Escherichia coli LY8561 and application thereof in high-yield lactic acid production by utilizing cellooligosaccharides

Abstract

The present application relates to a kind of escherichia coli LY8561 and its application in high-yield lactic acid using cellooligosaccharide, belong to fermentation technical field.The present application has screened a new chassis strain-escherichia coli LY8561.After the plasmid of the fusion protein of cellulase BR12 and extracellular anchoring protein OmpC is transferred and expressed in escherichia coli, it is found that the growth rate of escherichia coli LY8561 in cellooligosaccharide solution after surface display cellulase is significantly improved.In addition, the present application also introduces recombinant plasmid pPL451-ldhL-om-BR12-tom-BR12 into escherichia coli LY8561 to obtain recombinant escherichia coli, and the final yield of lactic acid is 46g / L by inoculating the recombinant escherichia coli in the medium with 100g / L cellooligosaccharide as the only carbon source and not adding carbon source during fermentation.

Description

Technical Field

[0001] This invention relates to the field of fermentation technology, and in particular to an Escherichia coli LY8561 and its application in high-yield lactic acid production using fiber oligosaccharides. Background Technology

[0002] Lignocellulosic biomass is the most abundant biomass resource on Earth. In recent years, with the development of technologies such as enzyme preparations and fiber pretreatment, the cost of lignocellulosic hydrolysis has been significantly reduced. The fermentation industry using lignocellulosic hydrolysate as raw material is on the verge of rapid development. *Escherichia coli* is currently the most important chassis cell in metabolic engineering research, used to prepare a variety of important chemical substances. Using lignocellulosic hydrolysate as raw material and employing *E. coli* for fermentation to produce bulk chemical products can save a significant amount of grain raw materials for the fermentation industry, thus helping to reduce production costs.

[0003] There are two main difficulties in using *E. coli* for cellulose hydrolysate fermentation: first, the cellulose hydrolysate contains a large number of inhibitors, and commonly used *E. coli* strains in laboratories generally have low tolerance to these inhibitors; second, *E. coli* has very low tolerance to sugars in the culture medium. Inhibitor tolerance can be obtained through screening microorganisms in specific environments with high inhibitor content and through mutagenesis breeding. There are reports both domestically and internationally of obtaining inhibitor-resistant *E. coli* strains through screening. Sugar tolerance is mainly determined by the organism's osmotic pressure tolerance, and it is generally difficult to find organisms within the same species with significantly altered properties in this regard. Besides osmotic pressure, the effects of glucose on *E. coli* growth and fermentation are complex. High concentrations of glucose also lead to the formation of a large number of byproducts harmful to growth and fermentation, which often inhibit both cell growth and fermentation. Therefore, the second point mentioned above has a particularly significant impact on the fermentation of *E. coli* using cellulose hydrolysate to produce bulk chemicals. Because bulk chemicals are inexpensive, fermentation production requires a high product concentration in the final fermentation broth; otherwise, the costs of subsequent product extraction and wastewater treatment will increase significantly, potentially leading to unprofitability. According to relevant research in this field, the sugar concentration during E. coli fermentation should generally be controlled below 3%; otherwise, the growth and fermentation of E. coli will be significantly inhibited, ultimately resulting in unprofitability.

[0004] In traditional grain-based fermentation, this problem is generally addressed using a fed-batch method. This involves using a low-sugar-concentration fermentation broth for initial cultivation and fermentation, followed by gradual replenishment of sugar and other nutrients as the sugar in the broth is consumed. This process is made possible by efficient hydrolysis technology for starch or starchy raw materials. Currently, the sugar concentration obtained from starch or starchy raw materials using a dual-enzyme hydrolysis method can reach 500 g / L or higher, providing key technical support for fed-batch fermentation. Hydrolysis of lignocellulose materials is considerably more difficult; currently, the concentration of hydrolysate obtained is generally around 10%, which would significantly dilute the fermentation broth for fed-batch fermentation, introducing new problems for fermentation production. Current solutions involve evaporation and concentration to increase the hydrolysate concentration, but this significantly increases production costs and is detrimental to achieving energy conservation and emission reduction goals. Therefore, there is an urgent need to find a new method for utilizing cellulosic sugars and corresponding chassis strains. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the lack of a chassis strain with high utilization efficiency of fiber oligosaccharides in the prior art.

[0006] To address the aforementioned technical problems, this invention provides an *E. coli* strain LY8561 with highly efficient utilization of cellulosic oligosaccharides and its applications. In actual production, to avoid the impact of cellulose hydrolysis into glucose on the osmotic pressure of the strain, cellulase can be used to hydrolyze cellulose into low-osmotic-pressure cellulosic oligosaccharides, rather than the high-osmotic-pressure final product glucose. In previous work, this invention screened a cellulase that hydrolyzes cellulosic oligosaccharides. Overexpressing this recombinant enzyme in existing *E. coli* chassis strains revealed that these strains could not efficiently utilize cellulosic oligosaccharides. Therefore, this invention mutagenesis screened a new *E. coli* chassis strain—*E. coli* LY8561. Recombinant bacteria were obtained by expressing the cellulase in *E. coli* LY8561. The recombinant bacteria of this invention showed significantly faster growth rates in a 100 g / L cellulosic oligosaccharide solution than other recombinant *E. coli* strains expressing cellulase. In addition, the plasmid pPL451-ldhL-om-BR12-tom-BR12 was introduced into the Escherichia coli LY8561 of the present invention to obtain recombinant Escherichia coli. The recombinant Escherichia coli was inoculated into a culture medium with cellulosic sugar as the sole carbon source for fermentation, and no carbon source was added during the fermentation process. The final yield of lactic acid was 46 g / L, which shows that the recombinant Escherichia coli of the present invention has good utilization efficiency of cellulosic sugar.

[0007] The first objective of this invention is to provide an Escherichia coli LY8561, which has the accession number CCTCC NO: M 20241854.

[0008] The second objective of this invention is to provide a recombinant bacterium that efficiently hydrolyzes cell oligosaccharides, wherein the recombinant bacterium uses the aforementioned Escherichia coli LY8561 as a host, and the fusion protein of outer membrane protein C and cellulase is overexpressed in the Escherichia coli LY8561.

[0009] Furthermore, the fusion protein of the outer membrane protein C and cellulase is expressed under the regulation of the tac promoter.

[0010] Furthermore, the gene sequence of the cellulase is shown in SEQ ID NO.1, and the gene sequence of the outer membrane protein C is shown in SEQ ID NO.2.

[0011] A third objective of this invention is to provide an application of the above-mentioned recombinant bacteria in hydrolyzed cellulosic oligosaccharides.

[0012] A fourth objective of this invention is to provide a recombinant Escherichia coli that utilizes cellulosic oligosaccharides to produce high levels of lactic acid. The recombinant Escherichia coli is constructed in the aforementioned Escherichia coli LY8561 with a first expression cassette and a second expression cassette. The first expression cassette includes a temperature-controlled promoter, a gene encoding lactate dehydrogenase, and a gene encoding a fusion protein of outer membrane protein C and cellulase. The second expression cassette includes a tac promoter and a gene encoding a fusion protein of outer membrane protein C and cellulase.

[0013] Furthermore, the lactate dehydrogenase has the NCBI number BF29_3038, and the temperature-controlled promoter includes a λ-phage PR-PL promoter controlled by the temperature-sensitive repressor protein CI857. The first expression cassette uses plasmid pPL451 as a vector, and the gene encoding lactate dehydrogenase and the gene encoding the fusion protein of outer membrane protein C and cellulase are located downstream of the temperature-controlled promoter.

[0014] Furthermore, when the first expression cassette uses plasmid pPL451 as a vector, since plasmid pPL451 carries the λ-phage PR-PL promoter controlled by the temperature-sensitive repressor protein CI857, there is no need for exogenous introduction. It is only necessary to place the gene encoding lactate dehydrogenase and the gene encoding the fusion protein of outer membrane protein C and cellulase downstream of the temperature-controlled promoter.

[0015] Furthermore, the lactate dehydrogenase is expressed under the independent regulation of an RBS, the sequence of which is TTAAGGAGG.

[0016] Furthermore, the cellulase in plasmid pPL451-ldhL-om-BR12-tom-BR12 consists of two copies. This is because lactic acid fermentation occurs in two stages: an early stage with aeration and low temperature (34°C), and a later stage with anaerobic high temperature (42°C). The portion of tom-BR12 controlled by the tac promoter (i.e., the second expression frame) hydrolyzes cellulosic oligosaccharides in the early stage to provide a carbon source for the strain's growth. Another temperature-controlled promoter, om-BR12, is expressed in tandem with the ldhL gene (i.e., the first expression frame). It is mainly expressed together with the ldhL gene at 42°C. In this stage, it hydrolyzes cellulosic oligosaccharides together with the cellulase expressed by the tac promoter in the second expression frame tom-BR12, providing a carbon source for lactic acid production. The cellulase gene controlled by the first expression frame is inactive in the early growth stage due to the low temperature.

[0017] The fifth objective of this invention is to provide a method for high-yield lactic acid production using cellulose oligosaccharides, wherein the method involves inoculating the aforementioned recombinant Escherichia coli into a fermentation medium with cellulose oligosaccharides as the sole carbon source for fermentation and culture, thereby obtaining the lactic acid.

[0018] Furthermore, the fermentation culture includes an aerobic stage and an anaerobic stage, wherein the dissolved oxygen saturation of the aerobic stage is between 25% and 35%, and the temperature of the aerobic stage is 30-35°C; the dissolved oxygen saturation of the anaerobic stage is less than 0.1%, and the temperature of the anaerobic stage is 40-45°C.

[0019] Furthermore, the concentration of the cellulose oligosaccharide is 10-100 g / L.

[0020] The beneficial effects of this invention are:

[0021] This invention provides a novel Escherichia coli chassis strain—Escherichia coli LY8561. A recombinant strain was obtained by introducing a plasmid overexpressing cellulase into E. coli LY8561. This recombinant strain maintains good growth performance in an environment with 100 g / L of cellulosic acid as the sole carbon source, and its growth performance is not inhibited in a primary screening medium containing a high inhibitory solution of corn straw. The recombinant E. coli obtained by introducing plasmids overexpressing cellulase and lactate dehydrogenase into E. coli LY8561 can produce high levels of lactic acid. Using cellulosic acid as the sole carbon source and with a single feeding, the recombinant E. coli of this invention can produce up to 46 g / L of lactic acid, which is the highest yield obtained from a single feeding of cellulosic acid in lactic acid fermentation using E. coli as the inoculum.

[0022] Preservation of biological materials

[0023] Escherichia coli LY8561, which was deposited at the China Center for Type Culture Collection on August 27, 2024, with accession number CCTCC No. M 20241854, at Wuhan University, Wuhan, China. Attached Figure Description

[0024] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0025] Figure 1 This is a structural diagram of the recombinant plasmid pUtom;

[0026] Figure 2 This is a diagram showing the amino acid sequence alignment results of BR12 with the CelEX-BR12 reported in the literature;

[0027] Figure 3 This is the structural diagram of the recombinant plasmid pUtom-BR12;

[0028] Figure 4 This is the structural diagram of the recombinant plasmid pPL451-ldhL-om-BR12-tom-BR12;

[0029] Figure 5 This describes the lactic acid fermentation process of recombinant Escherichia coli LY8561 / ldhL-BR in a 15L fermenter. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0031] The experimental materials and their preparation methods involved in the following examples are as follows:

[0032] MacConkey agar plates: Qingdao Haibo pre-prepared plates. Phosphate-buffered buffer was prepared according to the literature (Zhuge Jian, Wang Zhengxiang. Handbook of Industrial Microbiology Experimental Techniques. Beijing: China Light Industry Press, 1994.). Cellulose powder, also known as microcrystalline cellulose, was a product of Hefei BASF Biotechnology Co., Ltd. Peptone was an OXOID product. Commercially available cellulase and xylanase were products of Novozymes, models Ctec and Shearzyme 500L respectively. Commercially available hemicellulase was a product of Xiasheng Enzyme Biotechnology Co., Ltd. Endonucleases and ligases used in DNA recombination were all products of Baoriyi Biotechnology (Beijing) Co., Ltd. One-step cloning kit was the Nanjing Novozymes one-step cloning kit C112. The construction of recombinant plasmids and recombinant E. coli was carried out according to general molecular biology methods. Plasmid extraction kits and other molecular biology reagents were purchased from Shanghai Sangon Biotech Service Co., Ltd. Metagenomic extraction of bovine gastric bacteria was performed using the BBI Soil & Stool Genome DNA Extraction Kit (Mag-MK Soil & Stool Genome DNA Extract Kit, kit number B618763-0050), distributed by Shanghai Sangon Biotech Co., Ltd. All other reagents were domestically produced analytical grade reagents, purchased from Sinopharm Chemical Reagent Co., Ltd.

[0033] The screening medium, used as the sole carbon source for bacterial strain screening, is also known as MM medium (g / L): Na₂HPO₄·12H₂O 20, (NH₄)₂SO₄ 6, KH₂PO₄ 4.5, CaCl₂ 0.5, NaCl 1, KCl 3, FeSO₄ 0.001. After sterilization at 115℃ for 15 min, add 1 mL of filtered and sterilized magnesium chloride solution: MgSO₄ 100 g / L and 1 mL of trace element solution. The trace element solution composition (g / L) is: CoCl₂·6H₂O 0.2, CuSO₄·H₂O 0.1, ZnCl₂ 0.2, (NH₄)₆Mo₇O 24 • 4H₂O 0.4, H₃BO₃ 0.05, MnSO₄·H₂O 0.6. MM medium supplemented with 5 g / L glucose or cellulosic acid is generally abbreviated as MM-G5 or MM-COS5.

[0034] The information on the host bacteria and other strains of Escherichia coli used in the following examples is as follows:

[0035] Escherichia coli 1510 (Sun Jinfeng, Zhuge Jian, Wang Zhengxiang. Screening and transformation of intestinal bacteria that effectively utilize xylose [J]. Journal of Wuxi University of Light Industry, 2003, (01): 21-24.), is a wild-type Escherichia coli;

[0036] Escherichia coli MG1655, LG185 and LG108 have all been published in our group's previous literature (Chen Xianzhong, Dai Sheng, Shen Wei, Yang Haiquan, Xia Yuanyuan. An Escherichia coli strain with shortened tryptophan fermentation cycle and its application [P]. Chinese Patent Application: 202311745118.2, 2023-11-03.);

[0037] Escherichia coli BL21(DE3) is an experimental strain of Escherichia coli, which was previously obtained and preserved by our research group (Shen Wei, Wang Zhengxiang, Liu Jiquan, Zhuge Jian. Expression of thermophilic α-amylase gene of archaea Pyrococcus furiosus in Escherichia coli. Food and Fermentation Industries, 2003, 29(3):10-14.).

[0038] Escherichia coli YEC166 and YEC170 were obtained by the research group in the early stage, and the relevant materials have been published in the literature (Liang Yichen, Zhang Jinwen, Shen Wei, Chen Xianzhong, Yang Haiquan, Xia Yuanyuan, Chen Lei. A recombinant Escherichia coli with shortened fermentation cycle and its application. [P]. Chinese Invention Patent Authorization: ZL202110598376.7, 2021-05-31) and the literature (Liang Yichen. Optimization and metabolic modification of recombinant Escherichia coli fermentation for tyrosol production [D]. Master's thesis of Jiangnan University, 2021.).

[0039] Escherichia coli LG108 and LG185 were obtained through preliminary screening by the research group, and relevant information has been published in the literature (Chen Xianzhong, Dai Sheng, Shen Wei, Yang Haiquan, Xia Yuanyuan. An Escherichia coli strain with shortened tryptophan fermentation cycle and its application [P]. Chinese Invention Patent Application: 202311745118.2, 2023-11-03.).

[0040] Information on the expression vectors used in the following examples has been disclosed in previous work. Among them, pUtac6 is disclosed in the literature (Chen Xianzhong, Dai Sheng, Shen Wei, Yang Haiquan, Xia Yuanyuan. An Escherichia coli strain with shortened tryptophan fermentation cycle and its application [P]. JP, 202311745118.2, 2023-11-03.). The present invention has deposited the Escherichia coli transformant JM109 / pUtac6 containing plasmid pUtac6, with the deposit number: CICIM B7522. Information related to the temperature-controlled expression vector pPL451 is publicly available in the literature (Li Yun, Shen Wei, Wang Zhen, Zhou Li, Chen Xianzhong, Yang Haiquan, Xia Yuanyuan. A novel flocculant and its application in the recovery of lactic acid fermentation chassis cells. Chinese Invention Patent Application: 2025102846501, application date: 20250311). The E. coli transformant JM109 / pPL451 containing the vector has been formally deposited with the accession number CICIM B7503.

[0041] The two plasmids of the *E. coli* gene editing system pCas-pTarget were purchased from Hunan Yada Fenghui New Materials Co., Ltd., with pCas product number ZT0100 and pTargetF product number YH095. *E. coli* DH5α / pCas and DH5α / pTargetF containing the above plasmids have been re-deposited on the China University Industrial Microbiology Resource Information Platform of Jiangnan University, with accession numbers CICIM B7526 and CICIM B7527, respectively.

[0042] The primers and their sequences involved in the following examples are shown in Table 1.

[0043] Table 1. Primers involved in Examples 1-6

[0044] Pcel01 AATTGAATTCGGAAAAGTGAATAACTTC Pcel02 AATTGTCGACTTATTTCTCGAGAGCC PBR01 AATTACGCTGCAGGGAAAAGTGAATAACTTC PBR02 AATTACCAAGCTTTTATTTCTCGAGAGCC PL-1 CGTCTGCAGAAGCTTCTAGTTAAGGAGGATTCTTATGAAAAAAGTCAATCGTATT PL-2 GGTACCCGGGAGCTCGAATTTTACAATATCGGTGCCATT POM-BR01 GCATCGATAGATCTCGATTAAGGAGGAATCTTATGAAAGTTAAAGTACTG POM-BR02 CCAAGCTCGCGAGGCCTCGACCTAGGTTAT TTCTCGAGAGC PTOB01 AATGGCGAATGGCGCTAGCTGCATAATTCGTGTC PTOB02 CTATGGCGTGCTGCTAGGGGCCCGGATATAGTTCCTC

[0045] The preparation and detection methods involved in the following embodiments are as follows:

[0046] Method 1: Preparation of cellulosic sugars from microcrystalline cellulose and culture medium using cellulosic sugars as the sole carbon source

[0047] Cellulose powder was prepared into a 100 g / L suspension in 1% NaOH solution. The suspension was incubated at 90℃ for 4 hours, with stirring every 20 minutes. The liquid was filtered off using a vacuum filter, and the cellulose residue was repeatedly washed with deionized water. After filtration again, the cellulose residue was resuspended in 0.1 mol / L pH 6.0 phosphate buffer. Tetrasaccharide cellulase Cel9R was added to a final concentration of 5 U / L, and the reaction was carried out at 70℃ for 2 hours. Three times the total volume of acetone was added, and the mixture was allowed to stand at room temperature for 20 minutes. The precipitate was then collected by centrifugation. The precipitate was dissolved in deionized water, and the residue was removed by centrifugation. The supernatant was collected. The content of different sugar components was determined by thin-layer chromatography. After the experimental results stabilized, large-scale preparation was carried out, and the content of glucose, cellobiose, trisaccharides, and tetrasaccharides was determined by HPLC. Alternatively, the total glucose content could be determined by hydrolysis with commercially available cellulase. The above-mentioned cellulosaccharides are generally dried and stored in solid form for later use. In MM medium, using the above-mentioned cellulosic sugar as the sole carbon source to replace glucose or other carbon sources can yield MM medium with cellulosic sugar as the sole carbon source.

[0048] Method 2: Hydrolysate of corn stalks with high inhibitors and primary screening culture medium for initial screening

[0049] Hydrolysate was prepared from 200-mesh ultrafine corn stalk powder (purchased from Lianyungang Lianfeng Agricultural Products Co., Ltd.) for primary screening of microorganisms. The method was as follows: Corn stalk powder was prepared into a 100 g / L suspension in 1% NaOH solution. The solution was incubated at 90℃ for 8 hours, stirring every 20 minutes. The pH was adjusted to approximately 6.0 with hydrochloric acid. Commercially available cellulase, xylanase, and hemicellulase were added at approximately 0.1% by volume. The reaction was carried out at 50℃ for 6 hours. The contents of glucose, xylose, and arabinose were determined by HPLC. The total sugar content was generally 2.5–3%, with glucose being the majority (2–2.5%), and the remainder being xylose and trace amounts of arabinose. Because the stalk powder was not washed after high-temperature alkaline treatment, the hydrolysate contained high concentrations of inhibitors such as furfural. Based on the HPLC results, the solution was diluted to approximately 1% glucose. The remaining components of MM medium were added to obtain the primary screening medium for initial screening of microorganisms.

[0050] Method 3: Lactic acid fermentation of recombinant Escherichia coli

[0051] The inorganic salt fraction of the 15L fermentation medium for *E. coli* was the same as that of the modified M9 medium: NH4Cl 1.0 g / L, Na2HPO4·12H2O 15.11 g / L, NaCl 0.5 g / L, KH2PO4 3.0 g / L, and (NH4)2SO4 5.0 g / L. To promote *E. coli* growth, a small amount of peptone (0.2 g / L) was additionally added. The above medium was sterilized by high-temperature steam sterilization at 117°C for 18 minutes. After sterilization, add 1 mL of 1 mol / L MgSO4 and 1 mL of trace element solution (trace element composition: MnCl2·4H2O 0.495 g / L, CuCl2·2H2O 0.15 g / L, FeCl3·6H2O 2.4 g / L, CoCl2·6H2O 0.3 g / L, ZnCl2 0.3 g / L, Na2MO4·2H2O 0.3 g / L, H3BO3 0.075 g / L) to each liter of culture medium. The above solution is used after being filtered through a 0.22 μm bacterial filter for sterilization.

[0052] The fermentation process is as follows.

[0053] Seed culture stage:

[0054] (1) The recombinant Escherichia coli strain was streaked on an LB solid plate with ampicillin resistance and cultured in an incubator at 37°C for 14-16 h.

[0055] (2) Inoculate the single colony obtained by streaking into a 250 mL Erlenmeyer flask containing 50 mL of sugar-free LB liquid medium and incubate at 37 °C for 9-13 h in a shaker.

[0056] (3) Centrifuge the bacterial solution in a sterile 50mL centrifuge tube at 6000r / min for 5min and collect the bacterial cells.

[0057] (4) The bacterial cells were resuspended in sterilized modified M9 liquid medium, and the OD value of the bacterial suspension was measured. 600 Inoculate into 500mL Erlenmeyer flasks containing 150mL of modified M9 liquid medium with 5g / L glucose. Generally, 10 flasks are needed for inoculation. Control the OD concentration during inoculation. 600 The concentration was between 0.35 and 0.4. The bacterial culture was incubated in shake flasks at 37°C, with samples taken regularly to measure the bacterial concentration. Generally, the OD value was measured after 6-7 hours of incubation. 600 When the level reaches 4-5, it can be used to inoculate fermenter culture medium.

[0058] The first stage of fermentation in the fermenter (aerobic stage):

[0059] (5) Take seed liquid and measure its OD 600 The culture medium was inoculated into a 15L fermenter using modified M9 medium. The initial volume of the fermentation broth was generally around 9L. After inoculation, the bacterial concentration (OD) was controlled. 600 Between 0.15 and 0.2, the initial glucose concentration of M9 culture medium is generally controlled at 25-35 g / L. In this example, no glucose is added to the culture medium, and cellulosic sugar is added directly to a final concentration of 100 g / L.

[0060] (6) In the initial stage, the air flux was set to 3 L / min (approximately 0.3 v / v.min), the agitator speed was set to 200 r / min, the dissolved oxygen concentration was initially 100%, and the temperature was 33℃. As the strain grew, the air flux was gradually increased from 3 L / min to 7 L / min (approximately 0.7 v / v.min). The agitator speed was kept correlated with the dissolved oxygen value, and the dissolved oxygen concentration was kept above 30%. Ordinary ammonia solution with a concentration of about 25-30% was mainly used to adjust the pH, and the pH was maintained at 6-7 in the first stage. A sulfuric acid solution of about 5% (v / v) was prepared for use when the pH was too high, but it was generally not used in actual operation. Odion concentration (OD) was measured approximately every 6 hours. 600 OD 600 A score of 10 indicates that fermentation can proceed to the next stage.

[0061] Second stage of fermentation in the fermenter (oxygen-limited stage):

[0062] The oxygen-limited stage is the stage for lactic acid production. The air inlet valve is closed, and the air flow rate is set to 0 L / min. The agitator speed is maintained at 200 rpm. Generally, after 10 minutes, the dissolved oxygen concentration drops to near 0% and remains at this level until the end of fermentation. The fermenter temperature is changed to 42℃, and the pH is adjusted using a 250 g / L Ca(OH)₂ emulsion. The emulsion is generally kept in suspension using magnetic stirring. The pH of the fermentation broth is maintained at 6.5-7.5 throughout the process. When the fermentation process no longer consumes Ca(OH)₂, lactic acid production generally stops, and fermentation ends. When using M9 medium with glucose as the carbon source for lactic acid fermentation, glucose needs to be added during this stage; however, this patent does not use glucose. In this patent, the carbon source, namely cellulosic sugar, is added all at once (100 g / L) to the initial medium, and no additional carbon source is added during the fermentation process.

[0063] Method 4: HPLC detection of lactic acid

[0064] Lactic acid testing was performed using standard methods. The procedure is briefly described below.

[0065] (1) Prepare lactic acid standards at concentrations (g / L): 2, 4, 6, 8, and 10. Create a standard curve.

[0066] (2) Sample processing method: Centrifuge the fermentation sample at 12000r / min for 5min, take the supernatant and dilute it 10 times (take 200μL sample and add 1.8mL ultrapure water) and filter it through a 0.22μm microporous membrane for detection.

[0067] (3) Preparation of mobile phase

[0068] (4) Dilute sulfuric acid solution (5mM): Take 0.277mL of concentrated sulfuric acid, add 1L of ultrapure water, filter through a 0.22μm microporous membrane, and then degas by sonication for 20min.

[0069] (5) Detection conditions: The lactic acid content was determined by high performance liquid chromatography using an HPX-87H organic acid analytical column at a column temperature of 65℃ and ultraviolet detection at a wavelength of 210nm. The mobile phase flow rate was 0.8mL / min.

[0070] Example 1: Construction of cellotetrasaccharide-type cellulase Cel9R and preparation of cellooligosaccharides

[0071] According to literature reports, the main product obtained by the cellulase Cel9R of *Clostridium thermocellum* hydrolyzing cellulose is cellotetrasaccharide. Based on the gene sequence of Cel9R published by NCBI (NCBI number AJ585346.1), further codon optimization was performed to obtain a Cel9R coding gene sequence (SEQ ID NO.3) suitable for expression in *Pichia pastoris*. Based on this sequence, Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the entire gene. The synthesized gene was inserted between BamHI and EcoRI in the vector pPIC9K to obtain the recombinant plasmid pPIC9K-Cel9R. The recombinant plasmid was linearized by digestion with Bgl II and then transformed into *Pichia pastoris* GS115. Transformants were detected on histidine-free medium. Twenty transformants were selected, streaked, and single colonies were used for shake-flask fermentation. Because the Cel9R gene was inserted between BamHI and EcoRI of the pPIC9K vector in this embodiment, the signal peptide of the vector was removed during construction, and the Cel9R gene used only had the mature peptide coding region, so the expressed protein was all intracellular. At the end of fermentation, the fermentation broth was centrifuged to collect cells, and the cells were further lysed. The cell lysate was used to detect cellulase activity. The construction methods of the recombinant plasmid and recombinant Pichia pastoris, as well as the cell lysate method, were all carried out according to the construction, fermentation, and intracellular enzyme extraction methods previously established by the research group [Shen Wei, Wang Bingbo, Zhu Jincun, Fan You, Chen Xianzhong. A performance-improved pullulanase chimera and a high-yield Pichia pastoris mutant strain of the chimera. Chinese Invention Patent, Authorization No.: ZL201610306855.6]. The results showed that the lysate of most of the strains had significant cellulase activity and could degrade carboxymethyl cellulose to obtain reducing sugar. As a control, the transformant cells of the pPIC9K empty plasmid could not degrade carboxymethyl cellulose after lysation. Transformant Ce3 showed relatively high enzyme activity and was selected as the subsequent strain for Cel9R enzyme expression. This transformant was named *Pichia pastoris* GS115 / pPIC9K-Cel9R Ce3, abbreviated as Ce3. The recombinant enzyme prepared from strain Ce3 was named Cel9R-Ce3.

[0072] The recombinant enzyme Cel9R-Ce3 was mixed with pretreated microcrystalline cellulose and hydrolyzed. Pretreatment and hydrolysis conditions are as described in Method 1, yielding a hydrolysate. Three volumes of acetone were added to the hydrolysate, and after mixing, the precipitate was collected by centrifugation and dried to obtain cellulosic oligosaccharides. After dissolution, HPLC analysis showed that over 90% of the hydrolysate consisted of cellotetrasaccharides, with smaller amounts possibly being cellobiose, cellotriose, or other oligosaccharides; glucose was not observed.

[0073] Example 2: Obtaining recombinant Escherichia coli using fiber oligosaccharides

[0074] An extracellular anchoring protein, OmpC (or outer membrane protein C), exists in *E. coli* cells. Fusing the gene encoding a foreign protein with the gene encoding OmpC allows the expressed foreign protein to be anchored on the *E. coli* cell surface, making it the most commonly used tool for displaying proteins on the cell surface of *E. coli*. Based on the OmpC gene sequence, further codon optimization was performed to obtain a codon-optimized OmpC gene sequence, as shown in SEQ ID NO.2. Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the codon-optimized OmpC gene. The synthesized gene was inserted between EcoRI and SalI in the expression vector pUtac6 to obtain the recombinant plasmid pUtac-OmpC, which is abbreviated as pUtom for ease of description. Figure 1 ).

[0075] Bovine stomach contents were collected from slaughterhouses, and metagenomic DNA was extracted. Using this DNA as a template, the mature peptide coding region of the cellulase gene (possibly a mixture of multiple similar genes) was obtained by PCR using Pcel01 and Pcel02 primers. The PCR product was digested with EcoRI and SalI and then ligated with the expression vector pET28a, which had been digested with the same enzymes. The ligation product was transformed into Escherichia coli BL21(DE3). Multiple transformants were obtained, and their expression was induced and cell lysis was performed to detect enzyme activity. The methods for inducing expression and extracting intracellular enzymes were the same as those in the literature (Shen Wei, Wang Zhengxiang, Liu Jiquan, Zhuge Jian. Expression of thermophilic α-amylase gene of Pyrococcus furiosus in Escherichia coli. Food and Fermentation Industries, 2003, 29(3):10-14.). The results showed that the enzyme activity of one transformant, Cel-33, was significantly higher than that of other transformants. This transformant was named Escherichia coli BL21(DE3) / pET28a-Cel-33. This embodiment uses this gene for cellulase surface display. First, the recombinant vector pET28a-Cel-33, in which the Cel-33 gene was inserted, was sequenced. The results showed that the amino acid sequence of the protein encoded by the Cel-33 gene inserted in the vector had 95% homology with a cellulase derived from bovine rumen bacteria, CelEx-BR12 [KoKC,Lee B,Cheong DE,Han Y,Choi JH,Song JJ. Bacterial cell surface display of a multifunctional cellulolytic enzyme screened from a bovine rumen metagenomic resource[J].Microbiol Biotechnol.2015,25(11):1835-1841.], belonging to the same type of protein. For ease of description, this gene was named BR12. The nucleotide sequence of the BR12 gene obtained by sequencing is shown in SEQ ID NO.1. The comparison results of the amino acid sequence of the BR12 protein obtained in this embodiment with the amino acid sequence of CelEx-BR12 reported in the literature are shown in... Figure 2 .

[0076] Using pET28a-Cel-33 as a template, the BR12 gene was obtained by PCR using PBR01 and PBR02 primers. The obtained gene was digested with PstI and HindIII and then ligated with the vector pUtom, which had been digested with the same enzymes, to obtain the recombinant plasmid pUtom-BR12. Figure 3The obtained recombinant plasmid can control the expression of a fusion protein of OmpC and the target cellulase BR12 in recombinant bacteria. Guided by OmpC, the fusion protein can be secreted extracellularly and anchored on the surface of *E. coli* cells. The recombinant plasmid pUtom-BR12 was electrotransformed into *E. coli* 1510, and the transformants were tested for growth in a medium with cellulosic acid as the sole carbon source. The results showed that recombinant *E. coli* 1510 / pUtom-BR12 exhibited significant growth in the medium with cellulosic acid as the sole carbon source, with a biomass OD of [value missing] after 24 hours of culture. 600 It can reach about 1.0, while the control bacteria Escherichia coli 1510 / pUtom hardly grows.

[0077] Further transformation was performed using plasmid pUtom-BR12 on previously collected *E. coli* strains, including experimental strains such as *E. coli* BL21(DE3), MG1655, and YEC166, as well as wild-type strains. The obtained recombinant bacteria were cultured in a medium with cellulosic acid as the sole carbon source. Cell concentration was measured after 24 hours of culture. Results showed that the biomass of transformants from wild-type *E. coli* YEC166 and YEC170 was significantly higher than that of other strains. Among the other strains used were experimental *E. coli* strains such as BL21(DE3) and several wild-type *E. coli* strains previously collected by our group; their biomass was around 1.0, significantly different from the two strains mentioned above. Results for some transformants are shown in Table 2.

[0078] Table 2 Growth of recombinant bacteria

[0079] 1510 / pUtom-BR12 1.0 24h MG1655 / pUtom-BR12 1.1 24h BL21(DE3) / pUtom-BR12 0.9 30h LG185 / pUtom-BR12 1.0 24h LG108 / pUtom-BR12 1.2 24h YEC166 / pUtom-BR12 1.9 24h YEC170 / pUtom-BR12 2.1 24h

[0080] Analysis of the original data of the strains used above shows that YEC166 and YEC170 are both E. coli strains screened from pig manure in farmland. These two strains differ significantly from common E. coli in their carbon source utilization, both being highly efficient at utilizing maltose. YEC166 can efficiently utilize maltose but not lactose. YEC170 can efficiently utilize both maltose and lactose. Based on this, it is speculated that a type of E. coli capable of utilizing maltose may exist in the feces of large mammals such as pigs, and is more suitable for utilizing cellulase oligosaccharides by displaying cellulase on its surface. Furthermore, considering that the strains obtained in this patent will primarily be used in cellulose hydrolysate, they need to have some resistance to common fermentation inhibitors in cellulose hydrolysate; therefore, it is necessary to re-screen the chassis cells.

[0081] Example 3: Screening of wild-type Escherichia coli

[0082] In May and July 2023, samples were collected from farmland in Lingyuan City and Jianchang County in western Liaoning Province, as well as from rural areas surrounding Wuxi City, primarily from the feces of large animals and wastewater near livestock farms. Small quantities were collected and transported back to the laboratory for separation. First, a small sample was incubated overnight in ordinary enrichment medium for *E. coli*. The culture was then further incubated in a primary screening medium containing a high inhibitor, straw hydrolysate (1% glucose) (Method 2), to enrich strains resistant to the inhibitory components of the fibrous hydrolysate. Generally, 0.1% of the culture was inoculated and incubated for 16 hours, followed by one subculturing. The culture was diluted and plated on MacConkey agar plates for *E. coli* staining. After 24 hours of incubation, red or pink colonies were selected. Further streaking was performed on MM medium with maltose as the sole carbon source. Based on the colony characteristics of *E. coli* YEC166, strains with similar colony characteristics were selected. A total of 881 strains were screened. All the above-mentioned strains were preserved and numbered as follows: LY1001-LY1327, B0001-B0231, and WX3001-WX3323. These strains were extracted in batches and electroporated using a pUtom-BR12 transducer. A total of 422 strains were used, and transformants were obtained from 186 strains. 16S rDNA molecular identification was performed on these strains. The 16S rDNA gene sequence was first obtained using standard methods, and then submitted to NCBI for sequence alignment. If the alignment showed that the submitted sequence had more than 99% homology with the *E. coli* sequence in the NCBI nucleotide sequence library, it was identified as *E. coli*. The results showed that 81 strains were *E. coli*, and the rest were *Klebsiella*.

[0083] The 81 Escherichia coli transformants were inoculated as single colonies onto LB medium and cultured overnight. Afterward, they were inoculated at a rate of 0.1% onto MM-COS10 medium (10 g / L of cellulosic acid) with cellulosic acid as the sole carbon source. After 24 hours of culture, the bacterial count was measured. The results showed that three strains had an OD value exceeding the target value. 600 The OD values ​​were above or close to 2.5, significantly higher than other strains. The strains numbered LY1085, B0006, and B0201 had OD values ​​after 24 hours of culture. 600 They reached 2.7, 2.6 and 2.4 respectively.

[0084] Example 4: Mutagenesis screening of Escherichia coli

[0085] The LY1085 / pUtom-BR12 strain was mutagenized as follows: a single colony was inoculated into liquid LB medium and cultured for approximately 6 hours until it reached the logarithmic growth phase (measured by OD). 600Based on a concentration of approximately 0.8, 10 mL of bacterial cells were taken, centrifuged, and the supernatant was discarded. The bacterial cells were resuspended in an equal volume of 2 mmol / L pH 6.0 phosphate buffer, and 1 mg of nitrosoguanidine pre-dissolved in phosphate buffer was added. The mixture was then incubated at 37°C with shaking for 30 min. After centrifugation and discarding the supernatant, the bacterial cells were resuspended in phosphate buffer again and transferred to 80 mL of LB liquid medium. The mixture was incubated at 37°C with shaking for 1 h. The mutagenized bacterial solution was appropriately diluted and plated on solid medium with cellulosic acid as the sole carbon source, with the number of colonies on each plate controlled to be around 100. After 16 h of incubation, the colony size was observed. After plating approximately 2000 plates, approximately 1000 larger colonies were selected. These larger colonies were further streaked and isolated, and single colonies were inoculated into liquid medium with cellulosic acid as the sole carbon source. After 24 h of incubation, the bacterial concentration was measured. The results showed that strain 85-61 / pUtom-BR12 had the highest bacterial concentration, reaching 3.1. Considering that the presence of a plasmid in 85-61 / pUtom-BR12 would hinder subsequent operations, plasmid removal was necessary. We transformed 85-61 / pUtac-OmpC-BR12 with the pCas plasmid from the pCas-pTarget plasmid of the *E. coli* gene editing system. After multiple electroporations, an ampicillin-kanamycin resistant strain was obtained. Following the pTarget plasmid removal method in the pCas-pTarget system, we obtained a strain with lost ampicillin resistance by adding IPTG and subculturing. Further, the pCas plasmid was removed through high-temperature culture at 42°C. Finally, a strain with eliminated kanamycin resistance was obtained. This strain is obtained by removing all plasmids from the recombinant bacterium 85-61 / pUtom-BR12, and theoretically should be completely identical to 85-61. For ease of description, this strain is named 85-61*. To confirm the function of 85-61*, plasmid pUtom-BR12 was transformed into 85-61* again to obtain recombinant bacteria 85-61* / pUtom-BR12. Fermentation results showed that the growth of 85-61* / pUtom-BR12 in cellulosic oligosaccharides was completely consistent with that of 85-61 / pUtom-BR12. Considering that 85-61* is actually the host bacterium of 85-61 / pUtom-BR12, it was renamed 85-61. To avoid confusion with other strains, following the naming conventions of our research group, this strain was ultimately named *Escherichia coli* LY8561, abbreviated as LY8561. The host strain of Escherichia coli LY8561 was deposited at the China Center for Type Culture Collection in accordance with the patented strain preservation procedure, and classified and named as Escherichia coli LY8561. The deposit date was August 27, 2024, and the accession number was CCTCC NO: M 20241854.

[0086] Example 5: Performance of Escherichia coli LY8561

[0087] The vector pUtom-BR12 was transformed into Escherichia coli LY8561 to obtain recombinant Escherichia coli LY8561 / pUtom-BR12. Several other recombinant bacteria transformed into plasmid pUtom-BR12 were cultured in a solution of glucose and cellulosic acid. The results are shown in Table 3.

[0088] Table 3. Growth of recombinant bacteria in culture media with different concentrations of glucose as the sole carbon source.

[0089]

[0090]

[0091] As shown in Table 3, the OD values ​​of all bacterial strains in low-concentration glucose medium were... 600 All concentrations can reach above 2.0. When the glucose concentration reaches 20 g / L, bacterial growth is somewhat inhibited, but it still approaches 2.0. However, when the glucose concentration reaches 80 g / L, bacterial growth is severely inhibited, and at 100 g / L, normal growth is practically impossible. This is mainly because the high osmotic pressure created by high glucose concentrations affects bacterial growth; this is a fundamental characteristic of *E. coli*, consistent with both experimental and wild-type strains. In the fermentation of bulk products, a glucose concentration of 100 g / L or higher is a basic requirement if no subsequent feeding is used; otherwise, excessively low product concentration and high extraction costs will severely impact economic efficiency. Therefore, if a single-feeding method using a carbon source is employed for fermentation, and if the carbon source is glucose, fermentation with *E. coli* strains is difficult to implement.

[0092] The recombinant bacteria were inoculated into MM medium of different concentrations with cellulosic sugar as the sole carbon source, and the results of shake-flask fermentation are shown in Table 4.

[0093] Table 4. Growth of recombinant bacteria in a medium with cellulose as the sole carbon source.

[0094]

[0095] As shown in Table 4, the cell concentrations of the same strain were very similar in different concentrations of oligosaccharide-rich media. Particularly in the 100 g / L oligosaccharide-rich medium, no growth inhibition was observed in any strain, indicating that due to the large molecular weight of oligosaccharides, even at 100 g / L, they do not create a high osmotic pressure, resulting in minimal growth inhibition. In different concentrations of oligosaccharide-rich media, the cell concentration achieved by LY8561 / pUtom-BR12 was significantly higher than that of other strains, mainly due to its significantly higher utilization efficiency of oligosaccharides.

[0096] The above-mentioned strains were inoculated into a primary screening medium with high inhibitors, and the results are shown in Table 5. As can be seen from Table 5, LY1085 and the mutant strain LY8561 both exhibited high biomass in the high inhibitor medium, while the growth of other strains was severely inhibited. This is clearly because LY1085 was obtained by enrichment using a high inhibitor medium, and therefore has strong tolerance to the inhibitors in the cellulose hydrolysate.

[0097] Table 5. Growth of recombinant bacteria in high-inhibitory culture medium

[0098] 1510 / pUtom-BR12 0.57 MG1655 / pUtom-BR12 0.55 BL21(DE3) / pUtom-BR12 0.46 YEC166 / pUtom-BR12 0.63 LG108 / pUtom-BR12 0.64 LY1085 / pUtom-BR12 1.94 LY8561 / pUtom-BR12 1.91

[0099] Example 6: Application of Escherichia coli LY8561 in lactic acid fermentation

[0100] To investigate the application potential of LY8561 in the fermentation of bulk fermented products, this embodiment constructs a recombinant plasmid and transforms LY8561 with cellulase BR12 and the key lactate-producing enzyme gene ldhL. The fermentation performance of the recombinant bacteria is then tested, and the application potential of LY8561 is preliminarily assessed.

[0101] The first step was to obtain the recombinant plasmid of *E. coli* expressing lactate dehydrogenase. Based on the genome sequence of *Bacillus coagulans* (NCBI accession number: CP009709), primers for amplifying lactate dehydrogenase ldhL (gene number: BF29_3038, L-lactate dehydrogenase) were designed and are shown in Table 1 (PL-1 and PL-2).

[0102] Using chromosomal DNA from Bacillus coagulans ATCC7050 as a template, PCR was performed using primers PL-1 and PL-2 to obtain the lactate dehydrogenase gene ldhL from Bacillus coagulans ATCC7050. The PCR product was recovered from the gel and ligated with the EcoRI-digested vector pPL451 using a one-step cloning kit. The recombinant plasmid pPL451-ldhL was obtained. Sequencing of the recombinant plasmid was used for verification. In the recombinant plasmid, the lactate dehydrogenase gene is located downstream of the PR-PL promoter of λ-phage. Gene expression is temperature-controlled, with expression occurring at 42℃ and shutting down below 33℃. The ldhL gene's initiation codon contains the ribosome binding site sequence TTAAGGAGG, introduced by primer PL-1.

[0103] The second step involved obtaining a DNA fragment containing the coding region of the fusion protein OmpC-BR12 using PCR. The primer sequences used are shown in Table 1 as POM-BR01 and POM-BR02. The PCR product OmpC-BR12 includes the structural gene of the OmpC-BR12 fusion protein (abbreviated as om-BR12), preceded by a ribosome binding site. The PCR product was ligated into the XhoI-digested vector pPL451-RL-LdhL to obtain the recombinant plasmid: pPL451-RL-ldhL-Om-BR12. The fusion protein is located downstream of the ldhL gene and has an independent ribosome binding site. It is expressed in tandem with the ldhL gene at 42°C. At 33°C or lower, the temperature-controlled promoter ahead is shut down, and this gene, like the ldhL gene, cannot express the product.

[0104] The third step involved obtaining the DNA fragment tac-OmpC-BR12-TT, containing the tac promoter, the coding region of the fusion protein OmpC-BR12, and the downstream transcription termination region, using PCR. The primer sequences used are shown in Table 1 as PTOB01 and PTOB02.

[0105] The PCR product tac-OmpC-BR12-TT includes the tac promoter, the OmpC-BR12 fusion protein structural gene, and a transcription terminator, abbreviated as tom-BR12. This fragment possesses independent expression regulatory elements such as a promoter and can be expressed during both bacterial growth and lactate production stages. The PCR product was ligated with the NheI-digested vector pPL451-ldhL-Om-BR12 to obtain the recombinant plasmid: pPL451-ldhL-Om-BR12-tom-BR12. Figure 4The recombinant plasmid was transformed into *E. coli* LY8561 to obtain recombinant *E. coli* LY8561 / pPL451-ldhL-Om-BR12-tom-BR12. For ease of description, the recombinant bacteria are abbreviated as LY8561 / ldhL-BR. Simultaneously, the recombinant plasmid pPL451-ldhL-Om-BR12-tom-BR12 was transformed into the other 6 *E. coli* host strains listed in Table 4, as well as *E. coli* YEC170, to obtain recombinant bacteria. All 8 recombinant *E. coli* strains were fermented in a 15L tank (Method 4). The results showed that the recombinant bacteria constructed using 1510, MG1655, BL21(DE3), YEC166, and LG108 as host strains achieved a higher bacterial concentration (OD) after long-term cultivation. 600 The lactic acid yields of these strains were all far below 10, making normal lactic acid fermentation impossible. The treatment methods for these strains were as follows: after culturing at 34℃ for 60 hours, the temperature was increased to 42℃ for lactic acid fermentation. After 60 hours of continuous fermentation, the lactic acid yield was consistently between 5-15 g / L, indicating a long fermentation time with very low yields, making further research unnecessary. Recombinant bacteria obtained using YEC170, LY1085, and LY8561 as host bacteria achieved cell counts exceeding 10, and their lactic acid fermentation results are shown in Table 6. As can be seen from Table 6, in a culture medium with cellulosic acid as the sole carbon source, the recombinant strain LY8561 / ldhL-BR, obtained using LY8561 as the host bacteria, exhibited significantly better cell growth and fermentation rates than other strains. The final lactic acid yield obtained by LY8561 / ldhL-BR fermentation was 46 g / L, which is the highest level of lactic acid obtained by using *E. coli* as the strain and cellulosic acid as the carbon source in a single-stage fermentation process. According to the research group's investigation, when using *E. coli* as the host bacterium for lactic acid fermentation, if glucose or other carbon sources are added all at once without supplementation during fermentation, the 46 g / L result obtained in this example is also the highest concentration of fermented lactic acid in the fermentation broth. The fermentation process of strain LY8561 / ldhL-BR in a 15L fermenter is as follows... Figure 5 As shown.

[0106] Table 6. Growth and lactic acid fermentation of recombinant bacteria in media with different cellulosic sugars as the sole carbon source.

[0107] YEC170 / ldhL-BR 48 54 23 LY1085 / ldhL-BR 36 48 31 LY8561 / ldhL-BR 30 42 46

[0108] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. An Escherichia coli LY8561, characterized in that, The preservation number of the Escherichia coli LY8561 is CCTCC NO: M 20241854.

2. A recombinant bacterium that efficiently hydrolyzes cell oligosaccharides, characterized in that, The recombinant bacteria uses Escherichia coli LY8561 as the host according to claim 1, and overexpresses the fusion protein of outer membrane protein C and cellulase in Escherichia coli LY8561.

3. The recombinant bacteria according to claim 2, characterized in that, The fusion protein of outer membrane protein C and cellulase is expressed under the regulation of the tac promoter.

4. The recombinant bacteria according to claim 2, characterized in that, The gene sequence encoding the cellulase is shown in SEQ ID NO.1, and the gene sequence encoding the outer membrane protein C is shown in SEQ ID NO.

2.

5. The use of the recombinant bacteria according to any one of claims 2-4 in hydrolyzed fiber oligosaccharides.

6. A recombinant *Escherichia coli* strain that utilizes fiber oligosaccharides to produce high levels of lactic acid, characterized in that... The recombinant Escherichia coli constructs a first expression frame and a second expression frame in the Escherichia coli LY8561 of claim 1, wherein the first expression frame includes a temperature-controlled promoter, a gene encoding lactate dehydrogenase, and a gene encoding a fusion protein of outer membrane protein C and cellulase, and the second expression frame includes a tac promoter and a gene encoding a fusion protein of outer membrane protein C and cellulase.

7. The recombinant Escherichia coli according to claim 6, characterized in that, The lactate dehydrogenase has the NCBI number BF29_3038. The temperature-controlled promoter includes a λ-phage PR-PL promoter controlled by the temperature-sensitive repressor protein CI857. The first expression cassette uses plasmid pPL451 as a vector. The gene encoding lactate dehydrogenase and the gene encoding the fusion protein of outer membrane protein C and cellulase are located downstream of the temperature-controlled promoter.

8. A method for high lactic acid production using fiber oligosaccharides, characterized in that, The method involves inoculating the recombinant Escherichia coli according to claim 6 or 7 into a fermentation medium with cellulosic acid as the sole carbon source to obtain the lactic acid.

9. The method according to claim 8, characterized in that, The fermentation culture includes an aerobic stage and an anaerobic stage. The dissolved oxygen saturation of the aerobic stage is between 25% and 35%, and the temperature of the aerobic stage is 30-35°C. The dissolved oxygen saturation of the anaerobic stage is less than 0.1%, and the temperature of the anaerobic stage is 40-45°C.

10. The method according to claim 8, characterized in that, The concentration of the cellulose oligosaccharide is 10-100 g / L.

Images