Carbon dioxide fixation pathways and their use in microorganisms

Abstract

The application discloses a carbon dioxide fixation pathway and application thereof in microorganisms, and belongs to the technical field of synthetic biology. The application designs a new carbon fixation system of the carbon dioxide pathway, which can increase the ability of any microbial cell to utilize carbon dioxide to prepare lactic acid; the carbon fixation system comprises an engineered pathway for fixing carbon dioxide to lactic acid, and comprises recombinant enzymes: formate dehydrogenase, carboxylic acid reductase, glyoxylate linkase, carboxyl cleavage enzyme, serine-pyruvate aminotransferase, serine deaminase, malic enzyme, malonyl CoA synthetase, malonyl CoA lyase, glyoxylate reductase, glycolaldehyde dehydrogenase, pyruvate bifunctional enzyme, lactic acid dehydrogenase, alanine-glyoxylate aminotransferase and threonine aldolase; the path can utilize carbon dioxide, formic acid, formaldehyde and various one-carbon substrates, and has multiple values in substrate utilization.

Description

Technical Field

[0001] This invention relates to carbon dioxide fixation pathways and their applications in microorganisms, belonging to the technical field of synthetic biology. Background Technology

[0002] Carbon dioxide is not only a major greenhouse gas contributing to global warming, but also one of the most abundant and stable carbon compounds on Earth, possessing significant potential as a renewable carbon resource. With the increasing depletion of fossil resources and increasingly stringent carbon emission regulations, developing efficient and sustainable carbon dioxide resource utilization technologies has become a major challenge and research hotspot in the global energy and environment sector. How to transform carbon dioxide from an environmental burden into an industrial raw material, promoting its recycling and value enhancement, has become a key path to achieving green and low-carbon development. Therefore, it is urgent to construct an efficient and green carbon dioxide conversion technology system to transform it into high-value-added products, achieving the dual goals of environmental governance and resource utilization. However, currently, heterotrophic microorganisms such as *Escherichia coli*, *Saccharomyces cerevisiae*, *Kluyveromyces marxianus*, and *Issatchenkia orientalis* generally lack efficient carbon dioxide utilization pathways, posing difficulties for the resource utilization of carbon dioxide. With the increasing demands for environmental protection and sustainable development, research on microbial utilization of carbon dioxide to synthesize chemicals has become a hot topic in the field of bioengineering. This invention proposes a novel pathway for carbon dioxide utilization, enabling the synthesis of lactic acid (a biodegradable plastic monomer) from carbon dioxide through a series of biocatalytic reactions. Furthermore, this pathway is applicable to a variety of microorganisms. Summary of the Invention

[0003] This invention designs a novel carbon fixation system via a carbon dioxide pathway, which can increase the ability of any microbial cell to produce lactic acid using carbon dioxide.

[0004] In one embodiment, the carbon immobilization system includes an engineered pathway for immobilizing carbon dioxide to lactate, and comprises recombinant enzymes: i) formate dehydrogenase, EC: 1.17.1.9, ii) carboxylic acid reductase, EC: 1.2.1, iii) glyoxylate ligase, EC: 4.1.1.47, iv) carboxyl lyase, EC: 4.1.1.1 or 4.1.1.40, v) serine-pyruvate aminotransferase, EC: 2.6.1.51, vi) serine deaminase, EC: 4.3.1.17 or 4.3.1.13, vii) malate enzyme, EC: 1.1.1.38, 1.1.1.39 or 1.1.1.40, viiii) mayl-CoA synthase, EC: 6.2 1.9, ix) maloyl-CoA lyase, EC: 4.1.3.24, x) glyoxylate reductase, EC: 1.1.1.26 or 1.1.1.79, xi) glycolaldehyde dehydrogenase, EC: 1.2.1.21 or 1.2.1.22, xii) pyruvate bifunctional enzyme, which is a fusion of formate dehydrogenase and pyruvate-formate lyase, with formate dehydrogenase EC: 1.17.1.9 and pyruvate-formate lyase EC: 2.3.1.54, xiii) lactate dehydrogenase, EC: 1.1.1.27 or 1.1.1.28; xiv) alanine-glyoxylate aminotransferase, EC: 2.6.1.44; xv) threonine aldolase, EC: 4.1.2.48.

[0005] In one embodiment, the formate dehydrogenase is derived from Thiobacillus sp. KNK65MA, the carboxyl reductase is derived from Mycobacterium marinum, the glyoxylate ligase is derived from Escherichia coli, the carboxyl lyase is derived from Candida glabrata, the serine-pyruvate aminotransferase is derived from Thermotogamaritima, the serine deaminase is derived from Homo sapiens, the malate ligase is derived from Arabidopsisthaliana, the mayl-CoA synthase is derived from Methylorubrum extorquens, the mayl-CoA lyase is derived from Methylobacterium extorquens, the glyoxylate reductase is derived from Arabidopsisthaliana, the glycolaldehyde dehydrogenase is derived from Desulfovibrio intestinalis, and the pyruvate bifunctional enzyme is a combination of formate dehydrogenase derived from Thiobacillus sp. KNK65MA and Escherichia coli. Pyruvate-formate lyase derived from Coli is formed by fusion of EAAAKEAAAKEAAAK linker peptide, and lactate dehydrogenase is derived from Lacticaseibacillus casei; on this basis, alanine-glyoxylate aminotransferase derived from Homo sapiens and threonine aldolase derived from Leishmania major are expressed to further promote lactate synthesis.

[0006] In one embodiment, the amino acid sequence of the formate dehydrogenase is shown in SEQ ID NO.1, and the gene sequence is as follows:

[0007]

[0008] The amino acid sequence of the carboxylic acid reductase is shown in SEQ ID NO.2, and the gene sequence is shown below:

[0009]

[0010] The amino acid sequence of the glyoxylate ligase is shown in SEQ ID NO.3, and the gene sequence is shown below:

[0011]

[0012] The amino acid sequence of the carboxyl lyase is shown in SEQ ID NO.4, and the gene sequence is shown below:

[0013]

[0014] The amino acid sequence of the serine-pyruvate aminotransferase is shown in SEQ ID NO.5, and the gene sequence is shown below:

[0015]

[0016] The amino acid sequence of the serine deaminase is shown in SEQ ID NO.6, and the gene sequence is shown below:

[0017] atggatggcccggtggcggaacatgcgaaacaggaaccgtttcatgtggtgaccccgctgctggaaagctgggcgctgagccaggtggcgggcatgccggtgtttctgaaatgcgaaaacgtgcagccgagcggcagctttaaaattcgcggcattggccatttttgccaggaaatggcgaaaaaaggctgccgccatctggtgtgcagcagcggcggcaacgcgggcattgcggcggcgtatgcggcgcgcaaactgggcattccggcgaccattgtgctgccggaaagcaccagcctgcaggtggtgcagcgcctgcagggcgaaggcgcggaagtgcagctgaccggcaaagtgtgggatgaagcgaacctgcgcgcgcaggaactggcgaaacgcgatggctgggaaaacgtgccgccgtttgatcatccgctgatttggaaaggccatgcgagcctggtgcaggaactgaaagcggtgctgcgcaccccgccgggcgcgctggtgctggcggtgggcggcggcggcctgctggcgggcgtggtggcgggcctgctggaagtgggctggcagcatgtgccgattattgcgatggaaacccatggcgcgcattgctttaacgcggcgattaccgcgggcaaactggtgaccctgccggatattaccagcgtggcgaaaagcctgggcgcgaaaaccgtggcggcgcgcgcgctggaatgcatgcaggtgtgcaaaattcatagcgaagtggtggaagataccgaagcggtgagcgcggtgcagcagctgctggatgatgaacgcatgctggtggaaccggcgtgcggcgcggcgctggcggcgatttatagcggcctgctgcgccgcctgcaggcggaaggctgcctgccgccgagcctgaccagcgtggtggtgattgtgtgcggcggcaacaacattaacagccgcgaactgcaggcgctgaaaacccatctgggccaggtg

[0018] The amino acid sequence of the malic acid enzyme is shown in SEQ ID NO.7, and the gene sequence is shown below:

[0019]

[0020] The amino acid sequence of the malic ylCoA synthase is shown in SEQ ID NO.8, and the gene sequence is shown below:

[0021]

[0022] The amino acid sequence of the malic acyl-CoA lyase is shown in SEQ ID NO.9, and the gene sequence is shown below:

[0023] atgagctttaccctgattcagcaggcgaccccgcgcctgcatcgcagcgaactggcggtgccgggcagcaacccgacctttatggaaaaaagcgcggcgagcaaagcggatgtgatttttctggatctggaagatgcggtggcgccggatgataaagaacaggcgcgcaaaaacattattcaggcgctgaacgatctggattggggcaacaaaaccatgatgattcgcattaacggcctggatacccattatatgtatcgcgatgtggtggatattgtggaagcgtgcccgcgcctggatatgattctgattccgaaagtgggcgtgccggcggatgtgtatgcgattgatgtgctgaccacccagattgaacaggcgaaaaaacgcgaaaaaaaaattggctttgaagtgctgattgaaaccgcgctgggcatggcgaacgtggaagcgattgcgaccagcagcaaacgcctggaagcgatgagctttggcgtggcggattatgcggcgagcacccgcgcgcgcagcaccgtgattggcggcgtgaacgcggattatagcgtgctgaccgataaagatgaagcgggcaaccgccagacccattggcaggatccgtggctgtttgcgcagaaccgcatgctggtggcgtgccgcgcgtatggcctgcgcccgattgatggcccgtttggcgattttagcgatccggatggctataccagcgcggcgcgccgctgcgcggcgctgggctttgaaggcaaatgggcgattcatccgagccagattgatctggcgaacgaagtgtttaccccgagcgaagcggaagtgaccaaagcgcgccgcattctggaagcgatggaagaagcggcgaaagcgggccgcggcgcggtgagcctggatggccgcctgattgatattgcgagcattcgcatggcggaagcgctgattcagaaagcggatgcgatgggcggcaaa

[0024] The amino acid sequence of the glyoxylate reductase is shown in SEQ ID NO.10, and the gene sequence is shown below:

[0025] atggaagtgggctttctgggcctgggcattatgggcaaagcgatgagcatgaacctgctgaaaaacggctttaaagtgaccgtgtggaaccgcaccctgagcaaatgc gatgaactggtggaacatggcgcgagcgtgtgcgaaagcccggcggaagtgattaaaaaatgcaaatataccattgcgatgctgagcgatccgtgcgcggcgctgagc gtggtgtttgataaaggcggcgtgctggaacagatttgcgaaggcaaaggctatattgatatgagcaccgtggatgcggaaaccagcctgaaaattaacgaagcgatt accggcaaaggcggccgctttgtggaaggcccggtgagcggcagcaaaaaaccggcggaagatggccagctgattattctggcggcgggcgataaagcgctgtttgaag aaagcattccggcgtttgatgtgctgggcaaacgcagcttttatctgggccaggtgggcaacggcgcgaaaatgaaactgattgtgaacatgattatgggcagcatga tgaacgcgtttagcgaaggcctggtgctggcggataaaagcggcctgagcagcgataccctgctggatattctggatctgggcgcgatgaccaacccgatgtttaaagg caaaggcccgagcatgaacaaaagcagctatccgccggcgtttccgctgaaacatcagcagaaagatatgcgcctggcgctggcgctgggcgatgaaaacgcggtgag catgccggtggcggcggcggcgaacgaagcgtttaaaaaagcgcgcagcctgggcctgggcgatctggattttagcgcggtgattgaagcggtgaaatttagccgcgaa

[0026] The amino acid sequence of the glycolaldehyde dehydrogenase is shown in SEQ ID NO.11, and the gene sequence is shown below:

[0027]

[0028] The amino acid sequence of the pyruvate bifunctional enzyme is shown in SEQ ID NO.12, and the gene sequence is shown below:

[0029]

[0030] The amino acid sequence of the lactate dehydrogenase is shown in SEQ ID NO.13, and the gene sequence is shown below:

[0031] atggcgagcattaccgataaagatcatcagaaagtgattctggtgggcgatggcgcggtgggcagcagctatgcgtatgcgatggtgctgcagggcattgcgcaggaaattggcattgtggatatttttaaagataaaaccaaaggcgatgcgattgatctgagcaacgcgctgccgtttaccagcccgaaaaaaatttatagcgcggaatatagcgatgcgaaagatgcggatctggtggtgattaccgcgggcgcgccgcagaaaccgggcgaaacccgcctggatctggtgaacaaaaacctgaaaattctgaaaagcattgtggatccgattgtggatagcggctttaacggcatttttctggtggcggcgaacccggtggatattctgacctatgcgacctggaaactgagcggctttccgaaaaaccgcgtggtgggcagcggcaccagcctggataccgcgcgctttcgccagagcattgcggaaatggtgaacgtggatgcgcgcagcgtgcatgcgtatattatgggcgaacatggcgataccgaatttccggtgtggagccatgcgaacattggcggcgtgaccattgcggaatgggtgaaagcgcatccggaaattaaagaagataaactggtgaaaatgtttgaagatgtgcgcgatgcggcgtatgaaattattaaactgaaaggcgcgaccttttatggcattgcgaccgcgctggcgcgcattagcaaagcgattctgaacgatgaaaacgcggtgctgccgctgagcgtgtatatggatggccagtatggcctgaacgatatttatattggcaccccggcggtgattaaccgcaacggcattcagaacattctggaaattccgctgaccgatcatgaagaagaaagcatgcagaaaagcgcgagccagctgaaaaaagtgctgaccgatgcgtttgcgaaaaacgatattgaaacccgccag

[0032] The amino acid sequence of the alanine-glyoxylate aminotransferase is shown in SEQ ID NO.14, and the gene sequence is shown below:

[0033]

[0034] The amino acid sequence of the threonine aldolase is shown in SEQ ID NO.15, and the gene sequence is shown below:

[0035]

[0036] The present invention also provides a lactic acid-producing microbial cell that expresses all the enzymes in the above-described carbon fixation system.

[0037] The present invention also provides an engineered cell expressing the above-described carbon fixation system.

[0038] In one embodiment, the engineered cells use bacteria or fungi as expression hosts;

[0039] In one embodiment, the engineered cells use Bacillus subtilis, Escherichia coli, or yeast as expression hosts.

[0040] The present invention also provides a recombinant Escherichia coli that expresses all the enzymes in the above-described carbon fixation system.

[0041] In one embodiment, the recombinant *E. coli* integrates formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase into the fdh site on the genome, the NCBI number of which is 948384; and integrates carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase into the frmA site on the genome, the NCBI number of which is 944988; and integrates malate lyase (ME), malate-CoA synthase (… MCS and malic lyase (MCL) were integrated into the adhE site on the genome, with the NCBI number 945837; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) were integrated into the fucO site on the genome, with the NCBI number 947273; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) were integrated into the sfcA site on the genome, with the NCBI number 946031.

[0042] In one embodiment, the recombinant Escherichia coli may further include: integrating the alanine-glyoxylate aminotransferase and threonine aldolase into the yahJ (NCBI number: 944976) and yobf sites (NCBI number: 946338) on the genome, respectively.

[0043] The present invention also provides a recombinant *Kluyveromyces martensii* that expresses all the enzymes in the above-described carbon fixation system.

[0044] In one embodiment, the *Kluyveromyces martensii* comprises: formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase integrated into the PDC1 site on the genome, the NCBI number of which is 34717303; carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase integrated into the GPD1 site on the genome, the NCBI number of which is 34713860; and malate lyase (ME) and mayl-CoA synthase integrated into the genome. MCS and malic lyase (MCL) were integrated into the ADH1 site on the genome, with the NCBI number 34716095; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) were integrated into the PDC2 site on the genome, with the NCBI number 34715648; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) were integrated into the ADH2 site on the genome, with the NCBI number 34716208.

[0045] In one embodiment, the recombinant Kluyveromyces martensii may further include: integrating the alanine-glyoxylate aminotransferase and threonine aldolase into the PDC2 site (NCBI gene number: 34715648) and GPD2 site (NCBI gene number: 34714771) on the genome, respectively.

[0046] The present invention also provides a recombinant Isaac's orientalis yeast that expresses all the enzymes in the above-described carbon fixation system.

[0047] In one embodiment, the recombinant *Issa mesasula* comprises: formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase integrated into the EG4 site of the genome; carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase integrated into the EG9 site of the genome; malate lyase (ME), mayl-CoA synthase (MCS), and mayl-CoA lyase (MCL) integrated into the EG14 site of the genome; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) integrated into the GD5 site of the genome; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) integrated into the GD21 site of the genome. References for the selection of genome integration sites: Fatma, Z., Tan, S., Boob, AG & Zhao, HMA landing pad system for multicopy gene integration in Issatchenkia orientalis Metabolic Engineering 78, 200-208 (2023).

[0048] In one embodiment, the recombinant *Issa mesasula* may further include: integrating the alanine-glyoxylate aminotransferase and threonine aldolase into the EG6 and GD11 sites on the genome, respectively.

[0049] The present invention also provides a recombinant brewer's yeast that expresses all the enzymes in the above-described carbon fixation system.

[0050] In one embodiment, the recombinant Saccharomyces cerevisiae integrates formate dehydrogenase (FDH), carboxylate reductase (CAR), and glyoxylate ligase into the PDC2 site on the genome, the NCBI number of which is 851654; integrates carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase into the PDC6 site on the genome, the NCBI number of which is 852978; and integrates malate lyase (ME) and mayl-CoA synthase. MCS and malic lyase (MCL) were integrated into the ADH1 site on the genome, with the NCBI number 854068; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) were integrated into the ADH2 site on the genome, with the NCBI number 855349; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) were integrated into the ADH6 site on the genome, with the NCBI number 855368.

[0051] In one embodiment, the recombinant Saccharomyces cerevisiae may further include: integrating the alanine-glyoxylate aminotransferase and threonine aldolase into the PDC2 site (NCBI gene number: 851654) and GPD1 site (NCBI gene number: 851539) on the genome, respectively.

[0052] The present invention also provides a method for constructing a microbial strain that synthesizes lactic acid from carbon dioxide, wherein the method comprises expressing the enzyme in the above-mentioned carbon immobilization system using the microbial strain;

[0053] In one embodiment, the method involves integrating the carbon fixation system into the genome of a microbial strain.

[0054] In one embodiment, the microbial strain uses bacteria or fungi as an expression host;

[0055] In one embodiment, the microbial strain uses Bacillus subtilis, Escherichia coli, or yeast as the expression host.

[0056] The present invention also provides a method for synthesizing lactic acid using carbon dioxide as a raw material. The method involves using the above-mentioned lactic acid production microbial cells, or the above-mentioned engineered cells, or the microbial strains prepared by the above method, to provide CO2 with bicarbonate for fermentation to produce lactic acid.

[0057] In one embodiment, the bicarbonate salt includes, but is not limited to, sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, magnesium bicarbonate, barium bicarbonate, and ammonium bicarbonate.

[0058] In one embodiment, the fermentation conditions are: 28–32°C, 50–70 rpm, and a reaction time of at least 20 h.

[0059] The present invention also provides the application of the above-mentioned carbon immobilization system in constructing autotrophic chassis cells or engineered strains that synthesize lactic acid using carbon dioxide as a raw material.

[0060] The present invention also provides the application of the above-mentioned lactic acid producing microbial cells, or the above-mentioned engineered cells, or the microbial strains prepared by the above-mentioned methods in the preparation of lactic acid or lactic acid derivatives or products containing lactic acid.

[0061] Beneficial effects

[0062] (1) This pathway is a novel artificial carbon fixation pathway that can directly utilize carbon dioxide as a substrate and has four enzymes (formate dehydrogenase, carboxyl lyase, pyruvate functional enzyme and malic acid enzyme) that fix carbon dioxide simultaneously.

[0063] (2) This pathway includes a variety of central metabolites such as acetyl-CoA, pyruvate, malic acid, etc., which are essential substances for the metabolism of all microorganisms and have the potential for expanded applications.

[0064] (3) This pathway can produce lactic acid in a variety of microorganisms such as Escherichia coli, Kluyveromyces martensii, Isaac's orientalis and Saccharomyces cerevisiae, and has universality.

[0065] (4) This pathway can utilize a variety of one-carbon substrates such as carbon dioxide, formic acid and formaldehyde, and has multiple values ​​in terms of substrate utilization. Attached Figure Description

[0066] Figure 1 CGPD carbon fixation pathway.

[0067] Figure 2 pTarget plasmid map.

[0068] Figure 3 Escherichia coli produces lactic acid.

[0069] Figure 4 pUCC001 plasmid map.

[0070] Figure 5 Kluyveromyces maculae is used to produce lactic acid.

[0071] Figure 6 pVT plasmid map.

[0072] Figure 7 : Orient Isaac yeast produces lactic acid.

[0073] Figure 8 pCUT plasmid map.

[0074] Figure 9 Saccharomyces cerevisiae produces lactic acid. Detailed Implementation

[0075] This invention designs a carbon dioxide utilization pathway, named the CGPD pathway ( Figure 1 The enzymes in the CGPD pathway are: formate dehydrogenase (FDH), carboxylic acid reductase (CAR), glyoxylate ligase, carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), serine-serine deaminase, malate (ME), mayl-CoA synthase (MCS), mayl-CoA lyase (MCL), glyoxylate reductase (GR), glycolaldehyde dehydrogenase (GDH), pyruvate bifunctional enzyme (PB), and lactate dehydrogenase (LDH).

[0076] In addition, this pathway includes an auxiliary pathway that converts glyoxylate to glycine via alanine-glyoxylate aminotransferase (AGXT), and then glycine is converted to serine via threonine aldolase (TA), which enters the CGPD pathway to promote lactate synthesis.

[0077] This invention provides a recombinant cell that expresses the enzyme in the carbon dioxide fixation pathway of this invention. The recombinant cell can be expressed in free form using an expression vector in the cell, or it can be integrated into any site on the genome that does not affect its growth, thus achieving the technical solution of this invention.

[0078] This invention provides a recombinant *E. coli* strain expressing formate dehydrogenase (FDH), carboxylic acid reductase (CAR), glyoxylate ligase, carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), serine-serine deaminase, malate lyase (ME), mayl-CoA synthase (MCS), mayl-CoA lyase (MCL), glyoxylate reductase (GR), glycolaldehyde dehydrogenase (GDH), pyruvate bifunctional enzyme (PB), and lactate dehydrogenase (LDH). Based on this, alanine-glyoxylate aminotransferase (AGXT) converts the intermediate product glyoxylate to glycine, which is then converted to serine via threonine aldolase (TA), entering the CGPD pathway to promote lactate synthesis.

[0079] In one embodiment of the present invention, the recombinant *E. coli* may integrate formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase into the fdh site on the genome; integrate carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase into the frmA site on the genome; integrate malate lyase (ME), mayl-CoA synthase (MCS), and mayl-CoA lyase (MCL) into the adhE site on the genome; integrate glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) into the fucO site on the genome; and simultaneously integrate pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) into the sfcA site on the genome. Alanine-glyoxylate aminotransferase (AGXT) and threonine aldolase (TA) are integrated into the yahJ and yobf sites on the genome, respectively.

[0080] The present invention also provides a recombinant *Kluyveromyces martensii* yeast expressing formate dehydrogenase (FDH), carboxylic acid reductase (CAR), glyoxylate ligase, carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), serine-serine deaminase, malate lyase (ME), mayl-CoA synthase (MCS), mayl-CoA lyase (MCL), glyoxylate reductase (GR), glycolaldehyde dehydrogenase (GDH), pyruvate bifunctional enzyme (PB), and lactate dehydrogenase (LDH).

[0081] In one embodiment of the present invention, the recombinant Kluyveromyces martensii comprises: formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase integrated into the PDC1 site of the genome; carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase integrated into the GPD1 site of the genome; malate lyase (ME), mayl-CoA synthase (MCS), and mayl-CoA lyase (MCL) integrated into the ADH1 site of the genome; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) integrated into the PDC2 site of the genome; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) integrated into the ADH2 site of the genome.

[0082] The present invention also provides a recombinant *Isaiah dongnanensis*, which expresses formate dehydrogenase (FDH), carboxylic acid reductase (CAR), glyoxylate ligase, carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), serine-serine deaminase, malate lyase (ME), mayl-CoA synthase (MCS), mayl-CoA lyase (MCL), glyoxylate reductase (GR), glycolaldehyde dehydrogenase (GDH), pyruvate bifunctional enzyme (PB), and lactate dehydrogenase (LDH).

[0083] In one embodiment of the present invention, the recombinant *Issa mesasula* comprises: formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase integrated into the EG4 site of the genome; carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase integrated into the EG9 site of the genome; malate lyase (ME), mayl-CoA synthase (MCS), and mayl-CoA lyase (MCL) integrated into the EG14 site of the genome; glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) integrated into the GD5 site of the genome; and pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) integrated into the GD21 site of the genome.

[0084] The present invention also provides a recombinant brewer's yeast expressing formate dehydrogenase (FDH), carboxylic acid reductase (CAR), glyoxylate ligase, carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), serine-serine deaminase, malate lyase (ME), mayl-CoA synthase (MCS), mayl-CoA lyase (MCL), glyoxylate reductase (GR), glycolaldehyde dehydrogenase (GDH), pyruvate bifunctional enzyme (PB), and lactate dehydrogenase (LDH).

[0085] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae integrates formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase into the PDC2 site of the genome; integrates carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase into the PDC6 site of the genome; integrates malate lyase (ME), mayl-CoA synthase (MCS), and mayl-CoA lyase (MCL) into the ADH1 site of the genome; integrates glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH) into the ADH2 site of the genome; and integrates pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH) into the ADH6 site of the genome.

[0086] This invention also provides applications of the above-mentioned recombinant cells, recombinant Escherichia coli, recombinant Kluyveromyces martensii, recombinant Isaac's orientalis, and recombinant Saccharomyces cerevisiae in the preparation of lactic acid using carbon dioxide as a raw material.

[0087] The gene integration methods involved in the following embodiments are all conventional methods in the art. They can be homologous recombination-mediated gene integration, transposase-mediated gene integration, CRISPR / Cas9-mediated gene integration, or viral vector-mediated gene integration. Any technical means that can achieve the purpose of gene integration can be used.

[0088] The culture media involved in the following examples are as follows:

[0089] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0090] TB medium: yeast extract 24 g / L, tryptone 12 g / L, KH2PO4 2.31 g / L, K2HPO4 16.43 g / L, glycerol 4 g / L.

[0091] YPD medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0092] K. marxianus growth medium: ammonium sulfate 2 g / L, potassium dihydrogen phosphate 0.5 g / L, magnesium sulfate heptahydrate 1 g / L, yeast extract 5 g / L, glucose 50 g / L.

[0093] I. orientalis growth medium (ammonium sulfate 3 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate heptahydrate 1 g / L, yeast extract 2 g / L, peptone 2 g / L, glucose 55 g / L).

[0094] Saccharomyces cerevisiae growth medium: yeast extract 21 g / L, ammonium chloride 2 g / L, potassium dihydrogen phosphate 2 g / L, glucose 60 g / L.

[0095] The detection methods involved in the following embodiments are as follows:

[0096] Lactic acid determination: A BIO-RAD Aminex HPX-87H column was used for separation at 52℃. The mobile phase was 5 mmol / L sulfuric acid solution (H2SO4), and the flow rate was set to 0.6 mL / min. Analysis was performed using a UV detector. After appropriate dilution, the reaction solution was centrifuged at 12000 r / min for 10 min. The supernatant was filtered and used for injection at a volume of 20 μL.

[0097] Example 1: Carbon fixation pathway design

[0098] This invention designs a carbon dioxide utilization pathway, named the CGPD pathway ( Figure 1 This pathway starts with CO2, involves 13 reaction steps, fixes 5 molecules of carbon dioxide, and produces one molecule of lactic acid. The detailed steps are as follows:

[0099] (1) Step 1: CO2 is catalyzed by formate dehydrogenase (FDH) to produce formic acid. Formate dehydrogenase is classified as enzyme number 1.17.1.9, a general term for enzymes that catalyze the conversion of CO2 to formic acid. This enzyme relies on NADH (or NADPH) as a reducing agent. CO2 + NAD(P)H → Formose + NAD(P) + .

[0100] (2) Step 2: Formic acid is converted to formaldehyde by carboxylic acid reductase (CAR). Carboxylic acid reductase is classified under enzyme number EC: 1.2.1, a general term for enzymes that catalyze the conversion of carboxylic acids to aldehydes. This enzyme relies on ATP and NADH (or NADPH) as driving forces. Formate + ATP + NAD(PH) + →Formaldehyde+AMP+Diphosphate+NAD(P) + .

[0101] (3) Step 3: Formaldehyde is converted into glycolaldehyde by glyoxylate ligase (GCL). Carboxylic acid reductase is classified as enzyme number 4.1.1.47, which is the general term for enzymes that catalyze the conversion of formaldehyde to glycolaldehyde. 2Formaldehyde→Glycolaldehyde.

[0102] (4) Step 4: Glycolaldehyde and CO2 react with carboxyl lyase (CL) to produce hydroxypyruvate. Carboxyl lyase (CL) is classified as enzyme number 4.1.1.1 or 4.1.1.40, and is a general term for enzymes that catalyze the production of hydroxypyruvate from glycolaldehyde and CO2. Glycolaldehyde + CO2 → Hydroxypyruvate.

[0103] (5) Step 5: Hydroxypyruvate is catalyzed by serine-pyruvate aminotransferase (SPA) to form serine. Serine-pyruvate aminotransferase (SPA) is classified as enzyme number 2.6.1.51, a general term for enzymes that catalyze the conversion of hydroxypyruvate and alanine into serine and pyruvate. Hydroxypyruvate + Alanine → Serine + Pyruvate. Serine-pyruvate aminotransferase (SPA) and alanine dehydrogenase (ALD, enzyme number 1.1.4.1) are used in combination to achieve the cycling of pyruvate and alanine without carbon loss. Alanine dehydrogenase (ALD) is classified as enzyme number 1.1.4.1, a general term for enzymes that catalyze the recycling of pyruvate back to alanine. Pyruvate + NH4 + +NADH→Alanine+NAD + +H2O.

[0104] (6) Step 6: Serine is catalyzed by serine deaminase (SD) to form pyruvate. Serine hydrolases are also called serine hydrolases. Serine deaminase (SD) is classified as enzyme number 4.3.1.17 or 4.3.1.13, and is a general term for enzymes that catalyze the production of pyruvate from serine. L-serine → pyruvate + NH4 + .

[0105] (7) Step 7: Pyruvate and CO2 are catalyzed by malate enzyme (ME) to form malic acid. Malate enzyme (ME) is classified as enzyme number 1.1.1.38, 1.1.1.39, or 1.1.1.40, and is a general term for enzymes that catalyze the conversion of pyruvate to malic acid. Pyruvate + CO2 + NAD(P)H → Malate + NAD + .

[0106] (8) Step 8: Malic acid is catalyzed by malyl-CoA synthase (MCS) to form malyl-CoA. Malic acid thiokinase (MCS) is classified as enzyme number 6.2.1.9, which is the general term for enzymes that catalyze the formation of malic acid from malic acid. Malate + ATP + CoA → Mallyl-CoA + ADP + Phosphate.

[0107] (9) Step 9: Malyl-CoA is catalyzed by mayl-CoA lyase (MCL) to form acetyl-CoA and glyoxylate. Mayl-CoA lyase (MCL) is classified as enzyme number 4.1.3.24, which is the general term for enzymes that catalyze the formation of malic acid from malic acid. Malyl-CoA → Glyoxylate + Acetyl-CoA.

[0108] (10) Step 10: The glyoxylic acid produced in Step 9 is catalyzed by glyoxylate reductase (GR) to form glycolic acid. Glyoxylate reductase (GR) is classified as enzyme number 1.1.1.26 or 1.1.1.79, and is a general term for enzymes that catalyze the conversion of glyoxylic acid to glycolic acid. glyoxylate + NAD(P)H → glycolate + NAD(P) + .

[0109] (11) Step 11: Glycolic acid produced in Step 10 is catalyzed by glycolaldehyde dehydrogenase (GDH) to form glycolaldehyde. Glycolic acid dehydrogenase (GDH) is classified as enzyme number 1.2.1.21 or 1.2.1.22, and is a general term for enzymes that catalyze the formation of glycolaldehyde from glycolate. glycolate + NADH → glycolaldehyde + NAD + +H2O.

[0110] (12) Step 12: The acetyl-CoA and CO2 produced in Step 9 are catalyzed by the pyruvate bifunctional enzyme (PB) to form pyruvate. Specifically, the pyruvate bifunctional enzyme (PB) is formed by the fusion of formate dehydrogenase (FDH, enzyme number 1.17.1.9) and pyruvate formate lyase (PFL, enzyme number 2.3.1.54), realizing CO2 + acetyl-CoA + NAD(P)H → pyruvate + CoA + NAD(P) + .

[0111] (13) Step 13: Coupling the above pathway with lactate dehydrogenase (LDH) enables the production of lactic acid using carbon dioxide. Lactate dehydrogenase (LDH) is classified as enzyme number 1.1.1.27 or 1.1.1.28, and is a general term for enzymes that catalyze the production of lactic acid from pyruvate. pyruvate + NADH → lactate + NAD + .

[0112] (14) Step 14: Alanine-glyoxylate aminotransferase (AGXT) is classified as enzyme number 2.6.1.44, a general term for enzymes that catalyze the intermediate product glyoxylate to glycine: glyoxylate + L-alanine → glycine + pyruvate.

[0113] (15) Step 15: Threonine aldolase (TA) is classified as enzyme number 4.1.2.48, a general term for enzymes that catalyze the production of serine from glycine: glycine + Formaldehyde → Serine.

[0114] Example 2: Selection of pathway enzymes

[0115] Step 1: Formate dehydrogenase (FDH) from Thiobacillus sp. KNK65MA was selected, with the amino acid sequence shown in SEQ ID NO.1; Step 2: Carboxylic acid reductase (CAR) from Mycobacterium marinum was selected, with the amino acid sequence shown in SEQ ID NO.2; Step 3: Glyoxylate ligase (GCL) from Escherichia coli was selected, with the amino acid sequence shown in SEQ ID NO.3; Step 4: Carboxyl lyase (CL) from Candida glabrata was selected, with the amino acid sequence shown in SEQ ID NO.4; Step 5: Serine-pyruvate aminotransferase (SPA) from Thermotoga maritima was selected, with the amino acid sequence shown in SEQ ID NO.5; Step 6: Serine-serine deaminase (SD) from Homo sapiens was selected, with the amino acid sequence shown in SEQ ID NO.6; Step 7: Malicase (ME) from Arabidopsis thaliana was selected, with the amino acid and gene sequences shown in SEQ ID NO.7; Step Step 8: Select malic acid-CoA synthase (MCS) from Methylorubrum extorquens, with the amino acid sequence shown in SEQ ID NO. 8; Step 9: Select malic acid-CoA lyase (MCL) from Methylobacterium extorquens, with the amino acid sequence shown in SEQ ID NO. 9; Step 10: Select glyoxylate reductase (GR) from Arabidopsis thaliana, with the amino acid sequence shown in SEQ ID NO. 10; Step 11: Select glycolate-glycoaldehyde dehydrogenase (GDH) from Desulfovibrio intestinalis, with the amino acid sequence shown in SEQ ID NO. 11; Step 12: Select formate dehydrogenase (FDH) from Thiobacillus sp. KNK65MA and pyruvate-formate lyase (PFL) from Escherichia coli, fused via the EAAAKEAAAKEAAAK linker peptide to form a pyruvate bifunctional enzyme (PB), with the amino acid sequence shown in SEQ ID NO. 12; Step 13: Select Lacticaseibacillus... Step 14 selects alanine-glyoxylate aminotransferase (AGXT) derived from *Lacticaseibacillus casei*, with the amino acid sequence shown in SEQ ID NO.As shown in SEQ ID NO. 14; Step 15 selects alanine-threonine aldolase (TA) from Leishmania major, with the amino acid sequence shown in SEQ ID NO. 15.

[0116] Example 3: Modular assembly of pathway enzyme genes

[0117] To enable the CGPD pathway to function in microorganisms, the pathway is divided into 5 modules.

[0118] Module 1 includes formate dehydrogenase (FDH), carboxylic acid reductase (CAR), and glyoxylate ligase (GCL). The genes of the above three enzymes (amino acids are shown in SEQ ID NO. 1 to 3) are amplified using the FDH-T / FDH-B, CAR-T / CAR-B, and GCL-T / GCL-B primers in Table 1, respectively. The complete Module 1 gene fragment (fdh-car-gcl) is obtained by homologous recombination fusion and named M1.

[0119] Module 2 includes carboxyl lyase (CL), serine-pyruvate aminotransferase (SPA), and serine-serine deaminase (SD). Using the primers CL-T / CL-B, SPA-T / SPA-B, and SD-T / SD-B in Table 1, the genes of the above three enzymes were amplified respectively (the amino acids are shown in SEQ ID NO. 4 to 6, respectively), and fused by homologous recombination to obtain the complete Module 2 gene fragment (cl-spa-sd), named M2.

[0120] Module 3 includes malic acid lyase (ME), malic acyl-CoA synthase (MCS), and malic acyl-CoA lyase (MCL). Using the primers ME-T / ME-B, MCS-T / MCS-B, and MCL-T / MCL-B in Table 1, the genes of the above three enzymes were amplified respectively (the amino acids are shown in SEQ ID NO. 7 to 9, respectively), and fused by homologous recombination to obtain the complete gene fragment of module 3 (me-mcs-mcl), named M3.

[0121] Module 4 includes glyoxylate reductase (GR) and glycolaldehyde dehydrogenase (GDH). Using the CR-T / CR-B and GDH-T / GDH-B primers in Table 1, the genes of the two enzymes were amplified respectively (the amino acids are shown in SEQ ID NO. 10-11 respectively), and fused by homologous recombination to obtain the complete Module 4 gene fragment (gr-gdh), named M4.

[0122] Module 5 includes a pyruvate bifunctional enzyme (PB) and lactate dehydrogenase (LDH). Using the PB-T / PB-B and LDH-T / LDH-B primers in Table 1, the genes of the two enzymes were amplified respectively (the amino acids are shown in SEQ ID NO. 11-13 respectively), and fused by homologous recombination to obtain the complete Module 5 gene fragment (pb-ldh), named M5.

[0123] Table 1: Primers used for modular construction

[0124]

[0125] Example 4: Application of the CGPD pathway in the production of lactic acid from Escherichia coli

[0126] 1. Construction of Escherichia coli integrating the CGPD pathway

[0127] Based on CRISPR / Cas9 gene editing technology, the genes M1, M2, M3, M4, and M5 obtained above were sequentially and iteratively integrated into the fdh (948384), frmA (944988), adhE (945837), fucO (947273), and sfcA (946031) sites in the *E. coli* MG1655 genome. Specifically, the agg sequence was searched within the integration sites of the five target genes, and the 20 bp preceding the agg sequence in the previous sequence were selected as N20. The N20 sequences of the five genes are shown in Table 2.

[0128] Table 2: Escherichia coli genome integration N20 sequence

[0129] fdh-N20 TATCGCCCACGCCCAGGAAG frmA-N20 GCACCGCGGCTGGGGTCAGT adhE-N20 CGTTCGTAAAGGTGCAGAAC fucO-N20 CATGACATGCGGTAACAGGA sfcA-N20 AGGACAGACCGGGCTGTTTA yahJ-N20 ACCGGTTTTGACTACGAAAA yobf-N20 TATAAGGCTCGGCAGAGAAG

[0130] Copy and paste the N20 sequence to the corresponding N20 position in the pTarget sequence of plasmid. Figure 2 ) Design reverse amplification primers for whole plasmid PCR. The primers used are shown in Table 3.

[0131] Table 3 Primer sequences for constructing gene N20

[0132] fdh-N20-F tatcgcccacgcccaggaaggttttagagctagaaatagcaagttaaaat fdh-N20-R cttcctgggcgtgggcgataactagtattatacctaggactgag frmA-N20-F gcaccgcggctggggtcagtgttttagagctagaaatagcaagttaaaata frmA-N20-R actgaccccagccgcggtgcactagtattatacctaggactgag adhE-N20-F cgttcgtaaaggtgcagaacgttttagagctagaaatagcaagt adhE-N20-R gttctgcacctttacgaacgactagtattatacctaggactgagc fucO-N20-F catgacatgcggtaacaggagttttagagctagaaatagcaagttaaaat fucO-N20-R tcctgttaccgcatgtcatgactagtattatacctaggactgagcta sfcA-N20-F aggacagaccgggctgtttagttttagagctagaaatagcaagt sfcA-N20-R taaacagcccggtctgtcctactagtattatacctaggactgagc yahJ-N20-F accggttttgactacgaaaagttttagagctagaaatagcaagttaaaat yahJ-N20-R tttcgtagtcaaaaccggtactagtattatacctaggactgagcta yobf-N20-F tataaggctcggcagagaaggttttagagctagaaatagcaagttaaaat yobf-N20-R cttctctgccgagccttataactagtattatacctaggactgagcta

[0133] Subsequently, a gene integration frame was constructed using homologous recombination. The Cas9 plasmid was first electroporated into E. coli MG1655 competent cells, which were then used as hosts to prepare competent cells. The integration frame fragment and the N20-containing plasmid pTargetF were electroporated into the competent cells, and colony PCR was used to verify whether the gene had been knocked out. The five genes were iteratively integrated sequentially in the order of fdh, frmA, adhE, fucO, and sfcA: The complete gene fragment M1 (fdh-car-gcl) from module 1 was integrated into the fdh site of wild-type *E. coli* MG1655 to obtain strain *E. coli* MG166-M1; the complete gene fragment M2 (cl-spa-sd) from module 2 was integrated into the frmA site of *E. coli* MG166-M1 to obtain strain *E. coli* MG166-M2; the complete gene fragment M3 (me-mcs-mcl) from module 3 was integrated into the adhE site of *E. coli* MG166-M2 to obtain strain *E. coli* MG166-M3; and the complete gene fragment M4 (gr-gdh) from module 4 was integrated into *E. coli* MG166-M2. The strain E. coli MG166-M4 was obtained by inserting the fucO site of MG166-M3; the strain E. coli MG166-M4 was obtained by integrating the complete gene fragment M5 (pb-ldh) of module 5 into the sfcA site of E. coli MG166-M4. This strain contains the complete CGPD pathway gene.

[0134] 2. Production of lactic acid using carbon dioxide

[0135] (1) To further evaluate the performance of the strain in producing lactic acid using carbon dioxide, a single colony of E. coli MG166-M5 was picked from the plate and inoculated into LB medium. The culture was activated by fermentation at 37°C and 220 r / min for 6 h to prepare seed liquid.

[0136] (2) The prepared seed culture was transferred to 50 mL of TB medium at an inoculation rate of 5% (v / v) and cultured at 37 °C and 200 rpm until OD. 600 The concentration was 0.6-0.8. After incubation at 30℃ for 16 hours, the cells were collected by centrifugation.

[0137] (3) The bacterial cells collected under the above conditions were transformed into whole cells and evaluated in 250 mL serum bottles.

[0138] The initial volume of serum vials was 150 mL. Bacterial cell concentrations were added at levels of 5 g / L, 10 g / L, 15 g / L, and 20 g / L, respectively. Tris-HCl solution (pH 7.0) was used as the medium for whole-cell transformation. 500 mM NaHCO3 was added to provide CO2. The reaction was catalyzed at 37 °C and 50 rpm for 20 hours. After the reaction, the lactic acid content was measured.

[0139] The results are as follows Figure 3 As shown, when the bacterial cell concentration was 5 g / L, the lactic acid production reached 9.43 mM, proving that the CGPD pathway can operate in E. coli. When the E. coli bacterial cell concentration reached 20 g / L, the lactic acid production reached 55.23 mM.

[0140] 3. Construction of E. coli MG166-M6

[0141] The gene sequences of alanine-glyoxylate aminotransferase (AGXT) and threonine aldolase (TA) (amino acid sequences as shown in SEQ ID NO. 14-15, respectively) were further integrated into the yahJ (944976) and yobf (946338) sites on the E. coli MG166-M5 genome, respectively. The N20 sequences used and the introduction are shown in Tables 2 and 3.

[0142] Following the method in step 2, the lactic acid yield of the prepared recombinant strain was tested.

[0143] The results showed that when the amount of alanine (50 mM) required for alanine-glyoxylate aminotransferase (AGXT) was supplemented exogenously, the lactic acid production increased to 79.82 mM when the amount of Escherichia coli added reached 20 g / L.

[0144] Example 5: Application of the CGPD pathway in the production of lactic acid from Kluyveromyces marxianus

[0145] 1. Construction of *Kluyveromyces martensii* strain integrating the CGPD pathway

[0146] To enable the CGPD pathway to operate in *Kluyveromyces marxianus*, the five module genes M1-M5 of this pathway were sequentially and iteratively integrated into the *Kluyveromyces marxianus* genome using CRISPR / Cas9 gene editing technology. The five selected genomic integration sites were PDC1 (34717303), GPD1 (34713860), ADH1 (34716095), PDC2 (34715648), and ADH2 (34716208). The N20 sequences used for genome integration are shown in Table 4.

[0147] Table 4: N20 sequence integrated into the genome of *Kluyveromyces martensii*

[0148] (K.marxianus)PDC1-N20 GCTGACTTGGTTCTATCTGT (K.marxianus)GPD1-N20 GATTTGATCACAACCTGTGC (K.marxianus)ADH1-N20 ACCAAGTTGCCATTGGTGGG (K.marxianus)PDC2-N20 CAATTTTTGACCTCGCATTC (K.marxianus)ADH2-N20 ACCAAGTTGCCATTGGTCGG (K.marxianus)PDC2-N20 GGGTGTTTTAGAAGAGTTCA (K.marxianus)GPD2-N20 GATTACGTTATCGATTCGAC

[0149] Copy and paste the N20 sequence to the corresponding N20 position in the pUCC001 sequence. Figure 4 ) Design reverse amplification primers for whole plasmid PCR, and the primers used are shown in Table 5.

[0150] Table 5 Primer sequences for constructing gene N20

[0151] (K.marxianus)PDC1-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)PDC1-N20-R ctatttctagctctaaaacacagatagaaccaagtcagcgacgagcttactcgtttcgt (K.marxianus)GPD1-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)GPD1-N20-R ctatttctagctctaaaacgcacaggttgtgatcaaatcgacgagcttactcgtttcgt (K.marxianus)ADH1-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)ADH1-N20-R ctatttctagctctaaaaccccaccaatggcaacttggtgacgagcttactcgtttcgt (K.marxianus)PDC2-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)PDC2-N20-R ctatttctagctctaaaacgaatgcgaggtcaaaaattggacgagcttactcgtttcgt (K.marxianus)ADH2-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)ADH2-N20-R ctatttctagctctaaaacccgaccaatggcaacttggtgacgagcttactcgtttcgt (K.marxianus)PDC2-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)PDC2-N20-R ctatttctagctctaaaactgaactcttctaaaacacccgacgagcttactcgtttcgt (K.marxianus)GPD2-N20-F gttttagagctagaaatagcaagttaaaataaggctagtccg (K.marxianus)GPD2-N20-R ctatttctagctctaaaacgtcgaatcgataacgtaatcgacgagcttactcgtttcgt

[0152] The integration frame fragments of the target module genes and the plasmid pUCC001 containing N20 were introduced into the strain via lithium acetate chemical transformation. Screening was performed on YNB plates, and the genome was extracted and sequenced for verification. The specific integration sequence was as follows: the M1 gene (fdh-car-gcl) of module 1 was integrated into the PDC1 gene locus of wild-type K. marxianus to obtain strain K-M1; the M2 gene (cl-spa-sd) of module 2 was integrated into the GPD1 gene locus of strain K-M1 to obtain strain K-M2; the M3 gene (me-mcs-mcl) of module 3 was integrated into the ADH1 gene locus of strain K-M2 to obtain strain K-M3; the M4 gene (gr-gdh) of module 4 was integrated into the PDC2 gene locus of strain K-M3 to obtain strain K-M4; and the M5 gene (pb-ldh) of module 5 was integrated into the ADH2 gene locus of strain K-M4 to obtain strain K-M5, which includes the complete CGPD pathway.

[0153] 2. Production of lactic acid using carbon dioxide

[0154] (1) Select a single colony of strain K-M5 and inoculate it into a 250mL Erlenmeyer flask containing 50mL YPD medium. Incubate the flask at 37℃ for 12 hours on a reciprocating shaker at 200r / min until the bacterial culture reaches the OD value. 600 A score of 5-6 was obtained to produce first-grade seed solution;

[0155] (2) Inoculate the seed culture at a rate of 10% (v / v) into a 500 mL Erlenmeyer flask containing 100 mL of growth medium. Continue to culture under the same conditions (200 r / min, 37 °C) with shaking for about 15 hours until OD is reached. 600 The bacterial count reached 10. Subsequently, the cells were collected by centrifugation for later use.

[0156] (3) The reaction system for whole-cell transformation used serum bottles as reaction containers, with an initial liquid volume of 150 mL. Cell concentrations were set at 10 g / L, 15 g / L, 20 g / L, 25 g / L, and 30 g / L, respectively. Tris-HCl buffer solution at pH 7.0 was used as the reaction medium, and 500 mM NaHCO3 was added exogenously as a carbon dioxide donor. The catalytic reaction was carried out at 37 °C and 50 r / min for 20 hours. After the reaction, the lactic acid content was measured.

[0157] The results are as follows Figure 5 As shown, when the cell addition amount was 30 g / L, the final lactic acid production reached 25.83 mM, indicating that the constructed CGPD carbon fixation pathway can function in Kluyveromyces martensii.

[0158] 3. Construction of strain K-M6

[0159] The gene sequences of alanine-glyoxylate aminotransferase (AGXT) and threonine aldolase (TA) (amino acid sequences as shown in SEQ ID NO. 14-15, respectively) were further integrated into the PDC2 site (NCBI gene number: 34715648) and GPD2 site (NCBI gene number: 34714771) on the genome of strain K-M5, respectively. The N20 sequences used and their introduction are shown in Tables 4 and 5.

[0160] Following the method in step 2, the lactic acid yield of the prepared recombinant strain was tested.

[0161] The results showed that when the amount of alanine (40 mM) required for alanine-glyoxylate aminotransferase (AGXT) was supplemented exogenously, the lactic acid production increased to 37.21 mM when the amount of bacterial cells added reached 20 g / L.

[0162] Example 6: Application of the CGPD pathway in the production of lactic acid by Issatchenkia orientalis

[0163] 1. Construction of *Issa mesasura* strain integrating the CGPD pathway

[0164] To enable the CGPD pathway to function in *Issa mesasica* (I. orientalis), the five module genes of this pathway were iteratively integrated into the *I. orientalis* genome in a stepwise manner. The selected genomic integration sites were EG4, EG9, EG14, GD5, and GD21. The N20 sequences used for genome integration are shown in Table 6 below.

[0165] Table 6: N20 sequence integrated into the genome of *Isaccharomyces orientalis*

[0166] EG4-N20 gtcgctgtcacgggatcacg EG9-N20 tcttccgtgatccaggtgtt EG14-N20 gtagcgtgtagtggttagac GD5-N20 ctccgtatggctaagagtgc GD21-N20 tctttaatacctgttgcgta EG6-N20 acgacagacgacgccacgcg GD11-N20 tgtaggtattttccgcggca

[0167] Copy and paste the N20 sequence to the corresponding N20 position in the pVT sequence of plasmid. Figure 6 ) Design reverse amplification primers for whole plasmid PCR. The primers used are shown in Table 7.

[0168] Table 7 Primer sequences for constructing gene N20

[0169] EG4-N20-F gggttttcgtgaagtgcaagtggagtgtggaagttgaggcggacacgtgc EG4-N20-R tgcgccactgttggcatggctgcctgtgggactcttgtttgttgcgaggg EG9-N20-F ttggaaattccatggcatgtataaataacggatgtgtgagttcaagatgc EG9-N20-R gtttgtttgtgtctgtacttctattgtttacaatagacatggttcacaga EG14-N20-F tttccaaaatgatacgcggtcgtgctattatggtttccaaaagtttaatg EG14-N20-R taggtccatctatacatgtagaaaataatcattgtgaatataagttataa GD5-N20-F taagcgtataggtggaatccagttgatttctatcaggttaaccacataca GD5-N20-R aacctttgtgtaacagtaaggtaaaactttcgacatacagagtttccgtg GD21-N20-F gtcctgagattgaaatctcatagttaagttggcttccttttgctctaatt GD21-N20-R tctgtcagcaatgtttctcaattctcattgacaaagccagaaatatgcaa EG6-N20-F cctctgtggtgtcacagcaaggcccgtctataccaacatgtgcagagcac EG6-N20-R aggggtggctgcccctgtgtgtggatataacatacacacacacggacaga GD11-N20-F gacgcatcctttatctcggacttgactcggcaccctcttgccgcggcacc GD11-N20-R gcctctcgagccgcggaacaaccaatattctgtcatttccactcccgtga

[0170] The integration frame fragments of the target module genes and the plasmid pVT containing N20 and Cas were introduced into the strain via lithium acetate chemical transformation. Screening was performed on YNB plates, and the genome was extracted and sequenced for verification. The specific integration order was as follows: the M1 gene (fdh-car-gcl) of module 1 was integrated into the EG4 gene locus of wild-type *I. orientalis*, resulting in strain I-M1; the M2 gene (cl-spa-sd) of module 2 was integrated into the EG9 gene locus of strain I-M1, resulting in strain I-M2; the M3 gene (me-mcs-mcl) of module 3 was integrated into the EG14 gene locus of strain I-M2, resulting in strain I-M3; the M4 gene (gr-gdh) of module 4 was integrated into the GD5 gene locus of strain I-M3, resulting in strain I-M4; and the M5 gene (pb-ldh) of module 5 was integrated into the GD21 gene locus of strain I-M4, resulting in strain I-M5 containing the complete CGPD pathway.

[0171] 2. Production of lactic acid using carbon dioxide

[0172] (1) Select a single colony of strain I-M5 and inoculate it into a 250 mL Erlenmeyer flask containing 50 mL of YPD medium. Incubate at 28 °C and 200 r / min on a reciprocating shaker for 12 hours until OD is reached. 600 If the value reaches 4-5, it is considered a first-grade seed liquid.

[0173] (2) Inoculate the seed culture into a 500 mL Erlenmeyer flask containing 100 mL of growth medium at a 5% (v / v) inoculation ratio, and continue to culture under the same conditions (200 r / min, 28 °C) for about 30 hours until OD. 600 Increase to 20. Collect cells by centrifugation for subsequent reactions.

[0174] (3) In the transformation experiment, the bacterial cells were resuspended in a 150 mL initial volume serum bottle, and the bacterial cell addition amounts were set at 20 g / L, 30 g / L, 40 g / L, and 50 g / L, respectively. Tris-HCl buffer at pH 7.0 was used as the whole-cell catalytic reaction medium, and 500 mM NaHCO3 was added as the CO2 source. The reaction was carried out at 30 °C and 50 r / min for 25 hours. After the reaction, the lactic acid content was measured.

[0175] The results are as follows Figure 7 As shown, when the amount of bacterial cells added was 50 g / L, the final lactic acid yield reached 20.16 mM, indicating that the constructed CGPD artificial synthesis pathway can be functionally expressed in *Issa mesasura* and effectively drive the bioconversion of CO2 to the target product lactic acid.

[0176] 3. Construction of strain I-M6

[0177] The gene sequences of alanine-glyoxylate aminotransferase (AGXT) and threonine aldolase (TA) (amino acid sequences as shown in SEQ ID NO. 14-15, respectively) were further integrated into the EG6 and GD11 sites on the genome of strain I-M5, respectively. The N20 sequences used and the introduction are shown in Tables 6 and 7.

[0178] Following the method in step 2, the lactic acid yield of the prepared recombinant strain was tested.

[0179] The results showed that when the amount of alanine (30 mM) required for alanine-glyoxylate aminotransferase (AGXT) was supplemented exogenously, the lactic acid production increased to 30.38 mM when the amount of bacterial cells added reached 20 g / L.

[0180] Example 7: Using the CGPD pathway to produce lactic acid from Saccharomyces cerevisiae

[0181] 1. Construction of Saccharomyces cerevisiae integrating the CGPD pathway

[0182] To enable the CGPD pathway to operate in *Saccharomyces cerevisiae*, the five module genes M1-M5 of this pathway were sequentially and iteratively integrated into the *S. cerevisiae* genome using CRISPR / Cas9 gene editing technology. The five selected genomic integration sites were PDC2 (851654), PDC6 (852978), ADH1 (854068), ADH2 (855349), and ADH6 (855368); the N20 sequence used for genome integration is shown in Table 8.

[0183] Table 8: N20 sequence integrated into the genome of Saccharomyces cerevisiae

[0184] (S.cerevisiae)PDC1-N20 ATTCCTGCGGAGCATCGCGA (S.cerevisiae)PDC6-N20 CAGATATGGCGGTGTTTATG (S.cerevisiae)ADH1-N20 TAACTTGATGGCCGGTCACT (S.cerevisiae)ADH2-N20 CATTGTTAGCGCAGTCGTTA (S.cerevisiae)ADH6-N20 AGTGATATTCATTGTGCAGC (S.cerevisiae)PDC2-N20 TTTTCCACAACTGGTTAGTC (S.cerevisiae)GPD1-N20 TCTTACATCACTGAGGAACT

[0185] Copy and paste the N20 sequence to the corresponding N20 position in the pCUT sequence of plasmid. Figure 8 ). Design reverse amplification primers for whole plasmid PCR. The primers used are shown in Table 9.

[0186] Table 9 Primer sequences for constructing gene N20

[0187]

[0188]

[0189] The integration frame fragment and the plasmid pCUT containing N20 and Cas9 were introduced into the strain via lithium acetate chemical transformation. Screening was performed on YNB plates, and the genome was extracted and sequenced for verification. The specific integration order is as follows: The M1 gene (fdh-car-gcl) of module 1 was integrated into the PDC1 gene locus of wild-type *S. cerevisiae*, resulting in strain S-M1; the M2 gene (cl-spa-sd) of module 2 was integrated into the ADH3 gene locus of strain S-M1, resulting in strain S-M2; the M3 gene (me-mcs-mcl) of module 3 was integrated into the ADH1 gene locus of strain S-M2, resulting in strain S-M3; the M4 gene (gr-gdh) of module 4 was integrated into the PDC2 gene locus of strain S-M3, resulting in strain S-M4; and the M5 gene (pb-ldh) of module 5 was integrated into the ADH2 gene locus of strain S-M4, resulting in strain S-M5, which includes the complete CGPD pathway.

[0190] 2. Production of lactic acid using carbon dioxide

[0191] (1) Pick a single colony of strain S-M5 and inoculate it into a 250mL Erlenmeyer flask containing 50mL of YPD liquid medium. Incubate at 30℃ and 200r / min on a reciprocating shaker for 12 hours until the optical density (OD) of the primary seed culture is reached. 600 (Reaching 5 to 6.)

[0192] (2) The primary seed culture was transferred at an inoculation rate of 3% (v / v) to a 500 mL Erlenmeyer flask containing 100 mL of growth medium and cultured for approximately 30 hours at the same temperature and rotation speed (200 r / min, 30 °C) until OD was reached. 600 The value rose to 7. After the culture was completed, the bacterial cells were collected by centrifugation for subsequent reactions.

[0193] (3) In the whole-cell transformation experiment, the initial volume of the serum bottle was 150 mL, and different concentrations of bacterial cells (5 g / L, 10 g / L, 15 g / L and 20 g / L) were added. Tris-HCl buffer at pH 7.0 was used as the reaction medium, and 500 mM NaHCO3 was added as the CO2 donor. The catalytic reaction was carried out at 30 °C and 50 rpm for 20 hours.

[0194] The results are as follows Figure 9 As shown, when the cell concentration is 20 g / L, the lactic acid production can reach 35.42 mM, indicating that the constructed CGPD carbon fixation pathway can operate effectively in Saccharomyces cerevisiae and achieve the synthesis of the target product.

[0195] 3. Construction of strain S-M6

[0196] The gene sequences of alanine-glyoxylate aminotransferase (AGXT) and threonine aldolase (TA) (amino acid sequences as shown in SEQ ID NO. 14-15, respectively) were further integrated into the EG6 and GD11 sites on the genome of strain S-M5, respectively. The N20 sequences used and the introduction are shown in Tables 8 and 9.

[0197] Following the method in step 2, the lactic acid yield of the prepared recombinant strain was tested.

[0198] The results showed that when the amount of alanine (30 mM) required for alanine-glyoxylate aminotransferase (AGXT) was supplemented exogenously, the lactic acid production increased to 41.50 mM when the amount of bacterial cells added reached 20 g / L.

[0199] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A lactic acid-producing microbial cell, characterized in that, The microbial cells express enzymes for the carbon fixation pathway, which include: formate dehydrogenase, carboxyl reductase, glyoxylate ligase, carboxyl lyase, serine-pyruvate aminotransferase, serine deaminase, malate lyase, maloyl-CoA synthase, maloyl-CoA lyase, glyoxylate reductase, glycolaldehyde dehydrogenase, pyruvate bifunctional enzyme, and lactate dehydrogenase; the amino acid sequence of the formate dehydrogenase is shown in SEQ ID NO.1; the amino acid sequence of the carboxyl reductase is shown in SEQ ID NO.2; the amino acid sequence of the glyoxylate ligase is shown in SEQ ID NO.3; the amino acid sequence of the carboxyl lyase is shown in SEQ ID NO.4; the amino acid sequence of the serine-pyruvate aminotransferase is shown in SEQ ID NO.5; the amino acid sequence of the serine deaminase is shown in SEQ ID NO.6; the amino acid sequence of the malate lyase is shown in SEQ ID NO.7; and the amino acid sequence of the maloyl-CoA synthase is shown in SEQ ID NO.

8. The amino acid sequence of the malic acid-CoA lyase is shown in SEQ ID NO. 8; the amino acid sequence of the glyoxylate reductase is shown in SEQ ID NO. 10; the amino acid sequence of the glycolaldehyde dehydrogenase is shown in SEQ ID NO. 11; the amino acid sequence of the pyruvate bifunctional enzyme is shown in SEQ ID NO. 12; and the amino acid sequence of the lactate dehydrogenase is shown in SEQ ID NO.

13.

2. The microbial cell according to claim 1, characterized in that, The formate dehydrogenase is derived from Thiobacillus sp. KNK65MA, the carboxylic acid reductase derived from sp. KNK65MA, is a derivative of... Mycobacterium marinum Glyoxylate ligase originates from Escherichia coli The carboxyl lyase is derived from Candida glabrata The serine-pyruvate aminotransferase is derived from Thermotoga maritima The serine deaminase is derived from Homo sapiens The malic acid oxidase is derived from Arabidopsis thaliana, and the mayl-CoA synthase is derived from... Methylorubrum extorquens The malic ylCoA lyase is derived from Methylobacterium extorquens The glyoxylate reductase is derived from Arabidopsis thaliana The glycolaldehyde dehydrogenase is derived from Desulfovibrio intestinalis The pyruvate bifunctional enzyme is produced using... Thiobacillus Formate dehydrogenase derived from sp. KNK65MA and Escherichia coli The pyruvate-formate lyase is formed by fusion of EAAAKEAAAKEAAAK linker peptides, and the lactate dehydrogenase is derived from... Lacticaseibacillus casei .

3. The microbial cell according to claim 2, characterized in that, The microbial cells used are Escherichia coli or yeast as expression hosts.

4. The microbial cell according to claim 3, characterized in that, The enzymes in the carbon fixation pathway also include the following recombinant enzymes: alanine-glyoxylate aminotransferase and threonine aldolase; the amino acid sequence of the alanine-glyoxylate aminotransferase is shown in SEQ ID NO.14, and the amino acid sequence of the threonine aldolase is shown in SEQ ID NO.

15.

5. An engineered cell, characterized in that, The engineered cells express the enzymes of the carbon fixation pathway described in claim 1.

6. The engineered cell according to claim 5, characterized in that, The engineered cells use bacteria or fungi as expression hosts.

7. The engineered cell according to claim 6, characterized in that, The engineered cells use Escherichia coli or yeast as expression hosts.

8. A method for constructing a microbial strain that synthesizes lactic acid from carbon dioxide, characterized in that, The method involves using the microbial strain to express the enzymes of the carbon fixation pathway described in claim 1.

9. The method according to claim 8, characterized in that, The method involves integrating the gene encoding the enzyme of the carbon fixation pathway into the genome of a microbial strain.

10. The method according to claim 9, characterized in that, The microbial strain uses bacteria or fungi as the expression host.

11. The method according to claim 10, characterized in that, The microbial strains used Escherichia coli or yeast as expression hosts.

12. A method for synthesizing lactic acid from carbon dioxide, characterized in that, The method involves using lactic acid production microbial cells as described in any one of claims 1 to 4, engineered cells as described in any one of claims 5 to 7, or microbial strains prepared by the method described in any one of claims 8 to 11, to provide CO2 with bicarbonate for fermentation to produce lactic acid.

13. The method according to claim 12, characterized in that, The bicarbonates include sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, magnesium bicarbonate, barium bicarbonate, and ammonium bicarbonate.

14. The method according to claim 12, characterized in that, The fermentation conditions are: 28~32℃, 50~70rpm, and a reaction time of at least 20h.

15. The use of the lactic acid producing microbial cells according to any one of claims 1 to 4, or the engineered cells according to any one of claims 5 to 7, or the microbial strains prepared by the method according to any one of claims 8 to 11 in the preparation of lactic acid or lactic acid derivatives or products containing lactic acid.

Images