The invention relates to a method for synthesizing Cap2 structure 5apos; combinations and methods of capped RNA
By using a combination of tetranucleotide cap analogs and T7 RNA polymerase promoter sequences, the problems of low Cap2 capping rate and high cost were solved, efficient and economical Cap2 mRNA synthesis was achieved, and the safety and efficacy of mRNA were improved.
Patent Information
- Application Number
- CN202411750439.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2044-11-29
AI Technical Summary
The existing technology lacks a low-cost and efficient Cap2 capping method. The Cap2 capping rate is low, the preparation is complex and the cost is high, which limits the advancement of Cap2 mRNA in basic research and application development.
A combination of a tetranucleotide cap analogue and a T7 RNA polymerase promoter sequence is used to form an efficient Cap2 structure 5'-capped RNA by in vitro transcription. The tetranucleotide cap analogue is used to form a transcription initiation combination with a DNA template, and the transcription reaction is carried out in the presence of T7 RNA polymerase.
The efficient synthesis of Cap2-capped RNA was achieved, the capping rate was increased, the production cost was reduced, and the safety and effectiveness of mRNA were improved.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biochemistry and genetic engineering technology, and relates to a tetranucleotide cap analog, a transcription initiation combination containing the same, and applications thereof, and relates to a method for preparing 5'-capped RNA by combining a tetranucleotide cap analog and a transcription initiation sequence, specifically, performing in vitro transcription by combining a specific tetranucleotide cap structure analog and a T7 promoter sequence. Background Art
[0002] The cap structure is an important element at the 5′ end of mRNA and a decisive factor in the fate of RNA. Its function runs through the entire life cycle of the mRNA molecule, including the maturation of the mRNA molecule, the translational regulation of the coding region, and the resistance to degradation by host cell exonucleases. According to the number of 2'-hydroxymethylation of the nucleotides at the +1 / +2 position at the 5'-end of the mRNA, the cap structure without a 2'-hydroxymethyl group is a 0-type cap (Cap0), and those with 1 or 2 hydroxymethyl groups are respectively a 1-type cap (Cap1) and a 2-type cap (Cap2), which are also common capping forms in living cells. Among them, the development and establishment of the Cap1 capping method provides important guarantees for basic research and application development of mRNA, especially the development of the new crown mRNA vaccine uses Cap1 as the capping end point. The latest literature reports that Cap2 mRNA also has a high abundance and low immunogenicity in cells, suggesting that Cap2 mRNA also has important biological significance. However, the existing Cap2 capping strategy has disadvantages such as low capping rate, complex preparation and high cost, which seriously restricts the basic research and application development of mRNA centered on Cap2.
[0003] There are two ways to prepare mRNA in vitro: enzymatic capping and co-transcriptional capping. Enzymatic capping uses the capping system of the vaccinia virus vaccine, which requires a two-step enzymatic reaction. The introduction of additional enzymes and SAM makes the production process cumbersome. Co-transcriptional capping is the mainstream capping technology for mRNA therapy due to its high stability, low cost, and easy mass production. The main raw materials of the co-transcriptional capping method include cap structure analogs, T7 RNA polymerase, and a DNA template containing a T7 promoter sequence. T7 RNA polymerase is a key enzyme for synthesizing long-chain RNA and is highly specific to the T7 promoter. Commonly used T7 promoters include Φ6.5 (-1 to +3 is AGGG) and Φ2.5 (-1 to +3 is TAGG). The Φ6.5 promoter is more efficient and has a wider range of applications. The mRNA transcribed by the Φ2.5 promoter has better 5′ end homogeneity. T7 RNAP initiation of transcription depends on the sequence of the T7 promoter, among which the promoter -1, +1, and +2 sequences play an important role.
[0004] The development of cap structure analogs in co-transcriptional capping schemes has gone through three iterations: mCap, ARCA, and CleanCap. The capping rate has continued to increase, but competition between nucleotides and cap analogs still occurs during the initiation of T7 RNAP transcription. The uncapped 5' ppp-RNA byproducts produced during in vitro transcription not only lose their translational capacity, but also the triphosphate group at its 5' end is a key molecule for activating innate immune receptors such as RIG-I and MDA5, which can induce a significant immune response and reduce the safety and efficacy of mRNA. Therefore, the mRNA capping rate is one of the key indicators of mRNA molecule production quality, and improving the mRNA capping rate is particularly important for mRNA therapy.
[0005] Efficient production of Cap2-capped RNA remains a significant limitation in both basic research and applied development. TriLink utilizes oligonucleotide cap analogs for RNA capping (Patent Publication No. CN116751827B). Capping efficiencies for the various cap analogs used are as follows: A) m7G3'OmepppG = 79%; B) m7GpppG2'OmepG = 89%; C) m7G3'OmepppG2'OmepG = 87%; D) m7GpppA2'OmepG = 99%; E) m7G3'OmepppA2'OmepG = 99%; F) m7GpppC2'OmepG = 98%; G) m7G3'OmepppC2'OmepG = 97%; H) m7GpppA2'OmepG2'OmepG = 50%. (A-G) shows the capping efficiency of Cap1 analogs tested by Trilink, and (H) shows the capping efficiency of Cap2 analogs. The results show that the combination (D-G) achieves a high Cap1 capping efficiency, while the tested combination (H) only achieves a 50% Cap2 capping efficiency. Summary of the Invention
[0006] The present invention addresses the technical problem of the lack of a low-cost, efficient Cap2 capping method in the prior art. The invention provides a combination and method for synthesizing 5'-capped RNA with a Cap2 structure. The combination utilizes a transcription initiation combination containing a tetranucleotide cap analog and can be used for in vitro transcription of 5'-capped RNA.
[0007] The present invention solves the above technical problems through the following technical solutions.
[0008] The tetranucleotide cap analogs of the present invention are shown below:
[0009] A first aspect of the present invention provides a transcription initiation combination for synthesizing 5'-cap analog RNA, the transcription initiation combination comprising a tetranucleotide cap analog and a DNA template;
[0010] The tetranucleotide cap analog has a structure as shown in formula (I):
[0011]
[0012] Formula (I);
[0013] wherein B1, B2 and B3 are independently natural, modified or non-natural nucleoside bases; R1 and R2 are independently H, OH, CH3, O-CH3, O-CH2CH3, NH2, alkyne or azide groups and their derivatives;
[0014] The DNA template comprises a promoter sequence of T7 RNA polymerase, wherein -1, +1, +2 and +3 of the promoter sequence are natural or non-natural deoxynucleosides; and one or more nucleotides in the tetranucleotide cap analog are complementary to -1, +1, +2 and +3 positions of the DNA template.
[0015] In some embodiments, B1, B2, and B3 are independently natural, modified, or unnatural nucleobases; and R1 and R2 are independently OH or O-CH3.
[0016] In some embodiments, the DNA template comprises a promoter sequence of T7 RNA polymerase, as shown in formula (II); one or more nucleotides in the tetranucleotide cap analog complementarily pair with positions -1, +1, +2, and +3 of the DNA template;
[0017]
[0018] Formula (II);
[0019] Wherein Y is a natural deoxynucleoside, X is a natural deoxynucleoside, and X and Y are complementary pairs.
[0020] In the present invention, the sequence shown in the upper chain of the above-mentioned promoter is shown as SEQ ID NO: 9, and the sequence shown in the upper chain of the above-mentioned promoter is shown as SEQ ID NO: 10.
[0021] In some embodiments, B1, B2 and B3 in the tetranucleotide cap analog are complementary to the +1, +2 and +3 nucleotide bases of the promoter sequence in the DNA template, respectively; or, B2 and B3 in the tetranucleotide cap analog are complementary to the +1 and +2 nucleotide bases of the promoter sequence in the DNA template, respectively; or, B3 in the tetranucleotide cap analog is complementary to the +1 nucleotide base of the promoter sequence in the DNA template.
[0022] In some embodiments, in the tetranucleotide cap analog, R1 is O-CH3 or OH, and R2 is O-CH3 or OH.
[0023] In some embodiments, in the tetranucleotide cap analog, B1, B2, and B3 are natural nucleobases.
[0024] In some embodiments, in the tetranucleotide cap analog, B1, B2, and B3 are independently adenine, guanine, uracil, or cytosine.
[0025] In some embodiments, B1, B2, and B3 in the tetranucleotide cap acid analog are independently adenine or guanine.
[0026] In some embodiments, in the tetranucleotide cap analog, B1 is adenine, and B2 and B3 are guanine.
[0027] In some embodiments, in the tetranucleotide cap acid analog, B1 and B2 are adenine, and B3 is guanine.
[0028] In some embodiments, the -1 base of the promoter sequence in the DNA template is adenine or thymine, and the +1, +2, and +3 bases are natural bases.
[0029] In some embodiments, the -1 base of the promoter sequence in the DNA template is adenine, the +1 and +2 bases are adenine, and the +3 base is guanine.
[0030] In some embodiments, the -1 base of the promoter sequence in the DNA template is thymine, the +1 and +2 bases are adenine, and the +3 base is guanine.
[0031] In some embodiments, the -1 base of the promoter sequence in the DNA template is adenine, the +1 base is adenine, and the +2 and +3 bases are guanine.
[0032] In some embodiments, the -1 base of the promoter sequence in the DNA template is thymine, the +1 base is adenine, and the +2 and +3 bases are guanine.
[0033] In some embodiments, the promoter sequence in the DNA template is shown in any one of SEQ ID NOs: 1-4.
[0034] The second aspect of the present invention provides a kit, comprising: a tetranucleotide cap analog and RNA polymerase; the tetranucleotide cap analog can form the transcription initiation combination as described in the first aspect with a DNA template.
[0035] In some embodiments, the kit further comprises: NTPs, a buffer, and optionally a divalent metal ion.
[0036] In some preferred embodiments, the divalent metal ion is a magnesium ion.
[0037] In some preferred embodiments, the buffer is Tris-HCl buffer.
[0038] In some preferred embodiments, the NTP comprises GTP, ATP, CTP and UTP.
[0039] A third aspect of the present invention provides a method for improving RNA stability, comprising:
[0040] Incorporating a tetranucleotide cap analog into the RNA synthesis system; the tetranucleotide cap analog can form a transcription initiation combination as described in the first aspect with the DNA template;
[0041] Alternatively, the kit as described in the second aspect is reacted with a DNA template.
[0042] In some embodiments, the RNA synthesis system is an in vitro synthesis system.
[0043] The fourth aspect of the present invention provides a method for mRNA capping, which comprises performing a transcription reaction using the transcription initiation combination as described in the first aspect in the presence of T7 RNA polymerase.
[0044] The fifth aspect of the present invention provides a use of the transcription initiation combination as described in the first aspect, or the kit as described in the second aspect, in in vitro RNA synthesis.
[0045] The present invention also provides a combination of tetranucleotides and their analogs and a T7 RNA polymerase promoter characteristic sequence, wherein the combination is selected from any one of the following groups:
[0046] Combination 1
[0047] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0048] 5'-TAATACGACTCACTATAAAG (SEQ ID NO: 1)
[0049] 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5)
[0050] Combination 2
[0051] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0052] 5'-TAATACGACTCACTATAAGG (SEQ ID NO: 2)
[0053] 3'-ATTATGCTGAGTGATATTCC (SEQ ID NO: 6)
[0054] Combination 3
[0055] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0056] 5'-TAATACGACTCACTATTAAG (SEQ ID NO: 3)
[0057] 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7)
[0058] Combination 4
[0059] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0060] 5'-TAATACGACTCACTATTAGG (SEQ ID NO: 4)
[0061] 3'-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8)
[0062] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0063] The reagents and raw materials used in the present invention are commercially available.
[0064] The positive progress effect of the present invention is:
[0065] The tetranucleotide cap analog of the present invention can be used for Cap2 capping, and the transcription initiation combination formed with the T7 promoter in the DNA template can efficiently and economically cap RNA, such as RNA in an in vitro synthesis system. BRIEF DESCRIPTION OF THE DRAWINGS
[0066] Figure 1 Schematic diagram of the combination of the tetranucleotide cap structure and promoter in this application.
[0067] Figure 2 for m7 Gppp( 2'OMe A)p( 2'OMe A) pG and m7 Gppp(2'OMe A)p( 2'OMe G) Capping efficiency results of in vitro transcribed mRNA using pG in combination with different T7 promoters.
[0068] Figure 3 for m7 Gppp( 2'OMe A) pG and m7 Gppp( 2'OMe A)p( 2'OMe A) Capping efficiency of in vitro transcribed mRNA using pG in combination with the corresponding T7 promoter. DETAILED DESCRIPTION
[0069] definition
[0070] As used herein, the terms "nucleic acid," "nucleotide sequence," or "nucleic acid sequence" refer to an oligonucleotide, a polynucleotide, or any fragment thereof, any ribose or deoxyribose derivative, and to naturally occurring or synthetic molecules containing natural and / or modified nucleotide residues and internucleotide linkers. These phrases also refer to DNA or RNA of natural (e.g., genomic) or synthetic origin, which may be single-stranded, double-stranded, triple-stranded, or quadruple-stranded and may represent a sense or antisense strand, or to any DNA-like or RNA-like material. With reference to a DNA sequence, an "RNA equivalent" consists of a linear nucleotide sequence identical to the reference DNA sequence, except that all or most occurrences of the nitrogenous base thymine are replaced by uracil, and the sugar backbone consists of ribose instead of 2'-deoxyribose. Additional optional nucleic acid backbones suitable for the methods and compositions provided herein include, but are not limited to, phosphorothioates, phosphoroselenoates, alkyl phosphotriesters, aryl phosphotriesters, alkyl phosphates, aryl phosphonates, phosphoboronates, morpholino nucleic acids (MNA), locked nucleic acids (LNA), peptide nucleic acids (PNA).
[0071] As used herein, the term "primer" or "oligonucleotide primer" refers to a ribose- or deoxyribose- or chimeric ribose / deoxyribose-oligonucleotide, single-stranded, naturally occurring or synthetic, and often comprising a sequence of about 2 to about 10 nucleotides, about 3 to about 8 nucleotides, or about 3 to about 5 nucleotides. An oligonucleotide primer may contain one or more modifying groups. An oligonucleotide primer may comprise RNA, DNA, and / or other modified nucleosides. A skilled artisan can design and prepare oligonucleotide primers suitable for transcribing a DNA template sequence.
[0072] As used herein, the term "tetranucleotide cap analog" is used interchangeably with "initial capped oligonucleotide tetramer primer" to refer to a tetranucleotide capped primer composed of natural or non-natural nucleotides containing a guanosine or any nucleoside analog with a methylation modification at the N7 position on the 5'-end. The tetranucleotide cap analog is a substrate for RNA polymerase, has an unmodified or open 3'-OH group, and can be extended by RNA polymerase by incorporating NTPs into the 3' end of the primer. It is capable of initiating in vitro transcription under the control of a promoter in a transcription system containing the necessary components (DNA template (e.g., DNA plasmid), RNA polymerase, nucleoside 5'-triphosphates, and a suitable buffer).
[0073] As used herein, the term "unsubstituted" or "unmodified" in the context of starting capped oligonucleotide primers and NTPs refers to starting capped oligonucleotide primers and NTPs that have not been modified.
[0074] As used herein, the term "modified initial capping oligonucleotide primer" refers to an initial capping oligonucleotide primer that contains one or more additional modification groups.
[0075] As used herein, the term "modifying group" refers to any chemical moiety that can be attached to an initiator primer at positions including, but not limited to, a sugar, a nucleoside base, a triphosphate bridge, and / or an internucleotide phosphate. The modifying group of the initiator capping oligonucleotide primer can be any group that is compatible with the process of transcription.
[0076] As used herein, the term "internucleotide linker" refers to one or more bonds joining two nucleosides of an oligonucleotide primer or nucleic acid and can be a natural phosphodiester linker or a modified linker.
[0077] As used herein, the term "label" or "detectable label" refers to any compound or combination of compounds that can be attached or otherwise associated with a molecule so that the molecule can be detected directly or indirectly by detecting the label. A detectable label can be a radioisotope (e.g., carbon, phosphorus, iodine, indium, sulfur, tritium, etc.), a mass isotope (e.g., H2, C13, or N15), a dye or fluorophore (e.g., cyanine, fluorescein, or coumarin), a hapten (e.g., biotin), or any other agent that can be detected directly or indirectly.
[0078] As used herein, the term "hybridization" or "specific hybridization" refers to the process of annealing an initial capped oligonucleotide primer to a DNA template under appropriately stringent conditions during a transcription reaction. Hybridization to DNA occurs via an initial capped oligonucleotide primer, which, in certain embodiments, is 3-10 nucleotides in length, including a 5'-5' inverted cap structure. Nucleic acid hybridization techniques are well known in the art.
[0079] As used herein, in the context of a complex of a starting capped oligonucleotide primer and a DNA template, the terms "complementary," "complementary," or "complementarity" refer to the standard Watson / Crick base pairing rules. For example, the sequence "5'-GACT-3'" is complementary to the sequence "3'-CTGA-5'." Certain non-natural or synthetic nucleotides may be included in the nucleic acids described herein; these include, but are not limited to, base- and sugar-modified nucleosides, nucleotides, and nucleic acids such as inosine, 7-deazaguanosine, 2'-O-methylguanosine, 2'-fluoro-2'-deoxycytidine, pseudouridine, locked nucleic acids (LNA), and peptide nucleic acids (PNA). Complementarity need not be perfect; duplexes may contain mismatched base pairs, degenerate or mismatched nucleotides. One skilled in the art can determine duplex stability empirically taking into account a variety of variables, including, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, the incidence of mismatched base pairs, ionic strength, components of the hybridization buffer, and reaction conditions.
[0080] Complementarity can be "complete" or "total," in which all nucleotide bases of the two nucleic acid chains match according to generally accepted base pairing rules, it can be "partial," in which only some of the nucleotide bases of the starting capping oligonucleotide primer match the DNA target according to generally accepted base pairing rules, or it can be "absent," in which none of the nucleotide bases of the two nucleic acid chains match according to generally accepted base pairing rules. The degree of complementarity between the starting capping oligonucleotide primer and the DNA template can have a significant impact on the hybridization strength and, accordingly, the reaction efficiency between the starting capping oligonucleotide and the DNA template. The term complementarity can also refer to the use of individual nucleotides. For example, one can indicate the complementarity of a particular nucleotide within an oligonucleotide to a nucleotide within the other chain, or its lack thereof (relative to or compared to the complementarity between the remainder of the starting capping oligonucleotide primer and the DNA chain).
[0081] As used herein, the term "complete," "total," or "perfect" complementarity means that every nucleotide base of the initial capping oligonucleotide primer is precisely matched to the DNA target according to generally accepted base pairing rules.
[0082] As used herein, the term "substantially complementary" refers to two sequences that hybridize under stringent hybridization conditions. Those skilled in the art will appreciate that substantially complementary sequences do not need to hybridize along their entire length. Specifically, substantially complementary sequences can comprise a continuous base sequence that does not hybridize with the target sequence, and can be positioned 3' or 5' side of a continuous base sequence that hybridizes with the target sequence under stringent hybridization conditions.
[0083] As used herein, the term "specific" when used in reference to the initial capping oligonucleotide primer sequence and its ability to hybridize to a DNA template is a sequence that has at least 50% sequence identity with a portion of the DNA template when the initial capping oligonucleotide primer is aligned with the DNA strand. Higher levels of sequence identity that may be preferred include at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, and most preferably 100% sequence identity.
[0084] As used herein, the term "nucleoside" includes all naturally occurring nucleosides, including all forms of nucleoside bases and furanosides found in nature. The most commonly found base rings in naturally occurring nucleosides are purine rings and pyrimidine rings. Naturally occurring purine rings include, for example, adenine, guanine and N6-methyladenine. Naturally occurring pyrimidine rings include, for example, cytosine, thymine, 5-methylcytosine, pseudouracil (pseudouracyl). Naturally occurring nucleosides, for example, include, but are not limited to, ribose, 2'-O-methyl or 2'-deoxyribose derivatives of adenosine, guanosine, cytidine, thymidine, uridine, inosine, 7-methylguanosine or pseudouridine.
[0085] As used herein, the terms "nucleoside analogs," "modified nucleosides," or "nucleoside derivatives" include nucleosides synthesized as described herein. Nucleoside derivatives also include nucleosides with modified bases or / and sugar moieties with or without protecting groups, and include, for example, 2'-deoxy-2'-fluorouridine, 5-fluorouridine, and the like. Compounds and methods provided herein include such base rings and synthetic analogs thereof, as well as non-natural heterocyclic substituted base sugars and acyclic substituted base sugars. Other nucleoside derivatives that may be used in the present invention include, for example, LNA nucleosides, halogen-substituted purines (e.g., 6-fluoropurine), halogen-substituted pyrimidines, N6-ethyladenine, N4-(alkyl)-cytosine, 5-ethylcytosine, and the like.
[0086] As used herein, the terms "universal base," "degenerate base," "universal base analog," and "degenerate base analog" include, for example, nucleoside analogs having an artificial base that, in certain embodiments, can be recognized by RNA polymerase as a replacement for one of the natural NTPs (e.g., ATP, UTP, CTP, and GTP) or another specific NTP.
[0087] As used herein, the term "modified NTP" refers to a nucleoside 5'-triphosphate having a chemical moiety attached at any position including the sugar, the base, the triphosphate linker, or any combination of these three positions.
[0088] As used herein, the term "modified oligonucleotide" includes, for example, oligonucleotides containing modified nucleosides, modified internucleotide linkers, or any combination of modified nucleosides and internucleotide linkers. Examples of modified internucleotide linkers of oligonucleotides include phosphorothioate, phosphotriester, and methylphosphonate derivatives.
[0089] As used herein, the term "promoter" refers to the region of the dsDNA template that instructs and controls the transcription initiation of a specific DNA sequence (e.g., gene). The promoter is located on the same chain and upstream (5' region near the sense strand) on the DNA. The promoter is generally adjacent to (or partially overlaps with) the DNA sequence to be transcribed. The nucleotide position in the promoter is specified (position+1) relative to the transcription initiation site where DNA transcription begins. The starting oligonucleotide primer is complementary to the initiation site of the promoter sequence (in some embodiments, at position+1 and+2, and in the case of starting tetramers, at position+1,+2, and+3).
[0090] As used herein, the term "transcription" or "transcription reaction" refers to methods known in the art for enzymatically preparing RNA complementary to a DNA template to produce multiple RNA copies of a DNA sequence. The RNA molecules synthesized in the transcription reaction are referred to as "RNA transcripts," "primary transcripts," or "transcripts." The transcription reactions involving the compositions and methods provided herein employ "initial capping oligonucleotide primers." Transcription of a DNA template can be exponential, nonlinear, or linear. The DNA template can be double-stranded linear DNA, partially double-stranded linear DNA, circular double-stranded DNA, a DNA plasmid, a PCR amplicon, or a modified nucleic acid template compatible with RNA polymerase.
[0091] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0092] The information of instruments and reagents used in the examples is shown in Table 1.
[0093] Table 1 Instrument and reagent information
[0094]
[0095] Example 1
[0096] like Figure 1 As shown, the molecular formula of the tetranucleotide is: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0097] The sequence of positions -17 to +3 of the T7 promoter coding chain:
[0098] 5'-TAATACGACTCACTATAAAG (SEQ ID NO: 1)
[0099] 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5)
[0100] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence from positions -17 to +3 of the template strand is 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5).
[0101] mRNA was prepared by in vitro transcription, and the reaction system was configured as shown in Table 2.
[0102] Table 2 In vitro transcription reaction system
[0103]
[0104] After mixing, react at 37°C for 2 hours, and then digest with DNase I for 30 minutes.
[0105] The samples were analyzed by electrophoresis on 18 (w / v)% polyacrylamide gel containing 8 M urea and 1× TBE. The gel was stained with SYBR GOLD and the grayscale of the capped and uncapped bands was analyzed using Image Lab.
[0106] Determination of capping rate formula 1: (gray value of capped RNA band) / [(gray value of capped RNA band) + (gray value of uncapped RNA band)]
[0107] The obtained mRNA was extracted with RNA extraction reagent and precipitated with isopropanol, and its concentration was determined.
[0108] The capping rate of the 5′-end short fragment released by Twister self-cleavage was further analyzed by LC-MS.
[0109] Calculation formula for determining capping efficiency: (peak intensity of capped RNA) / [(peak intensity of capped RNA) + (peak intensity of uncapped RNA)]
[0110] The capping efficiency of mRNA prepared by in vitro transcription using a promoter sequence with TAATACGACTCACTATAAAG (SEQ ID NO: 1) at positions -17 to +3 in combination with AAGCap2 was approximately 99%.
[0111] Example 2
[0112] The molecular formula of tetranucleotide is: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0113] The sequence of positions -17 to +3 of the T7 promoter coding chain:
[0114] 5'-TAATACGACTCACTATAAGG (SEQ ID NO: 2)
[0115] 3'-ATTATGCTGAGTGATATTCC (SEQ ID NO: 6)
[0116] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence from positions -17 to +3 of the template strand is 3'-ATTATGCTGAGTGATATTCC (SEQ ID NO: 6).
[0117] Referring to the method of Example 1, the capping rate of mRNA prepared by in vitro transcription using a promoter sequence with positions -17 to +3 of TAATACGACTCACTATAAGG (SEQ ID NO: 2) in combination with AAG Cap2 was 98%.
[0118] Example 3
[0119] The molecular formula of tetranucleotide is: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0120] The sequence of positions -17 to +3 of the T7 promoter coding chain:
[0121] 5'-TAATACGACTCACTATTAAG (SEQ ID NO: 3)
[0122] 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7)
[0123] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence from positions -17 to +3 of the template strand is 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7).
[0124] mRNA was prepared by in vitro transcription according to the method of Example 1. The capping rate of mRNA prepared by in vitro transcription using a combination of a promoter sequence with positions -17 to +3 of TAATACGACTCACTATTAAG (SEQ ID NO: 3) and AAG Cap2 was 92%.
[0125] Example 4
[0126] The molecular formula of tetranucleotide is: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0127] The sequence of positions -17 to +3 of the T7 promoter coding chain:
[0128] 5'-TAATACGACTCACTATTAGG (SEQ ID NO: 4)
[0129] 3'-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8)
[0130] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence from positions -17 to +3 of the template strand is 3'-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8).
[0131] mRNA was prepared by in vitro transcription according to the method of Example 1. The capping rate of mRNA prepared by in vitro transcription using a combination of a promoter sequence with positions -17 to +3 of TAATACGACTCACTATTAGG (SEQ ID NO: 4) and AAG Cap2 was 68%.
[0132] The results of the above examples are as follows Figure 2 and Figure 3 shown.
[0133] References:
[0134] 1. Despic, V. & Jaffrey, SR mRNA ageing shapes the Cap2 methylomein mammalian mRNA. Nature 614, 358–366 (2023).
[0135] 2. Drazkowska, K. et al. 2’-O-Methylation of the second transcribednucleotide within the mRNA 5’ cap impacts the protein production level in acell-specific manner and contributes to RNA immune evasion. Nucleic AcidsRes. 50, 9051–9071 (2022).
[0136] 3. Rosa, S. S., Prazeres, D. M. F., Azevedo, A. M. & Marques, M. P.C. mRNA vaccines manufacturing: Challenges and bottlenecks. Vaccine 39, 2190–2200 (2021).
[0137] 4. Henderson, J. M. et al. Cap 1 Messenger RNA Synthesis with Co-transcriptional CleanCap® Analog by In Vitro Transcription. Curr. Protoc. 1,e39 (2021).
[0138] 5. Inagaki, M. Cap analogs with a hydrophobic photocleavable tagenable facile purification of fully capped mRNA with various cap structures.Nat. Commun. (2023).
[0139] 6. Linares-Fernández, S. et al. Combining an optimized mRNA templatewith a double purification process allows strong expression of in vitrotranscribed mRNA. Mol. Ther. - Nucleic Acids 26, 945–956 (2021).
[0140] 7. Li, S. et al. The mitochondrial protein ERAL1 suppresses RNA virusinfection by facilitating RIG-I-like receptor signaling. Cell Rep. 34,(2021).
[0141] 8. Rehwinkel, J. & Gack, M. U. RIG-I-like receptors: their regulationand roles in RNA sensing. Nat. Rev. Immunol. 20, 537–551 (2020).
[0142] 9. Moradian, H., Roch, T., Anthofer, L., Lendlein, A. & Gossen, M.Chemical modification of uridine modulates mRNA-mediated proinflammatory andantiviral response in primary human macrophages. Mol. Ther. - Nucleic Acids27, 854–869 (2022)。
Claims
1. A transcription initiation combination for synthesizing 5'-cap structure RNA, characterized in that: The transcription initiation assembly comprises a tetranucleotide cap analog and a DNA template; The tetranucleotide cap analog has a structure as shown in formula (I): Formula (I); wherein B1, B2 and B3 are independently natural, modified or non-natural nucleoside bases; R1 and R2 are independently OH or O-CH3; The DNA template comprises a promoter sequence of T7 RNA polymerase, as shown in formula (II); one or more nucleotides in the tetranucleotide cap analog are complementary to positions -1, +1, +2 and +3 of the DNA template; Formula (II); Wherein Y is a natural deoxynucleoside, X is a natural deoxynucleoside, and X and Y are complementary pairs.
2. The transcription initiation combination according to claim 1, wherein B1, B2 and B3 in the tetranucleotide cap analog are complementary to the +1, +2 and +3 nucleotide bases of the promoter sequence in the DNA template, respectively; or, B2 and B3 in the tetranucleotide cap analog are complementary to the +1 and +2 nucleotide bases of the promoter sequence in the DNA template, respectively; or, B3 in the tetranucleotide cap analog is complementary to the +1 nucleotide base of the promoter sequence in the DNA template.
3. The transcription initiation combination according to claim 1 or 2, wherein In the tetranucleotide cap analog, R1 is O-CH3 or OH, and R2 is O-CH3 or OH.
4. The transcription initiation combination according to any one of claims 1 to 3, wherein In the tetranucleotide cap analog, B1, B2 and B3 are natural nucleoside bases.
5. The transcription initiation combination according to any one of claims 1 to 4, wherein In the tetranucleotide cap analog, B1, B2 and B3 are independently adenine, guanine, uracil or cytosine.
6. The transcription initiation combination according to any one of claims 1 to 5, characterized in that In the tetranucleotide cap acid analog, B1, B2 and B3 are independently adenine or guanine.
7. The transcription initiation combination according to any one of claims 1 to 6, wherein In the tetranucleotide cap acid analog, B1 is adenine, and B2 and B3 are independently adenine or guanine.
8. The transcription initiation combination according to any one of claims 1 to 7, wherein In the tetranucleotide cap acid analog, B1 and B2 are adenine, and B3 is guanine.
9. The transcription initiation combination according to any one of claims 1 to 7, wherein In the tetranucleotide cap acid analog, B1 is adenine, and B2 and B3 are guanine.
10. The transcription initiation combination according to any one of claims 1 to 9, wherein The -1 base of the promoter sequence in the DNA template is adenine or thymine, and the +1, +2 and +3 bases are natural bases.
11. The transcription initiation combination according to any one of claims 1 to 10, wherein The -1 base of the promoter sequence in the DNA template is adenine, the +1 and +2 bases are adenine, and the +3 base is guanine.
12. The transcription initiation combination according to any one of claims 1 to 10, wherein The -1 base of the promoter sequence in the DNA template is thymine, the +1 and +2 bases are adenine, and the +3 base is guanine.
13. The transcription initiation combination according to any one of claims 1 to 10, wherein The -1 base of the promoter sequence in the DNA template is adenine, the +1 base is adenine, and the +2 and +3 bases are guanine.
14. The transcription initiation combination according to any one of claims 1 to 10, wherein The -1 base of the promoter sequence in the DNA template is thymine, the +1 base is adenine, and the +2 and +3 bases are guanine.
15. A kit, characterized in that The kit comprises: a tetranucleotide cap analog and RNA polymerase; the tetranucleotide cap analog can form the transcription initiation combination according to any one of claims 1 to 14 with a DNA template.
16. The kit according to claim 15, wherein The kit further comprises: NTP, buffer, and optionally divalent metal ions; Preferably, the divalent metal ion is a magnesium ion; and / or the buffer is a Tris-HCl buffer; and / or the NTP comprises GTP, ATP, CTP and UTP.
17. A method for improving RNA stability, characterized in that: The method comprises: Incorporating a tetranucleotide cap analog into the RNA synthesis system; the tetranucleotide cap analog can form a transcription initiation combination according to any one of claims 1 to 14 with the DNA template; Alternatively, the kit according to claim 15 or 16 is reacted with a DNA template.
18. The method according to claim 17, wherein The RNA synthesis system is an in vitro synthesis system.
19. A method for mRNA capping, comprising performing a transcription reaction using the transcription initiation combination according to any one of claims 1 to 14 in the presence of T7 RNA polymerase.
20. Use of the transcription initiation combination according to any one of claims 1 to 14, or the kit according to claim 15 or 16, in in vitro RNA synthesis.
Citation Information
Patent Citations
Compositions and methods for synthesizing 5'-capped RNA
CN116751827B
Compositions and methods for synthesizing 5'-capped rnas
CN108366604A
Methods and compositions for increasing capping efficiency of transcribed RNA
CN113166737A
Cap2 structure 5' hat analogue and preparation method and application thereof
CN113337559A
Kits and methods for generating 5' capped RNA
US20070281336A1
Cited By
Efficient in vitro transcription of artificial mRNA with highly modified 5' ends
WO2026078020A3