Detection system for improving CRISPR (clustered regularly interspaced short palindromic repeats) detection technology specificity through Blocker sequence and application of detection system

Abstract

The invention relates to the technical field of CRISPR detection, in particular to a detection system for improving CRISPR detection technology specificity through a Blocker sequence and application of the detection system, guide RNA specifically designed for a target sequence and the corresponding Blocker sequence are added into a CRISPR system, the Blocker sequence is competitively combined with the guide RNA, and the CRISPR system further comprises Cas protein, a nucleic acid probe and a buffer solution. On the basis of high sensitivity and high specificity of a CRISPR molecular diagnosis system, a Blocker sequence is introduced to compete with guide RNA to be combined with a wild type site sequence, so that the specificity of CRISPR detection of the SNP sites is further improved, and the workload of introducing extra mutation site screening when the guide RNA detects the SNP sites is reduced.

Description

Technical Field

[0001] The present invention relates to the field of CRISPR detection technology, and specifically to a detection system and its application for improving the specificity of CRISPR detection technology through Blocker sequences. Background Art

[0002] Mycobacterium tuberculosis complex (MTBC), the pathogen that causes tuberculosis (TB), faces drug resistance, a major global public health challenge. Traditional TB treatment relies on first-line anti-TB drugs, primarily isoniazid and rifampicin. However, the widespread spread of drug-resistant MTBC in recent years has significantly reduced drug efficacy. Drug resistance in MTBC is primarily caused by genetic mutations. For example, mutations in the rpoB gene confer rifampicin resistance, while mutations in the katG and inhA genes are associated with isoniazid resistance.

[0003] While existing detection technologies such as phenotypic drug susceptibility testing and qPCR molecular diagnostics (e.g., GeneXpert MTB / RIF) can detect drug-resistance mutations, they also have limitations. Phenotypic drug susceptibility testing is time-consuming, prone to contamination, and requires advanced laboratories and culture equipment. While qPCR molecular diagnostics offer advantages such as shorter detection times and higher sensitivity, they generally rely on expensive testing platforms and reagent costs. Summary of the Invention

[0004] The purpose of the present invention is to provide a detection system and application thereof for improving the specificity of CRISPR detection technology through Blocker sequences.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] A detection system that enhances the specificity of CRISPR detection technology through blocker sequences, specifically comprising: adding a guide RNA specifically designed for a target sequence and a corresponding blocker sequence to the CRISPR system, wherein the blocker sequence competitively binds to the guide RNA. The CRISPR system also includes a Cas protein, a nucleic acid probe, and a buffer.

[0007] Furthermore, the guide RNA is used to specifically detect point mutations in the target sequence.

[0008] Furthermore, the blocker sequence is fully complementary or partially complementary to the guide sequence in the guide RNA; the blocker is a DNA sequence or an RNA sequence or a derivative thereof, and the derivative includes LNA, PNA, ANA, BNA, CeNA, FANA, GNA, HNA, morpholino nucleic acid or TNA.

[0009] Furthermore, the Cas protein is a type 2 V or type 2 VI Cas protein; the type V Cas protein includes a Cas12 protein; and the type VI Cas protein includes a Cas13 protein.

[0010] Furthermore, the length of the Blocker is 5-40 nt, and the ratio of Blocker to guide RNA is 1:1-100:1; one or more mutation sites can be introduced into the Blocker sequence to enhance the ability of the guide RNA to specifically target the point mutation sequence.

[0011] Furthermore, the target gene is the rpoB gene, and the drug resistance sites are the 511th and 531st drug resistance sites of the rpoB gene.

[0012] Furthermore, the crRNA sequence is shown in SEQ ID NO: 3-4.

[0013] Furthermore, the Blocker sequence is shown in SEQ ID NO: 5-6.

[0014] The above-mentioned detection system of the present invention that improves the specificity of CRISPR detection technology by using Blocker sequences can be used to prepare a kit for detecting drug resistance of Mycobacterium tuberculosis complex.

[0015] A kit for improving the specificity of CRISPR detection technology through Blocker sequences, including a guide RNA specifically designed for the target sequence and the corresponding Blocker sequence, Cas protein, nucleic acid probe, amplification system and buffer.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) Based on the high sensitivity and specificity of the CRISPR molecular diagnostic system, the present invention introduces a Blocker sequence to compete with the guide RNA for binding to the wild-type site sequence, thereby further improving the specificity of CRISPR detection of SNP sites and reducing the workload of the guide RNA introducing additional mutation site screening when detecting SNP sites.

[0018] (2) The present invention has the advantages of rapidity, high sensitivity and specificity, and low reagent cost, which is of great significance for accelerating the early diagnosis and treatment decision-making of drug-resistant tuberculosis, reducing the misdiagnosis rate and medical costs, and improving the accessibility of diagnosis in resource-poor areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the detection result of the drug resistance site 511 (L511P) of the rpoB gene.

[0020] Figure 2 This is the detection result of the drug resistance site 531 (S531L) of the rpoB gene. DETAILED DESCRIPTION

[0021] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0022] Example Detection of drug resistance sites in the rpoB gene of Mycobacterium tuberculosis complex (MTBC)

[0023] 1. Design of PCR primers for rpoB gene

[0024] Mutations in the rifampin resistance determining region (RRDR) of the rpoB gene (GenBank Accession No.: U12205.1) of Mycobacterium tuberculosis complex can lead to rifampicin resistance. Therefore, to detect resistance sites in the rpoB gene, PCR primers must be designed to amplify the entire rpoB resistance determining region. The rpoB gene PCR primer sequences (SEQ ID NOs: 1-2) designed based on this requirement are shown in Table 1 below.

[0025] Table 1 rpoB PCR primer sequences

[0026]

[0027] 2. Design of crRNA and Blocker for the rpoB gene resistance site

[0028] LbCas12a crRNA was designed for the drug-resistant sites 511 (L511P, CTG>CCG) and 531 (S531L, TCG>TTG) of the rpoB gene for specific detection of rpoB site mutations. In order to improve the specificity of CRISPR detection of SNPs, additional mutation sites were introduced during crRNA design. The specific crRNA sequences (SEQ ID NOs: 3-4) are shown in Table 2 below.

[0029] Table 2 crRNA sequences of drug resistance sites at positions 511 (L511P) and 531 (S531L) of the rpoB gene

[0030] rpoB gene resistance site crRNA name Sequence name (5'-3') rpoB-511C-crRNA AATTTCTACTGTTGTAGATGGCACCAGTCAGGCGAGCCA rpoB-531T-crRNA AATTTCTACTGTTGTAGATCTGTTGGCGCTGGGGTCCCG

[0031] Note: The underlined part is the spacer sequence.

[0032] Since CRISPR detection of SNPs generally requires crRNA to introduce additional mutation sites, and due to differences in SNP site sequences, even extensive screening tests can fail to identify crRNAs with optimal specificity. The present invention introduces a Blocker sequence (SEQ ID NOs: 5-6) that competes with crRNA for binding to the wild-type site sequence, thereby improving the specificity of crRNA for SNP detection and reducing the workload of screening for additional mutation sites introduced by crRNA.

[0033] Table 3 Blocker sequences of rpoB gene resistance sites

[0034] rpoB gene resistance site Blocker name Sequence name (5'-3') rpoB-511C-Blocker TTCGGCACCAGCCAGCTGGG rpoB-531T-Blocker CACAAGCGCCGACTGTCGGA

[0035] 3. Detection of drug resistance sites in the rpoB gene

[0036] (1) PCR amplification of rpoB gene

[0037] The rpoB PCR amplification reaction system was prepared according to Table 4 below. The PCR templates were 1000 copies / μL of the wild-type rpoB plasmid and 1000 copies / μL of a plasmid containing the drug-resistance mutations at positions 511 (L511P) and 531 (S531L) of the rpoB gene. The plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The 2× Magic Green Taq SuperMix (21502) used was from Anhui Tolo Port Biotechnology Co., Ltd.

[0038] Table 4 rpoB gene PCR amplification reaction system

[0039] Reagent name Volume (μL) 2×Magic Green Taq SuperMix 2 rpoB-F (10 μM) 1 rpoB-R (10 μM) 1 Nuclease-free water 11 template 5 total 20

[0040] PCR reaction program: 95°C for 3 min, 1 cycle; 95°C for 15 s, 60°C for 15 s, for a total of 40 cycles.

[0041] (2) CRISPR detection of drug resistance sites at positions 511 (L511P) and 531 (S531L) of the rpoB gene

[0042] The CRISPR detection systems for the drug resistance sites at position 511 (L511P) and position 531 (S531L) of the rpoB gene were prepared according to Tables 5 and 6 below, respectively, wherein LbCas12a (32108) and HOLMES-Fluo ssDNA repoter 1 (31101) were from Anhui Tolo Port Biotechnology Co., Ltd., and rpoB-511C-crRNA, rpoB-511C-Blocker, rpoB-531T-crRNA and rpoB-531T-Blocker were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0043] Table 5 Detection of drug resistance site at position 511 (L511P) of rpoB gene

[0044] Reagent name Volume (μL) 10×HOLMES Buffer for Cas12a 2 LbCas12a (10 μM) 0.2 rpoB-511C-crRNA (1 μM) 0.5 rpoB-511C-Blocker (10 μM) 0.5 / 0 HOLMES-Fluo ssDNA repoter 1 (10μM, FAM) 1 Nuclease-free water 13.8 / 14.3 PCR amplification products 2 total 20

[0045] Reaction conditions: 48°C, 20 min, signal acquisition every 1 min.

[0046] Table 6 Detection of drug resistance site 531 (S531L) of rpoB gene

[0047] Reagent name Volume (μL) 10×HOLMES Buffer for Cas12a 2 LbCas12a (10 μM) 0.2 rpoB-531T-crRNA (1 μM) 0.5 rpoB-531T-Blocker (10μM) 0.5 / 0 HOLMES-Fluo ssDNA repoter 1 (10μM, FAM) 1 Nuclease-free water 13.8 / 14.3 PCR amplification products 2 total 20

[0048] Reaction conditions: 48°C, 20 min, signal acquisition every 1 min.

[0049] according to Figure 1-2 It can be seen that when CRISPR detection of the drug resistance site 511 (L511P) of the rpoB gene is performed, the addition of rpoB-511C-Blocker can significantly improve the specificity of rpoB-511C-crRNA in detecting the wild-type rpoB. Similarly, the addition of rpoB-531T-Blocker also significantly reduces the specificity of rpoB-531T-crRNA in detecting the wild-type rpoB.

[0050] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A detection system that enhances the specificity of CRISPR detection technology through blocker sequences, characterized by: A guide RNA specifically designed for the target sequence and a corresponding Blocker sequence are added to the CRISPR system, wherein the Blocker sequence competitively binds to the guide RNA. The CRISPR system also includes a Cas protein, a nucleic acid probe, and a buffer.

2. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The guide RNA is used to specifically detect point mutations in the target sequence.

3. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The blocker sequence is fully complementary or partially complementary to the guide sequence in the guide RNA; the blocker is a DNA sequence or an RNA sequence or a derivative thereof, and the derivative includes LNA, PNA, ANA, BNA, CeNA, FANA, GNA, HNA, morpholino nucleic acid or TNA.

4. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The Cas protein is a type 2 V or type 2 VI Cas protein; the type V Cas protein includes a Cas12 protein; the type VI Cas protein includes a Cas13 protein.

5. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The length of the blocker is 5-40 nt, and the ratio of blocker to guide RNA is 1:1-100:1; one or more mutation sites can be introduced into the blocker sequence to enhance the ability of the guide RNA to specifically target the point mutation sequence.

6. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The target gene is the rpoB gene, and the drug resistance sites are the 511th and 531st drug resistance sites of the rpoB gene.

7. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The guide RNA sequence is shown in SEQ ID NO: 3-4.

8. The detection system for enhancing the specificity of CRISPR detection technology by using blocker sequences according to claim 1, characterized in that: The Blocker sequence is shown in SEQ ID NO: 5-6.

9. Use of the detection system according to any one of claims 1 to 8 in the preparation of a kit for detecting drug resistance of Mycobacterium tuberculosis complex.

10. A kit for improving the specificity of CRISPR detection technology through blocker sequences, characterized by: It includes guide RNA specifically designed for the target sequence and the corresponding Blocker sequence, Cas protein, nucleic acid probe, amplification system and buffer.

Images