4) Application in the cultivation of sweet potatoes resistant to soft rot;

[0030] The nucleotide sequence of the encoding gene IbWRKY26 is shown in SEQ ID NO.1.

[0031] Preferably, the biomaterial includes a recombinant vector or recombinant bacteria.

[0032] As an optional addition, the biomaterials of this invention also include expression cassettes and transgenic plant cell lines.

[0033] More preferably, the expression cassette includes a promoter, a gene encoding IbWRKY26, and a terminator; the promoter may be a CaMV35S promoter, a NOS promoter, or an OCS promoter; the terminator may be a NOS terminator or an OCS polyA terminator.

[0034] More preferably, the recombinant expression vector may be the recombinant expression vector pCAMBIA1300-IbWRKY26-GFP or the recombinant expression vector pCAMBIA1300-IbWRKY26;

[0035] More preferably, the recombinant expression vector pCAMBIA1300-IbWRKY26-GFP is obtained through the following steps:

[0036] The recombinant expression vector pCAMBIA1300-IbWRKY26-GFP was obtained by inserting the encoding gene IbWRKY26 between the multiple cloning sites of the vector pCAMBIA1300-GFP.

[0037] Further preferred, the pCAMBIA1300-GFP vector was digested with Kpn I and Sal I enzymes, the large fragment of the vector was recovered, the target gene sequence was amplified using forward and reverse primers for the coding gene IbWRKY26 with relevant homologous arms, and the recovered large fragment of the vector was ligated with the fragment containing the coding gene IbWRKY26 to obtain the recombinant expression vector pCAMBIA1300-IbWRKY26-GFP;

[0038] More preferably, the recombinant vector is a vector that integrates the gene encoding IbWRKY26 into the genome.

[0039] In this invention, the recombinant bacteria can be obtained by introducing the recombinant expression vector into the starting microorganism; specifically, the recombinant bacteria can be K599 / pCAMBIA1300-IbWRKY26-GFP; K599 / pCAMBIA1300-IbWRKY26-GFP is a recombinant Agrobacterium rhizogenes obtained by transforming the recombinant plasmid pCAMBIA1300-IbWRKY26-GFP into Agrobacterium rhizogenes K599.

[0040] In this invention, the transgenic plant cell lines do not include propagation material; the transgenic plant is understood to include not only the first-generation transgenic plant obtained by transforming the recipient plant with the IbWRKY26 gene (i.e., the gene encoding the IbWRKY26 protein), but also its progeny; for transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly including commercial varieties. The transgenic plant includes seeds, callus tissue, intact plants, and cells.

[0041] This invention provides a method for controlling sweet potato soft rot, comprising any one of the following methods:

[0042] (1) The resistance of sweet potato to soft rot was improved by overexpressing the gene IbWRKY26 in sweet potato;

[0043] (2) Reduce the resistance of sweet potato to soft rot by interfering with the encoding gene IbWRKY26 in sweet potato;

[0044] The nucleotide sequence of the encoding gene IbWRKY26 is shown in SEQ ID NO.1.

[0045] This invention provides a method for breeding sweet potatoes resistant to soft rot, comprising the steps of overexpressing the encoding gene IbWRKY26 in sweet potatoes, increasing the expression level of the encoding gene IbWRKY26, and obtaining sweet potatoes resistant to soft rot.

[0046] The nucleotide sequence of the encoding gene IbWRKY26 is shown in SEQ ID NO.1.

[0047] This invention provides a product for regulating sweet potato soft rot, the product comprising an IbWRKY26 protein agonist, an IbWRKY26 gene agonist, or an IbWRKY26 gene interference agent;

[0048] The amino acid sequence of the IbWRKY26 protein is shown in SEQ ID NO.2; the nucleotide sequence of the encoding gene IbWRKY26 is shown in SEQ ID NO.1.

[0049] This invention provides the application of the above-mentioned product in controlling sweet potato soft rot.

[0050] The present invention discloses the following technical effects:

[0051] This invention is the first to discover that overexpression of the gene encoding IbWRKY26 (IbWRKY26 gene) in plants can significantly enhance resistance to sweet potato soft rot. Specifically, this invention provides a WRKY transcription factor (IbWRKY26 protein) and the IbWRKY26 gene encoding the IbWRKY26 protein. This gene was introduced into sweet potato to obtain transgenic sweet potato plants overexpressing the IbWRKY26 gene. Soft rot resistance was assessed in transgenic tubers, and it was found that compared to wild-type, the transgenic tubers showed significantly enhanced resistance to soft rot. Therefore, the IbWRKY26 protein and its encoding gene described in this invention can regulate plant resistance to soft rot and can be used to cultivate highly resistant transgenic plants. In conclusion, the IbWRKY26 protein and its encoding gene provided in this invention have significant theoretical and practical value in the research of sweet potato soft rot resistance. Attached Figure Description

[0052] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0053] Figure 1 This section describes the acquisition and detection of transgenic plants. A shows the acquisition of the intended transformation recipient; B shows the removal of lateral branches and internode growth points; C shows the pretreated transformation recipient immersed in transformation solution; D shows the transformation recipient immersed in Agrobacterium transformation solution and planted in the transplanting field; E shows the harvesting of the intended transformation tubers; F shows the germination of positive tubers; G shows the PCR identification of the transgenic lines; lane WT represents the negative control wild-type line, and lane P represents the positive control (recombinant plasmid pCAMBIA1300-IbWRKY26); H shows the qPCR detection results of the transgenic plants; I is a magnified view of D; and J is a magnified view of E.

[0054] Figure 2 To identify the resistance of sweet potato tubers overexpressing the transgenic IbWRKY26 to soft rot; where A is a graph showing the disease incidence after inoculation with soft rot pathogen; and B is a statistical graph showing the diseased area. Detailed Implementation

[0055] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0056] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0057] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0058] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0059] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0060] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0061] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0062] Example 1: Acquisition and functional verification of proteins and their encoding genes associated with sweet potato soft rot.

[0063] I. Identification of proteins associated with sweet potato soft rot and their encoding genes

[0064] 1. Extraction of total RNA from sweet potato: Take 1g of tender leaves of sweet potato variety Nongdabai (NDB), grind them into powder in liquid nitrogen, add them to a 2mL centrifuge tube, extract total RNA from sweet potato using the Trizon method, and reverse transcribe the first strand cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser kit.

[0065] 2. Based on comparative transcriptome analysis of sweet potato varieties resistant to soft rot, which has been studied in the laboratory, the differentially expressed gene IbWRKY26 was screened and compared with the Sweetpotato Garden library. Primers IbWRKY26-F1 and IbWRKY26-R1 were designed and synthesized, with the following sequences:

[0066] IbWRKY26-F1: 5'-ATGAGTTCTTCAGGTGGAAG-3', SEQ ID NO.3;

[0067] IbWRKY26-R1: 5'-TCAGTTTAGGAAAGTGCTGAA-3', SEQ ID NO.4;

[0068] 3. Using the cDNA obtained in step 1 as a template, and the IbWRKY26-F1 and IbWRKY26-R1 synthesized in step 2 as primers, PCR amplification was performed to obtain a PCR amplification fragment product of approximately 1650 bp, which was then sequenced.

[0069] The results showed that the nucleotide sequence of the PCR amplification product obtained in step 3 was as shown in SEQ ID NO.1, specifically: ATG TGA The gene shown in this sequence is named the IbWRKY26 gene, and the protein it encodes is named the IbWRKY26 protein or protein IbWRKY26. The amino acid sequence is shown in SEQ ID NO.2, specifically:

[0070] II. Application of IbWRKY26 protein in regulating resistance to sweet potato soft rot

[0071] 1. Construction of plant expression vectors

[0072] Based on the nucleotide sequence of the sweet potato IbWRKY26 gene (SEQ ID NO.1), primer sequences were designed to amplify the complete coding sequence. Kpn I and Sal I restriction sites were introduced into the forward and reverse primers, respectively. The primer sequences are as follows:

[0073] IbWRKY26-F-Kpn I:

[0074] 5'-ACGGGGGACGAGCTC GGTACC ATGAGTTCTTCAGGTGGAAG-3' (underlined part is Kpn I restriction site), SEQ ID NO.5;

[0075] IbWRKY26-R-Sal I:

[0076] 5'-GCCCTTGCTCACCAT GTCGAC TCAGTTTAGGAAAGTGCTGAA-3' (underlined part is Sal I restriction site), SEQ ID NO.6;

[0077] Using the artificially synthesized SEQ ID NO.1 as a template, after PCR amplification, the product was ligated into the pMD19-T vector, named the pMD-IbWRKY26 vector, and sequenced using M13-F / R (M13-F: GTAAAACGACGGCCAGT, SEQ ID NO.7; M13-R: CAGGAAACAGCTATGAC, SEQ ID NO.8) to ensure the correct nucleotide reading frame and restriction enzyme sites of the sweet potato IbWRKY26 gene.

[0078] The pCAMBIA1300-GFP vector was digested with Kpn I and Sal I, and the large fragment was recovered. Simultaneously, a fragment was amplified from the pMD-IbWRKY26 vector using IbWRKY26-F-Kpn I and IbWRKY26-R-Sal I primers, and a fragment of approximately 1650 bp was recovered. The recovered large fragment was ligated to the approximately 1650 bp fragment to obtain the target plasmid. The target plasmid was transformed into *E. coli* DH5α, plated, and cultured at 37°C for 16 h. PCR analysis and restriction enzyme digestion identification of the recombinant expression vector were performed, followed by sequencing verification. Sequencing results showed that the sequence shown in SEQ ID NO. 1 was inserted between the Kpn I and Sal I restriction sites of pCAMBIA1300-GFP, indicating that the recombinant expression vector was constructed correctly, and the recombinant plasmid pCAMBIA1300-IbWRKY26-GFP expressed the protein IbWRKY26 shown in SEQ ID NO. 2.

[0079] The recombinant plasmid pCAMBIA1300-IbWRKY26-GFP has an expression cassette containing the CaMV35S promoter, the IbWRKY26 gene, the gene encoding the GFP fusion protein, and the NOS terminator in its nucleotide sequence.

[0080] 2. Transformation of Agrobacterium tumefaciens using plant expression vectors

[0081] The process is as follows Figure 1 As shown in AJ, the details are as follows:

[0082] (1) Thaw Agrobacterium K599 competent cells on ice, add 2 μL of extracted pCAMBIA1300-IbWRKY26 plasmid, gently tap the tube wall to mix, and incubate on ice for 5 min;

[0083] (2) Quick freeze in liquid nitrogen for 5 min, water bath at 37℃ for 5 min, ice bath for 5 min;

[0084] (3) Add 500 μL of liquid LB medium and incubate at 28°C and 200 rpm for 3 h;

[0085] (4) Spread 100 μL of bacterial culture onto LB solid medium containing 100 μg / mL kanamycin and 100 μg / mL rifampin;

[0086] (5) After inverted dark culture at 28℃ for 2 days, single clones were picked and cultured in liquid LB medium containing 100 μg / mL kanamycin and 100 μg / mL rifampin. After molecular detection by PCR, Agrobacterium culture containing pCAMBIA1300-IbWRKY26-GFP vector was obtained. The recombinant Agrobacterium was named K599 / pCAMBIA1300-IbWRKY26-GFP.

[0087] (6) Genetic transformation of sweet potato (in situ transformation)

[0088] The K599 / pCAMBIA1300-IbWRKY26-GFP gene was introduced into the sweet potato variety Longshu 9 using in situ transformation. The specific method is as follows:

[0089] 6.1) Stem segment pretreatment: Select tender stem segments of well-grown Longshu No. 9, remove the petioles of lateral branches, and then use a scalpel to cut off the protruding base of the petiole, ready for use. Figure 1 (A and B in the text).

[0090] 6.2) Bacterial pretreatment: The recombinant Agrobacterium obtained after transformation was named K599 / pCAMBIA1300-IbWRKY26-GFP and activated. 1 mL of bacterial culture was added to 100 mL of LB liquid medium containing 100 μg / mL kanamycin and 100 μg / mL streptomycin, and cultured overnight. The cells were collected by centrifugation and resuspended to OD using transformation resuspension buffer (10 mM MES, 10 mM MgCl2, 200 μM MAS, 0.02% Silwet L-77). 600 =0.8-1.0, converted for later use.

[0091] 6.3) Stem segment infection: Immerse the treated stem segments in the prepared conversion solution, ensuring all wounds on the stem segments are submerged. After 24 hours of incubation in the dark, they are then planted in field soil. Figure 1 (C in the middle).

[0092] 6.4) Transplanting to the field: Infected stem segments are transplanted to isolated fields. After 6-8 weeks of planting, tubers are harvested and subsequently identified. Figure 1 (D and I in the text).

[0093] 6.5) Identification of Transgenic Lines: Harvested sweet potato tubers intended for transgenic propagation were buried in the soil and allowed to sprout. The sprouts emerging from the tubers were identified as transgenic lines. These lines were numbered, and genomic DNA was extracted from leaves using the CTAB method. Using the extracted genomic DNA as a template, water and wild-type plants were used as negative controls, and plasmid pCAMBIA1300-IbWRKY26-GFP as a positive control. PCR amplification was performed using primers JD-F (GATGGAAACATTCTTGGACACA (SEQ ID NO. 9)) and JD-R (AGTTCATCCATGCCATGTGTAA (SEQ ID NO. 10)). A PCR amplification product of approximately 300 bp was obtained. If the PCR amplification product contained a band of approximately 300 bp, the corresponding sweet potato transgenic plant was identified as a positive transgenic sweet potato plant, i.e., a transgenic sweet potato overexpressing the IbWRKY26 gene.

[0094] Electrophoresis detection amplification results as follows Figure 1 As shown in G in the figure, lanes 4-10 and the positive control amplified a target band of approximately 300 bp, indicating that the IbWRKY26 gene has been integrated into the sweet potato genome. This confirms that these regenerated plants are transgenic plants overexpressing the IbWRKY26 gene. Further analysis of the IbWRKY26 gene in these transgenic plants revealed that its expression level was higher than that of wild-type sweet potato. The highest expression levels were observed in transgenic plants numbered OE-W3 and OE-W4. Figure 1 (H in the middle); then, the transgenic sweet potato plants identified as overexpressing the IbWRKY26 gene were propagated and subjected to soft rot resistance identification.

[0095] Meanwhile, images of germinating transgenic strains are shown... Figure 1 As shown in F, the harvested images are as follows: Figure 1 E and J are shown in the figure.

[0096] 3. Identification of soft rot in transgenic plants after inoculation

[0097] (1) Preparation of pathogens: The preserved sweet potato soft rot pathogens were inoculated into PDA solid medium and cultured for 2 days. Then, holes were punched using a 6mm puncher to obtain mycelium cakes with a diameter of 6mm for later use.

[0098] (2) Potato preparation: Clean the genetically modified and wild-type potato tubers, dry them, and cut them into potato slices about 1cm thick. Place them on a 9cm diameter plate, line the plate with two layers of filter paper and spray with sterile water to keep it moist. Place the potato slices on the filter paper.

[0099] (3) Inoculation and identification: Inoculate one mycelium cake in the middle of each potato chip. After inoculation, cover the plate and place it in a constant temperature incubator at 28℃ for 16 hours.

[0100] (4) Disease assessment: Imagej was used to measure the lesion area of ​​the potato chips 16 hours after inoculation. The results are as follows: Figure 2 As shown in the figure. The results show that overexpression of the IbWRKY26 gene in sweet potato enhances its resistance to soft rot.

[0101] In conclusion, the sweet potato soft rot-related protein IbWRKY26 and its encoding gene have important theoretical significance in regulating plant soft rot resistance.

[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of IbWRKY26 protein in any of the following: (1) Application in improving the treatment of sweet potato soft rot; (2) Application in the preparation of products that improve the prevention of soft rot in sweet potatoes; (3) Application in breeding sweet potatoes resistant to soft rot; (4) Application in the cultivation of sweet potatoes resistant to soft rot; The amino acid sequence of the IbWRKY26 protein is shown in SEQ ID NO.2; By increasing the expression level of IbWRKY26 protein in sweet potatoes, the resistance of sweet potatoes to soft rot can be improved.

2. The gene encoding the IbWRKY26 protein IbWRKY26 Application in any of the following: (1) Application in improving the treatment of sweet potato soft rot; (2) Application in the preparation of products that improve the prevention of soft rot in sweet potatoes; (3) Application in breeding sweet potatoes resistant to soft rot; (4) Application in the cultivation of sweet potatoes resistant to soft rot; The encoding gene IbWRKY26 The nucleotide sequence is shown in SEQ ID NO.1; By overexpressing the gene encoded in sweet potato IbWRKY26 This achieves the effect of improving the sweet potato's resistance to soft rot disease.

3. Contains coding genes IbWRKY26 Applications of biomaterials in any of the following: (1) Application in improving the treatment of sweet potato soft rot; (2) Application in the preparation of products that improve the prevention of soft rot in sweet potatoes; (3) Application in breeding sweet potatoes resistant to soft rot; (4) Application in the cultivation of sweet potatoes resistant to soft rot; The encoding gene IbWRKY26 The nucleotide sequence is shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The biomaterials include recombinant vectors or recombinant bacteria.

5. A method for improving the prevention of soft rot in sweet potatoes, characterized in that, Including overexpression of gene encoding in sweet potatoes IbWRKY26 Steps to improve the resistance of the sweet potato to soft rot; The encoding gene IbWRKY26 The nucleotide sequence is shown in SEQ ID NO.

1.

6. A method for cultivating sweet potatoes resistant to soft rot, characterized in that, Including overexpression of gene encoding in sweet potatoes IbWRKY26 To improve the coding gene IbWRKY26 The expression level of the sweet potato was determined, and the steps to obtain the sweet potato resistant to soft rot were analyzed. The encoding gene IbWRKY26 The nucleotide sequence is shown in SEQ ID NO.1.

Images