Wheat snp breeding chip and application thereof

Abstract

The application discloses a wheat SNP breeding chip and application thereof. The application provides a chip for detecting wheat genotypes, which comprises reagents for specifically detecting 5286 SNP sites in table 1 and reagents for specifically detecting 134 indel sites in table 2; the position information of the 5286 SNP sites in table 1 and the 134 indel sites in table 2 is determined by alignment based on a wheat genome reference sequence, wherein the wheat genome reference sequence is the whole genome sequence of a wheat variety Zhongnongchun, and the version number is IWGSC RefSeq2.1. Compared with previous wheat chips, the chip has the characteristics of high site representation, rich diversity information and uniform marker distribution, is more flexible, has higher detection rate, better repeatability and lower application cost.

Description

Technical Field

[0001] This invention relates to the field of gene chip technology, specifically to a wheat SNP breeding chip and its application. Background Technology

[0002] Wheat is one of the world's most important food crops, and improving its yield, quality, disease resistance, and other agronomic traits is crucial for ensuring global food security. Traditional wheat breeding methods mainly rely on phenotypic selection, which is time-consuming, inefficient, and has limited accuracy. With the development of molecular biology techniques, marker-assisted breeding (MAS) has emerged, which can select for target traits at the genomic level, greatly improving the precision and efficiency of breeding.

[0003] Breeding microarrays, as high-throughput molecular marker detection tools, have been widely used in crop breeding. The wheat genome is large and complex, and developing high-density, low-cost, and high-accuracy breeding microarrays suitable for wheat breeding is of great value in advancing wheat genetic breeding research and the selection of new varieties. Currently, although some wheat breeding microarrays exist, they still suffer from problems such as uneven marker distribution, incomplete coverage of functional genes, and high costs. Therefore, there is an urgent need to develop a more optimized 5K wheat breeding microarray. Summary of the Invention

[0004] The purpose of this invention is to provide a wheat SNP breeding chip and its application.

[0005] Firstly, the present invention claims protection for a chip used to detect wheat genotypes.

[0006] This invention claims protection for a chip used to detect wheat genotypes, which may include:

[0007] (A1) Reagents for specific detection of SNP sites; the SNP sites are the 5286 SNP sites in Table 1;

[0008] (A2) Reagents for specific detection of indel sites; the indel sites are the 134 indel sites listed in Table 2;

[0009] The location information of the 5286 SNP sites in Table 1 and the 134 indel sites in Table 2 were determined by comparison with the wheat genome reference sequence, which is the whole genome sequence of the wheat variety Chinese Spring, version number IWGSC RefSeq2.1.

[0010] The target location information mentioned below was also determined by comparison with the wheat genome reference sequence (IWGSC RefSeq2.1).

[0011] Furthermore, the reagent is a probe. In some embodiments of the present invention, the probe is a double-stranded DNA probe.

[0012] Furthermore, in (A1), there are a total of 5286 probes; for each SNP site, a target site is selected within a 120bp range upstream and downstream of the location of the SNP site on the wheat genome reference sequence, the target site covers the SNP site, and a probe is designed for the target site, the nucleotide sequence of the probe being the same as or reverse complementary to the nucleotide sequence of the target site.

[0013] Furthermore, in (A2), there are a total of 134 probes; for each indel site, a target site is selected within a 120bp range upstream and downstream of the indel site on the wheat genome reference sequence, the target site covers the indel site, and a probe is designed for the target site, the nucleotide sequence of the probe being the same as or reverse complementary to the nucleotide sequence of the target site.

[0014] In this invention, the probe is a 120bp nucleotide sequence with a GC content closest to 45% within 120bp to the left and right of the SNP site and the indel site as the center. That is, the probe length is 120bp (or 120nt).

[0015] In some implementations, in (A1), the start and end positions of the target point corresponding to each of the 5286 probes are shown in Table 1. The 5286 probes include the probe shown in SEQ ID No. 1.

[0016] In some implementations, in (A2), the start and end positions of the target point corresponding to each of the 134 probes are shown in Table 2. The 134 probes include the probe shown in SEQ ID No. 2.

[0017] It should be noted that, given the reference genome and its version number, and the specific location of the target site within it, obtaining the specific sequence information of each probe is very easy for those skilled in the art. Due to space limitations, the specific sequence information of each probe is not presented visually in this article.

[0018] Furthermore, the probe may be modified with biotin.

[0019] In one embodiment of the present invention, the probe is coupled to a fluorescent microsphere via a C12 molecular arm and amino modification; each fluorescent microsphere is coupled with one type of probe.

[0020] In this invention, the chip is a liquid-phase probe hybridization chip.

[0021] Secondly, the present invention claims protection for a kit for detecting wheat genotypes.

[0022] This invention claims protection for a kit for detecting wheat genotypes, comprising the chip and streptavidin-encapsulated magnetic beads described in the first aspect above.

[0023] Thirdly, the present invention claims protection for probe sets used to detect wheat genotypes.

[0024] The probe set for detecting wheat genotypes claimed in this invention consists of the probes for specifically detecting SNP sites described in (A1) of the first aspect above and the probes for specifically detecting indel sites described in (A2).

[0025] Fourthly, the present invention claims protection for the use of the chip described in the first aspect above, the kit described in the second aspect above, the probe set described in the third aspect above, or the substance for detecting the SNP site described in (A1) and the indel site described in (A2) of the first aspect above, in any of the following:

[0026] (B1) Detection of wheat genotypes;

[0027] (B2) Analysis of wheat genetic diversity;

[0028] (B3) Construction of a molecular genetic map of wheat;

[0029] (B4) Marker-Assisted Selection Breeding of Wheat;

[0030] (B5) Authenticity verification of wheat varieties;

[0031] (B6) Wheat whole-genome selection breeding.

[0032] Fifthly, the present invention claims a method for detecting wheat genotypes.

[0033] The method for detecting wheat genotype claimed in this invention may include the following steps: hybridizing the genomic DNA of the wheat to be tested with the chip described in the first aspect above to obtain a hybridization capture library; and then sequencing the obtained hybridization capture library to obtain the genotype of the wheat to be tested.

[0034] Furthermore, the conditions for carrying out the hybridization reaction can be: incubation at 65°C for 16 hours.

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0036] 1. High site representativeness and rich diversity information

[0037] The markers used in the wheat 5K breeding chip provided by this invention are derived from large-sample, high-density gene chips, resequencing data, and all currently publicly available resequencing data. The background of these data covers major wheat varieties (local, wild, or cultivated) in various regions globally (spring and winter wheat regions). It covers genes or QTLs (quantitative trait loci) related to important agronomic traits of wheat, such as those related to yield, disease resistance, and quality.

[0038] 2. Locus markers are evenly distributed throughout the genome.

[0039] The wheat 5K breeding chip marker design provided by this invention is optimized so that the markers are evenly distributed on the 21 chromosomes of wheat, with each chromosome containing approximately 260 SNP markers and / or indel markers.

[0040] 3. The results are accurate, stable, and have a good detection rate.

[0041] The detection rate of wheat 5K breeding chip marker sites provided by this invention exceeds 99%.

[0042] 4. Lower price, suitable for large-scale molecular identification of materials.

[0043] The wheat 5K breeding chip provided by this invention contains genome-wide polymorphic genetic background loci, functional linkage loci, and variety authenticity identification loci. Its price is 30% lower than other products with similar performance, which greatly reduces the cost of molecular-assisted breeding and can be applied on a large scale for breeding detection.

[0044] In summary, the wheat 5K breeding chip provided by this invention contains specific combinations of SNPs and indel markers, enabling rapid and effective tracking of wheat genetic information. This facilitates faster wheat breeding processes and improves the efficiency of new variety selection. Compared with previous wheat chips, this invention features high locus representativeness, rich diversity information, and uniform marker distribution. The chip is also more flexible, boasts a higher detection rate, and lower application costs. Attached Figure Description

[0045] Figure 1 This is a statistical graph showing the number of probes and chromosome length at SNP / indel sites in this invention.

[0046] Figure 2 This is a statistical diagram showing the distribution of SNP / indel sites on chromosomes according to the present invention. Detailed Implementation

[0047] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0049] Example 1: Preparation of the 5K wheat breeding chip of the present invention

[0050] I. Selection of SNP sites and / or indel site combinations on the chip and preparation of corresponding probes

[0051] 1. Screening for wheat 5K SNP sites and / or indel sites;

[0052] (1) Based on the gene chip of 500 wheat germplasms at 50K and reported resequencing data (Hao CY, Jiao CZ, Hou J, Li T, Liu HX, Wang YQ, Zheng J, Liu H, Bi ZH, Xu FF, Zhao J, Ma L, Wang YM, Majeed U, Liu X, Appels R, Maccaferri M, Tuberosa R, Lu HF, Zhang XY. Resequencing of 145 cultivars reveals asymmetric sub-genome selection and strong founder genotype effects on wheat breeding in China. Molecular Plant, 2020, 13(12):1733-1751.), by comparing with the wheat reference genome, SNP and indel loci were obtained on the genomes of the above 500 wheat samples. The above loci were screened according to the principle of MAF≥0.05, Miss<5%, heterozygosity het<5%, and chromosome uniform distribution, resulting in 5270 polymorphic loci (i.e., “uniform markers” in Tables 1 and 2), including 5138 SNP loci and 132 indel loci.

[0053] (2) Based on publicly published literature (Peng Y. Reference genome assemblies reveal the origin and evolution. Nat Genet. 2022; 54(8):1248-1258. doi:10.1038 / s41588-022-01126-8), 150 functional marker sites (i.e., “functional markers” in Tables 1 and 2) were obtained, including 148 SNP sites and 2 indel sites.

[0054] The above SNP / indel sites constitute all the variation sites (including SNPs and indels) involved in the wheat 5K breeding chip of this invention, containing a total of 5286 SNPs and 134 indel sites, with a total number of sites of 5420.

[0055] These loci cover genes or QTLs (quantitative trait loci) associated with important agronomic traits of wheat, such as yield, disease resistance, and quality.

[0056] 2. Design and fabrication of wheat 5K breeding chip probes

[0057] Probe design principles: probe length 120bp, probe GC content between 25% and 69%, average GC content about 45%, number of homologous regions ≤3, selected regions should not contain SSR and GAP regions to the greatest extent possible, combined with the principle of uniform chromosome distribution.

[0058] For each SNP / indel site obtained in step 1, a 120bp target sequence is selected from within a 120bp range upstream and downstream of the location of the SNP / indel site in the wheat genome reference sequence (IWGSCRefSeq2.1). This target sequence covers the SNP / indel site. A probe (with a GC content closest to 45%) is designed for this target sequence, and the nucleotide sequence of the probe is identical to that of the target site. The probes designed in this invention are double-stranded DNA probes. Information on the 5286 target sites targeting 5286 SNP sites is shown in Table 1. Information on the 134 target sites targeting 134 indel sites is shown in Table 2.

[0059] Table 1. Information on the start and end positions of 5286 SNP sites and their target sites in the wheat reference genome.

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137] Note: The location information of the 5286 SNP sites and their targets in the table is determined based on the wheat genome reference sequence (IWGSCRefSeq2.1). The nucleotide information in the "SNP wild-type nucleotides" column of the table is consistent with the corresponding nucleotides in IWGSC RefSeq2.1.

[0138] Table 1 presents multiple sets of data from left to right, consisting of SNP number, SNP location, SNP wild-type nucleotide, SNP mutant nucleotide, target start position, target end position, and marker type. These represent the corresponding SNP loci, their corresponding target chromosomes, their specific locations, and their marker types. In the "SNP location" field, the character before the colon indicates the chromosome number, and the character after the colon indicates the specific location of the SNP locus on that chromosome in the wheat reference genome IWGSC RefSeq 2.1. For example, "1A" represents chromosome 1A, and "1205959" indicates the specific location on chromosome 1A in the wheat reference genome IWGSC RefSeq 2.1. "SNP wild-type nucleotide" refers to the nucleotide type of the SNP locus in the wheat reference genome IWGSC RefSeq 2.1, and "SNP mutant nucleotide" refers to the nucleotide type resulting from the mutation of the "SNP wild-type nucleotide" at that SNP locus. For example, the SNP site shown in C00001 corresponds to position 1205959 of chromosome 1A in the wheat reference genome IWGSC RefSeq 2.1, and its nucleotide type is C (wild type) or T (mutant). The start and end positions of the target site of the SNP site shown in C00001 correspond to positions 1205899 and 1206018 of chromosome 1A in the wheat reference genome IWGSC RefSeq 2.1, respectively. The target sequence of the SNP site shown in C00001 is (5'-3'): AACTTGTAATTCCTCCCACATGTTCCTTCATTTAGTTGGTTTGTTCCTTTCCTTTTTCT TCTTCAAAACTATGCAAACTGACATTATTTGCAGGCTAGACCATTGCTTAGTCGAGCTCTT (SEQ ID No. 1). The nucleotide sequence of the probe targeting the SNP site shown in C00001 is (5'-3'): AACTTGTAATTCCTCCCACATGTTCC TTCATTTAGTTGGTTTGTTCCTTTCCTTTTTCTTCTTCAAAACTATGCAAACTGACATTATTTGCAGGCTAGACCATTGCTTAGTCGAGCTCTT (SEQ ID No. 1).

[0139] Table 2. Information on the start and end positions of the 134 indel sites and their target sites in the wheat reference genome.

[0140]

[0141]

[0142]

[0143] Note: The location information of the 134 indel sites and their target sites in the table is determined based on the wheat genome reference sequence (IWGSCRefSeq2.1). The nucleotide information in the "SNP wild-type nucleotide" column is consistent with the corresponding nucleotides in IWGSC RefSeq2.1. The location information given in the "indel position" column is the position of the first base in the "indel wild-type" column in IWGSC RefSeq2.1. The specific positions of the bases after the "indel wild-type" column can be arranged sequentially according to the location information in the "indel position" column.

[0144] Table 2 presents multiple sets of data from left to right, consisting of indel number, indel location, indel wild type, indel mutant type, target start position, target end position, and marker type. These represent the corresponding indel loci, their corresponding target chromosomes, their specific locations, and their marker types. In the "indel location" column, the character before the colon indicates the chromosome number, and the character after the colon indicates the specific location of that indel locus on that chromosome in the wheat reference genome IWGSC RefSeq 2.1 (corresponding to the first base in the "indel wild type" column). For example, "1A" indicates chromosome 1A.

[0145] “488904884” indicates the specific location on chromosome 1A of the wheat reference genome IWGSC RefSeq 2.1.

[0146] "Indel wild type" refers to the nucleotide information of the indel site on the wheat reference genome IWGSC RefSeq 2.1, while "indel mutant type" refers to the nucleotide information of the indel site after the "indel wild type" mutation. For example, as shown in C00136, the wild type of the indel site corresponds to positions 488904884-488904885 on chromosome 1A of the wheat reference genome IWGSC RefSeq 2.1, with the nucleotide code TA and the mutant type T. The start and end positions of the target site at the indel site shown in C00136 correspond to positions 488904824 and 488904943 on chromosome 1A of the wheat reference genome IWGSC RefSeq 2.1, respectively. The target sequence of the indel site shown in C00136 is (5'-3'): CCAATAATCCTCTTAAAGAAATCTTCTTTTGTGTTCTCAAGAATTTGAGGAAGAGCAGCCTAAACAATTTGATAGTGC AACAATCCATAATCAAGTTGTGTCAATCATAAGAGAACAATA (SEQ ID No. 2). The nucleotide sequence of the probe targeting the indel site shown in C00136 is (5'-3'): CCAATAATCCTCTTAAAGAAATCTTCTTTTGTGTTCTCAAGAA TTTGAGGAAGAGCAGCCTAAACAATTTGATAGTGCAACAATCCATAATCAAGTTGTGTCAATCATAAGAGAACAATA (SEQ ID No. 2).

[0147] It should be noted that, given the reference genome and its version number, and the specific location of the target site within it, obtaining the specific sequence information of each probe is very easy for those skilled in the art. Due to space limitations, the specific sequence information of each probe is not presented visually in this article.

[0148] Figure 1 This is a statistical graph showing the number of probes and chromosome length at SNP / indel sites in this invention.

[0149] Figure 2 This is a statistical diagram showing the distribution of SNP / indel sites on chromosomes according to the present invention.

[0150] Based on the start and end positions of the target sites at each SNP / indel site shown in Tables 1 and 2, sequences modified with biotin groups at the 5' end were synthesized to obtain wheat 5K breeding chip probes. Then, the obtained probes were coupled to fluorescent microspheres via C12 molecular arms and amino groups, with one probe coupled to each fluorescent microsphere. The probes coupled to the fluorescent microspheres constitute the liquid-phase probe hybridization chip of this invention—the wheat 5K breeding chip.

[0151] The probe is coupled with fluorescent microspheres to facilitate separation and detection, and to improve the stability and accuracy of capture. Specifically:

[0152] Facilitates separation and detection: The fluorescent microspheres possess fluorescence properties, allowing for monitoring and control of the capture reaction via fluorescence signals. After capture, the DNA fragments containing the target exons conjugated with the fluorescent microspheres can be easily identified and separated using fluorescence detection equipment. For example, flow cytometry and other instruments can rapidly separate the captured exons from other unbound DNA fragments and impurities based on the intensity and characteristics of the fluorescence signal, thereby obtaining a pure target exon sample for subsequent sequencing and analysis.

[0153] Improving capture stability and accuracy: Fluorescent microspheres provide a stable support structure for the probe, protecting it from degradation by nucleases and other factors during capture, thus improving probe stability and activity. Simultaneously, the coupling method between the fluorescent microspheres and the probe can be optimized, allowing the probe to bind to the microsphere surface with appropriate spatial orientation and density. This enables more effective binding to target exons, improving capture accuracy and specificity, and reducing interference and errors caused by non-specific binding.

[0154] The main functions of modifying the probe with a biotin group are: (1) Facilitating separation and purification: Biotin has a very high affinity for streptavidin, and its dissociation constant (Kd) is about 10. -15mol / L, this affinity is one of the strongest known non-covalent interactions. When the probe is modified with a biotin group, it can bind to streptavidin rapidly and specifically under mild conditions. In the experiment, after the biotin-modified probe binds to the target sequence, the probe-target sequence complex can be efficiently and specifically separated and purified from the complex sample solution using streptavidin-modified magnetic beads or microbeads as carriers. (2) Improve detection efficiency and sensitivity: The high affinity of the biotin-streptavidin system ensures the stability and specificity of the binding. This stable binding allows the target sequence to be accurately captured even in complex biological sample backgrounds. Moreover, since the biotin-modified probe can specifically recognize and bind to the target sequence, it reduces the interference of non-specific binding, thereby improving the detection efficiency and sensitivity.

[0155] Example 2: Method of using the wheat 5K breeding chip of the present invention

[0156] (1) DNA extraction: DNA was extracted from the wheat samples to be tested using a high-throughput DNA extraction kit or the CTAB method.

[0157] (2) DNA quality control: The purity, integrity, and contamination of DNA were analyzed using 1% agarose gel electrophoresis; the DNA concentration was accurately quantified using Qubit; and the integrity was precisely detected using Agilent 2100. The standard for passing quality control is a total amount of not less than 4 μg, a sample concentration of less than 40 ng / μl, good sample integrity, and no contaminants.

[0158] (3) Library construction: The qualified sample DNA is randomly fragmented using an ultrasonic disruptor, and the DNA fragments of the required length are recovered by electrophoresis. Adapters are added to the ends of the fragments to form a library.

[0159] (4) Sequencing library construction: The sample library is amplified by LM-PCR and purified to form a sequencing library, which can be used for probe hybridization experiments.

[0160] (5) Hybrid capture library construction: Take 300 ng of the constructed sequencing library and hybridize it with a probe coupled with fluorescent microspheres after denaturation treatment (i.e., the wheat 5K breeding chip prepared in Example 1) to complete the construction of the hybrid capture library.

[0161] (6) Hybrid capture library quality control: Initial quantification was performed using Qubit4.0, and the effective concentration of the hybrid capture library obtained in the previous step was accurately quantified using qPCR to ensure library quality.

[0162] (7) Sequencing: Sequencing was performed using the DNBSeq T7 high-throughput sequencer and related reagents.

[0163] (8) Analysis: After obtaining the sequencing data, BWA was used to compare the sequencing data with the reference genome IWGSC RefSeq2.1 (wheat variety Chinese Spring), and GATK was used to perform standard callSNPs on the data; thus obtaining the genotyping data of the sample to be tested.

[0164] Example 3: Application of the Wheat 5K Breeding Chip of the Present Invention

[0165] (1) Take 24 samples of wheat leaves to be tested and put them in a -20℃ refrigerator for later use.

[0166] (2) Using the wheat 5K breeding chip prepared in Example 1, DNA was extracted, library was constructed, and sequencing was performed according to the method in Example 2 to obtain the final SNP data.

[0167] (3) Calculate the detection rate.

[0168] Product site detection rate is an important indicator for judging chip quality. In plants, the detection rate is generally measured by the ratio of the number of product-detected sites to the number of designed sites. In this example, the average detection rate of the 24 samples tested was greater than 99%. The detection site missing rate was 0.09%-0.39%, indicating that the site design quality and probe capture efficiency of the targeted capture probe were very good. The specific detection rate results are shown in Table 3.

[0169] Table 3. Statistical table of detection results of 24 wheat samples.

[0170] W1 5420 5 0.09％ 99.91％ W11 5420 5 0.09％ 99.91％ W11-1 5420 6 0.11％ 99.89％ W13 5420 8 0.15％ 99.85％ W13-1 5420 7 0.13％ 99.87％ W15 5420 10 0.18％ 99.82％ W23 5420 8 0.15％ 99.85％ W27 5420 21 0.39％ 99.61％ W3 5420 10 0.18％ 99.82％ W3-1 5420 9 0.17％ 99.83％ W35 5420 13 0.24％ 99.76％ W37 5420 10 0.18％ 99.82％ W41 5420 8 0.15％ 99.85％ W43 5420 13 0.24％ 99.76％ W45 5420 10 0.18％ 99.82％ W49 5420 13 0.24％ 99.76％ W51 5420 9 0.17％ 99.83％ W59 5420 8 0.15％ 99.85％ W61 5420 13 0.24％ 99.76％ W85 5420 10 0.18％ 99.82％ W9 5420 12 0.22％ 99.78％ W9-1 5420 9 0.17％ 99.83％ W95 5420 7 0.13％ 99.87％ W99 5420 8 0.15％ 99.85％

[0171] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A liquid-phase probe hybridization chip, comprising: (A1) Reagents for specific detection of SNP sites; The SNP sites are the 5286 SNP sites listed in Table 1; (A2) Reagents for specific detection of indel sites; the indel sites are the 134 indel sites listed in Table 2; The location information of the 5286 SNP sites in Table 1 and the 134 indel sites in Table 2 were determined by comparison with the wheat genome reference sequence, which is the whole genome sequence of the wheat variety Chinese Spring, version number IWGSC RefSeq2.1; The reagent is a probe; The probe is modified with biotin; The probe is coupled to the fluorescent microsphere via a C12 molecular arm and amino modification; each fluorescent microsphere is coupled with one of the probes.

2. The liquid-phase probe hybridization chip according to claim 1, characterized in that: In (A1), there are a total of 5286 probes; For each SNP site, a target site is selected within a 120bp range upstream and downstream of the location of the SNP site on the wheat genome reference sequence. The target site covers the SNP site. A probe is designed for the target site. The nucleotide sequence of the probe is the same as or reverse complementary to the nucleotide sequence of the target site. In (A2), there are a total of 134 probes; For each indel site, a target site is selected within a 120bp range upstream and downstream of the indel site on the wheat genome reference sequence, the target site covering the indel site. A probe is designed for the target site, the nucleotide sequence of the probe being the same as or reverse complementary to the nucleotide sequence of the target site.

3. The liquid-phase probe hybridization chip according to claim 2, characterized in that: In (A1), the start and end positions of the target points corresponding to each of the 5286 probes are shown in Table 1; In (A2), the starting and ending positions of the target points corresponding to each of the 134 probes are shown in Table 2.

4. A kit comprising a liquid-phase probe hybridization chip as described in any one of claims 1-3 and streptavidin-coated magnetic beads.

5. The application of the liquid-phase probe hybridization chip according to any one of claims 1-3 in any of the following: (B1) Analysis of wheat genetic diversity; (B2) Construction of a molecular genetic map of wheat; (B3) Marker-Assisted Selection Breeding for Wheat; (B4) Identification of wheat variety authenticity.

Images