Efficient large-scale seed production method of all-male larvae of large yellow croaker

Abstract

The application provides a large-scale production method of high-efficiency all-male large yellow croaker fry, and relates to the technical field of aquatic breeding, and comprises the following steps: inducing genetic male large yellow croaker to undergo sex reversal by gradient feeding of estradiol feed, and screening pseudo-female large yellow croaker with genotype XY and gonadal histological characteristics conforming to female development. The pseudo-female large yellow croaker is paired with normal male fish to breed YY super-male parents, and finally the all-male large yellow croaker is produced by mating the super-male parents with female parents. The pseudo-female fish is induced by gradient feeding of low-dose estradiol, which ensures the success rate of induction and improves the survival rate of individuals; the pseudo-female fish and super-male fish are screened by using gender-specific molecular markers combined with PIT marking technology; the all-male fry is produced by one-step large-scale production through mixed mating of super-male fish and ordinary female fish, and the fry has the advantages of fast growth and stable traits.

Description

Technical Field

[0001] This invention relates to the field of aquatic breeding technology, and in particular to a method for large-scale production of all-male fry of large yellow croaker at high efficiency. Background Technology

[0002] Large yellow croaker, one of the "Four Major Marine Products" of the East my country Sea, enjoys the reputation of "National Fish of Marine Water." Since breakthroughs in seedling breeding technology, its aquaculture production has continued to climb, reaching 2.58 billion seedlings and 258,000 tons in 2022, ranking first among marine aquaculture fish in my country for many consecutive years. Large yellow croaker exhibits significant sexual dimorphism. Although females grow faster than males, males, after reaching sexual maturity, have a more slender body shape, better meeting market demands and thus possessing higher economic value.

[0003] Chinese patent application CN 118985489A discloses a method for large-scale breeding of all-male salmon and trout, which involves treating genetically male individuals with exogenous estradiol to induce sex reversal and transform them into physiologically female offspring. Studies have shown that estradiol can induce sex reversal in genetically male fish, causing them to exhibit female phenotypes. However, the induction effect is significantly affected by species-specific biological characteristics, requiring optimization of induction parameters based on the reproductive and developmental patterns of the target fish species. Furthermore, the use of estradiol has dose-dependent side effects: excessively high doses can lead to growth inhibition, decreased survival rates, and delayed or even arrested gonadal development; while excessively low doses may not achieve effective induction. Currently, there are no effective reports on the large-scale production of all-male fry in large yellow croaker sex control research. Summary of the Invention

[0004] To address the aforementioned technical challenges in the large-scale production of all-male large yellow croaker fry, this invention provides a highly efficient method for large-scale production of all-male large yellow croaker fry. The method induces pseudo-female production through a low-dose estradiol gradient feeding approach, ensuring a high induction success rate while also improving individual survival rates. Pseudo-females and super-males are screened using sex-specific molecular markers combined with PIT marker technology. By combining multiple parental screenings and mating of super-males with females, an all-male fry can be produced on a one-step, large-scale basis. This invention integrates the advantages of sex control, population selection, and molecular breeding, resulting in fry that grow rapidly, exhibit stable traits, are easy to operate, and are suitable for large-scale application, giving it strong market competitiveness.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for large-scale, efficient breeding of all-male large yellow croaker fry includes the following steps: (1) Male large yellow croaker were fed with a diet gradient containing estradiol to induce sex reversal in male large yellow croaker and the pseudo-female large yellow croaker with genotype XY and gonadal morphology was identified and screened. (2) Inject oxytocin into pseudo-female large yellow croaker and normal male fish to induce spawning and fertilization. The hatched fry were selected and screened twice, and super male large yellow croaker with genotype YY was identified. (3) Inject oxytocin into normal female fish and sexually mature super-male large yellow croaker to induce spawning and fertilization, collect the fertilized eggs for incubation and cultivation, and obtain large-scale all-male large yellow croaker seedlings.

[0007] Preferably, the gradient feeding begins when the male large yellow croaker is 45-52 days old and continues for a total of 73-80 days.

[0008] More preferably, the gradient feeding method is as follows: male large yellow croakers are fed a formulated feed with an estradiol content of 0.7-0.9 mg / kg when they are 45-65 days old; they are fed a formulated feed with an estradiol content of 0.9-1.1 mg / kg when they are 66-80 days old; they are fed a feed with an estradiol content of 1.3-1.7 mg / kg when they are 81-125 days old; and after 125 days old, they are fed a normal feed.

[0009] More preferably, when male large yellow croakers fed the gradient feeding method are 150 days old, the morphological characteristics of normal female ovaries and oocytes can be observed through histological sections.

[0010] Preferably, the identification and screening of pseudo-female or super-male large yellow croaker utilizes PIT live electronic tagging technology, injecting wireless frequency tags into the tagged fish to achieve individual identification; the screening utilizes sex-specific molecular markers to perform PCR amplification and gel electrophoresis analysis on fin DNA, combined with observation of gonadal morphology in gonadal tissue sections, to screen pseudo-female or super-male large yellow croaker.

[0011] More preferably, the PIT live electronic tagging is performed on 12-month-old large yellow croaker individuals.

[0012] Preferably, the oxytocin is LHRH-A3, and the injection dose is 1.5-2 μg / kg fish body weight.

[0013] Preferably, in step (2), the ratio of sexually mature pseudo-female fish to normal male fish is 2 to 2.5:1.

[0014] Preferably, the selection and screening operation in step (2) is carried out when the fish fry are 6 months and 12 months old, respectively.

[0015] More preferably, the selection criteria for the selection and screening operation in step (2) are: weight greater than average, good body color, no deformities, and a selection rate of 5-15%.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) Low-dose estradiol gradient feeding technique was used to induce pseudo-female fish, which improved the individual survival rate while ensuring normal gonadal development. (2) Based on sex-specific molecular markers and PIT marker technology, pseudo-female and super-male fish can be accurately screened with a screening accuracy of 100%, which significantly improves breeding efficiency and reduces labor costs. (3) By using parental trait-oriented screening and super-male-female mating strategy, the large-scale production of all-male seedlings can be achieved in one step, and the growth performance and phenotypic stability of the seedlings are significantly optimized. Attached Figure Description

[0017] Figure 1 This is an electrophoretic detection image of primers designed for sex-specific molecular markers in this invention after PCR amplification of pseudo-female maternal fish, normal male paternal fish, and offspring.

[0018] Figure 2 Gonadal tissue sections of offspring produced by mating a pseudo-female maternal parent and a normal paternal parent at 4 months of age.

[0019] The offspring contain three types: female (XX), male (XY), and supermale (YY). The scale bar in the figure is 20 μm. Detailed Implementation

[0020] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0021] In this embodiment of the invention, the preparation method of the compound feed containing estradiol is as follows: a certain amount of estradiol is weighed and dissolved in 95% ethanol to prepare an estradiol solution with a stock solution concentration of 1 mg / mL, which is then stored in a refrigerator at 4°C in the dark. The stock solution is diluted to a suitable concentration, and the corresponding amount of compound feed is weighed and mixed well, and then allowed to air dry naturally at room temperature.

[0022] Example 1

[0023] This embodiment provides a general and efficient method for large-scale breeding of all-male large yellow croaker fry, including the following steps: (1) Male large yellow croaker were fed with a diet gradient containing estradiol to induce sex reversal in male large yellow croaker and the pseudo-female large yellow croaker with genotype XY and gonadal morphology was identified and screened. (2) Inject oxytocin into pseudo-female large yellow croaker and normal male fish to induce spawning and fertilization. The hatched fry were selected and screened twice, and super male large yellow croaker with genotype YY was identified. (3) Inject oxytocin into normal female fish and sexually mature super-male large yellow croaker to induce spawning and fertilization, collect the fertilized eggs for incubation and cultivation, and obtain large-scale all-male large yellow croaker seedlings.

[0024] In some preferred embodiments, the gradient feeding begins at 45–52 days of age in male large yellow croakers and continues for a total of 73–80 days. The technical advantage lies in initiating induction during the critical window of gonadal differentiation in large yellow croakers, ensuring maximum efficiency in sex reversal, while avoiding growth inhibition caused by feeding too early or gonadal development retardation caused by feeding too late.

[0025] In some preferred embodiments, the gradient feeding method is as follows: male large yellow croakers are fed a formulated feed with an estradiol content of 0.7–0.9 mg / kg from 45 to 65 days of age; from 66 to 80 days of age, they are fed a formulated feed with an estradiol content of 0.9–1.1 mg / kg; from 81 to 125 days of age, the feeding dose is 1.3–1.7 mg / kg; after 125 days of age, they are switched to normal feed. The technical effect is that by establishing a temporal gradient enhancement pattern of estradiol, dynamic adaptation between the physiological metabolism and gonadal development of the large yellow croaker is achieved. Initially, low-dose estradiol feeding reduces the metabolic burden on the large yellow croaker; in the middle stage, the feeding dose is gradually increased to enhance gonadal feminization; and in the later stage, high-dose estradiol ensures the completion of sex reversal, guaranteeing the survival rate of pseudo-females while ensuring complete gonadal development and normal spawning function.

[0026] In some preferred embodiments, male large yellow croakers fed with the gradient feeding method at 150 days of age can have normal female ovarian morphology and oocytes observed through histological sections.

[0027] In some preferred embodiments, the identification and screening of pseudo-female or super-male large yellow croaker utilizes PIT live electronic tagging technology, injecting radio frequency tags into the tagged fish to achieve individual identification. The screening process employs sex-specific molecular markers for PCR amplification and gel electrophoresis analysis of fin DNA, combined with observation of gonadal morphology in gonad tissue sections, to screen for pseudo-female or super-male large yellow croaker. The technical advantage lies in achieving dual verification of genotype and phenotype through the combined use of molecular markers and morphology, ensuring 100% screening accuracy and avoiding breeding deviations caused by misscreening. Simultaneously, live tagging technology supports tracking of individuals throughout their entire life cycle, providing a data foundation for large-scale breeding.

[0028] In some preferred embodiments, the PIT live electronic tagging is performed on 12-month-old large yellow croaker individuals. The technical advantage lies in the fact that tagging at the sexual maturity stage reduces stress damage caused by tagging operations in juvenile fish, accurately correlates gonadal development status with individual identity information, and enhances the biological significance of the tagging data.

[0029] In some preferred embodiments, the oxytocin is LHRH-A3, and the injection dosage is 1.5-2 μg / kg fish body weight. The technical advantage is that this dosage range can effectively stimulate synchronized ovulation and sperm release in parent fish, improving the quality of fertilized eggs and hatching rate, while avoiding metabolic burden or gonadal overmaturation caused by excessive hormone intake.

[0030] In some preferred embodiments, the ratio of sexually mature pseudo-female fish to normal male fish in step (2) is 2–2.5:1. The technical effect is that by optimizing the sex ratio and balancing the sperm-egg ratio, fertilization efficiency is significantly improved, and resource waste caused by sperm competition is reduced.

[0031] In some preferred implementations, the selection and screening operation in step (2) is performed at 6 months and 12 months of age, respectively. The technical effect is that the phased screening can dynamically evaluate the growth performance and stress resistance of the fry, remove individuals with lagging development in the early stage, and lock in high-quality parent candidates in the later stage, thereby improving the consistency of the population.

[0032] In some preferred implementations, the selection criteria for the selection and screening operation in step (2) are: greater than average weight, good body color, no deformities, and a selection rate of 5-15%. The technical effect is that, through phenotypic targeted selection, superior individuals with fast growth and strong disease resistance are selected to maintain the genetic diversity of the population, while controlling the selection rate to avoid inbreeding depression and ensure the robustness of the seedling population.

[0033] Example 2

[0034] This embodiment provides a method for large-scale breeding of all-male large yellow croaker fry at high efficiency, including the following steps: 1. Induction and breeding of pseudo-female fish.

[0035] Starting in May 2021, approximately 150,000 vigorous and feeding common large yellow croaker fry were selected and placed in a 10-ton cement tank. They were fed a formulated feed containing estradiol starting 45 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 80 days.

[0036] Estradiol was administered using a gradual increase in dosage: 0.8 mg / kg for fish aged 45-65 days; 1 mg / kg for fish aged 66-80 days; and 1.5 mg / kg for fish aged 81-125 days. After 125 days, the fish were switched to a normal diet. The water volume was changed at least 100% daily, and the fish were fed 4-5 times daily. Mortality rates were monitored and recorded daily.

[0037] Subsequently, at 150 days and 12 months of age, gonads of the large yellow croaker were collected to prepare histological sections for observation of gonadal development. Simultaneously, corresponding fin rays were collected to extract DNA for genotyping. Individuals with a DNA genotype (XY) of male were identified; if their histological sections showed female characteristics, they were identified as pseudo-females. The gonads of pseudo-females exhibited the morphological characteristics of normal female ovaries, and oocytes could be observed at 150 days of age. The sections are shown in the image. Figure 2 As shown, during estradiol treatment, the survival rate of large yellow croaker was 95%, and the success rate of pseudo-female induction was 100%.

[0038] 2. Molecular identification and screening of pseudo-female fish.

[0039] Large yellow croakers induced by estradiol were cultured and selected twice, at 6 months and 12 months of age. The selection criteria were that they were larger than average in weight, had good body color, and were free of deformities, with a retention rate of 10%. At 6 months of age, there were approximately 100,000 large yellow croaker fry, from which 10,000 were selected according to the selection criteria; at 12 months of age, 1,000 were selected according to the selection criteria.

[0040] Selected large yellow croakers were identified by injecting radio frequency tags into the fish using PIT (Plasmograph Interferometer) live electronic tagging technology, enabling individual identification. Simultaneously, fin rays from each fish were preserved in anhydrous ethanol and stored at -20°C, and matched one-to-one with the radio frequency tag serial numbers. Genomic DNA was then extracted from the fin rays using the phenol-chloroform extraction method. Existing sex-specific primers for large yellow croakers were used for PCR amplification and gel electrophoresis. Sexing was determined by differences in the amplified DNA bands. Genetically female (XX) large yellow croakers showed only one band at 200 bp, while genetically male (XY) large yellow croakers showed two bands at 250 bp and 200 bp. Based on this, pseudo-female large yellow croakers were screened out. The amplification electrophoresis results are shown in the figure below. Figure 1 As shown.

[0041] The primer information for DNA-specific molecular markers is as follows: LYC-XF:TCCCTGGTTAACTCTGATGTCCACG, LYC-XR:AGTGCCCTCTGGACAGAAACA, LYC-YF:ACTGTTTCAGAAAGTAACCGCAG, LYC-YR:CTGGGTGGCCTCACACTCAGTGTT.

[0042] The PCR reaction system consisted of 10 μL of 2×PCR Taq mix, 0.5 μL each of F and R primers, 1 μL of 50 ng / μL DNA, and 8 μL of double-distilled water. The amplification program was as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 61℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 35 cycles; and 72℃ extension for 10 minutes.

[0043] 3. Spawning and hatching of pseudo-female large yellow croaker and cultivation of super-male fry.

[0044] A total of 485 pseudo-female large yellow croakers were screened using sex molecular markers. Among them, 45 sexually mature 2-year-old pseudo-females were selected, and 20 normal males were selected. They were placed together in a cement pond, and nutritional and photothermal regulation was carried out on the pseudo-females and normal females.

[0045] Nutritional regulation refers to using fresh mackerel and sandworms as feed, adding 3-5% vitamin C and 1-2% vitamin E by weight of the feed, and feeding twice a day; light and temperature regulation involves using 65W incandescent lamps to control the surface light of the broodstock pond, with a light intensity of 60-650 lux, and the light duration gradually increasing from 12 hours to 16 hours of long light, while maintaining a water temperature of 18-22℃.

[0046] Male and female parent fish were injected with the oxytocin LHRH-A3 to induce spawning and fertilization. A total of 1,150 mL of fertilized eggs were collected and cultured. Approximately 320,000 fry hatched, and about 120,000 juveniles reached a total length of 5 cm. The water temperature for rearing fry, juveniles, and young fish was 23–26℃, the salinity was 28–32‰, and the pH was 8.0–8.2. The water exchange rate and aeration rate gradually increased as the fry grew. The feed used for fry rearing consisted of rotifers, fresh copepods, Artemia nauplii, and formulated feed.

[0047] 4. Molecular identification and screening of super male large yellow croaker.

[0048] At 6 and 12 months of age, the offspring of pseudo-female large yellow croaker underwent two selections. The selection criteria were greater than average weight, good body color, and no deformities, with a retention rate of 10% each time. After two selections, approximately 1,000 individuals were retained for breeding. At 15 months of age, each retained individual was individually tagged with PIT electronic markers, and DNA was extracted from fin rays for sex determination. Genetically female (XX) large yellow croakers showed only a single band at 200 bp, while genetically male (XY) large yellow croakers showed two bands at 250 bp and 200 bp. Super-male (YY) large yellow croakers showed a single band at 250 bp. Based on this, super-male large yellow croakers were selected. 220 super-male large yellow croakers were identified through molecular marker selection.

[0049] 5. Large-scale breeding of all-male large yellow croaker.

[0050] The selected super-male fish were bred, and 20 sexually mature females over 2 years old and 20 super-male fish were placed in a cement pond. Nutritional and light-temperature regulation were carried out on the super-male fish and ordinary female fish.

[0051] The parent fish were injected with the oxytocin LHRH-A3 to induce spawning and fertilization, and the fertilized eggs were collected for rearing. The water temperature for rearing fry, juveniles, and young fish was 23–25℃, salinity 28–32‰, and pH 8.0–8.2. The water exchange rate and aeration rate gradually increased as the fry grew. The feed used for fry rearing consisted of rotifers, Artemia nauplii, and formulated feed, in that order. A total of 150,000 all-male fry reaching a total length of 5cm were reared. When the fry reached 4 months of age, 30 samples were taken, and their gonads were removed. Histological examination confirmed that all were male, proving that the reared fry were all-male large yellow croaker.

[0052] Comparative Example 1

[0053] The difference between this comparative example and Example 2 is that the feeding period in this comparative example is 60 days.

[0054] About 200 vigorous and feeding common large yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 45 days after hatching to induce sex reversal in genetically male large yellow croaker. The estradiol feeding period was 60 days.

[0055] Estradiol was administered using a gradient approach: 0.8 mg / kg for fish aged 45-55 days; 1 mg / kg for fish aged 56-65 days; and 1.5 mg / kg for fish aged 66-105 days. After 105 days, the fish were switched to a normal diet. The water volume was changed at least 100% daily, and the fish were fed 4-5 times daily. Mortality rates were monitored and recorded daily.

[0056] Subsequently, at 150 days and 12 months of age, the gonads of the large yellow croaker were taken to prepare histological sections to observe gonadal development, and the corresponding fin rays were taken to extract DNA to identify the genotype.

[0057] During estradiol treatment, the survival rate of large yellow croaker was 90%, and the success rate of pseudo-female induction was 90%. Histological sections revealed that some large yellow croaker exhibited facultative gonadal phenomena.

[0058] Comparative Example 2

[0059] The difference between this comparative example and Example 2 is that the feeding period in this comparative example is 105 days.

[0060] About 200 vigorous and feeding common yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 45 days after hatching to induce sex reversal in genetically male yellow croaker. The estradiol feeding period was 105 days.

[0061] Estradiol was administered using a gradient approach: 0.8 mg / kg for fish aged 45-65 days; 1 mg / kg for fish aged 66-80 days; and 1.5 mg / kg for fish aged 81-150 days. After 150 days, the fish were switched to a normal diet. The water volume was changed at least 100% daily, and the fish were fed 4-5 times daily. Mortality rates were monitored and recorded daily.

[0062] Subsequently, at 150 days and 12 months of age, gonads of the large yellow croaker were harvested to prepare histological sections for observation of gonadal development. Simultaneously, corresponding fin rays were collected for DNA extraction to identify the genotype. During estradiol treatment, the survival rate of the large yellow croaker was 85%, and the success rate of pseudo-female induction was 90%. Histological sections revealed abnormal egg nucleus development in some large yellow croaker individuals.

[0063] Comparative Example 3

[0064] The difference between this comparative example and Example 2 is that the dosage of estradiol fed in this comparative example is lower than the protection scope of this invention.

[0065] About 200 vigorous and feeding common yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 45 days after hatching to induce sex reversal in genetically male yellow croaker. The estradiol feeding period was 80 days.

[0066] Estradiol was administered using a gradual increase in dosage: 0.5 mg / kg for fish aged 45-65 days; 0.7 mg / kg for fish aged 66-80 days; and 1 mg / kg for fish aged 81-125 days. After 125 days, the fish were switched to a normal diet. The water volume was changed at least 100% daily, and the fish were fed 4-5 times daily. Mortality rates were monitored and recorded daily.

[0067] Subsequently, at 150 days and 12 months of age, gonads of the large yellow croaker were harvested to prepare histological sections for observation of gonadal development. Simultaneously, corresponding fin rays were collected for DNA extraction to identify the genotype. During estradiol treatment, the survival rate of the large yellow croaker was 95%, and the success rate of pseudo-female induction was 100%. Histological sections revealed that oocyte developmental arrest was prevalent in all large yellow croaker individuals.

[0068] Comparative Example 4

[0069] The difference between this comparative example and Example 2 is that the dosage of estradiol fed in this comparative example is higher than the protection scope of this invention.

[0070] About 200 vigorous and feeding common yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 45 days after hatching to induce sex reversal in genetically male yellow croaker. The estradiol feeding period was 80 days.

[0071] Estradiol was administered using a gradual increase in dosage: 1.2 mg / kg for fish aged 45-65 days; 1.5 mg / kg for fish aged 66-80 days; and 2.0 mg / kg for fish aged 81-125 days. After 125 days, the fish were switched to a normal diet. The water volume was changed by more than 100% daily, and the fish were fed 4-5 times a day. Mortality rates were monitored and recorded daily.

[0072] Subsequently, gonads were harvested from large yellow croakers at 150 days and 12 months of age to prepare histological sections for observing gonadal development. Simultaneously, corresponding fin rays were collected for DNA extraction to identify the genotype. During estradiol treatment, the survival rate of large yellow croakers was 68%, and the success rate of pseudo-female induction was 81%. Histological sections revealed that high doses of estradiol caused ovarian fibrosis in individual large yellow croakers.

[0073] Comparative Example 5

[0074] The difference between this comparative example and Example 2 is that the feeding period in this comparative example starts from 30 days of age of the large yellow croaker.

[0075] About 200 vigorous and feeding common yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 30 days after hatching to induce sex reversal in genetically male yellow croaker. The estradiol feeding period was 80 days.

[0076] Estradiol was administered using a gradual increase in dosage: 0.8 mg / kg for fish aged 30-50 days; 1 mg / kg for fish aged 51-65 days; and 1.5 mg / kg for fish aged 66-110 days. After 110 days, the fish were switched to a normal diet. The water volume was changed at least 100% daily, and the fish were fed 4-5 times daily. Mortality rates were monitored and recorded daily.

[0077] Subsequently, at 150 days and 12 months of age, the gonads of the large yellow croaker were harvested to prepare histological sections for observation of gonadal development. Simultaneously, corresponding fin rays were collected to extract DNA for genotyping. During estradiol treatment, the survival rate of the large yellow croaker was 78%, and the success rate of pseudo-female induction was 63%.

[0078] Comparative Example 6

[0079] The difference between this comparative example and Example 2 is that the feeding period in this comparative example starts from 60 days of age of the large yellow croaker.

[0080] About 200 vigorous and feeding common large yellow croaker fry were selected and fed with a formulated feed containing estradiol starting 60 days after hatching to induce sex reversal in genetically male large yellow croaker. The estradiol feeding period was 80 days.

[0081] Estradiol was administered using a gradual increase in dosage: 1.2 mg / kg for fish aged 60-80 days; 1.5 mg / kg for fish aged 81-95 days; and 2.0 mg / kg for fish aged 96-140 days. After 125 days, the fish were switched to a normal diet. The water volume was changed by more than 100% daily, and the fish were fed 4-5 times a day. Mortality rates were monitored and recorded daily.

[0082] Subsequently, at 150 days and 12 months of age, the gonads of the large yellow croaker were harvested to prepare histological sections for observation of gonadal development. Simultaneously, corresponding fin rays were collected to extract DNA for genotyping. During estradiol treatment, the survival rate of the large yellow croaker was 90%, and the success rate of pseudo-female induction was 58%.

[0083] The induction success rate and survival rate of Example 2 and Comparative Examples 1-6 are summarized in Table 1.

[0084] Table 1 Example 2 100 95 No abnormalities Comparative Example 1 90 90 The appearance of facultative gonads Comparative Example 2 90 85 Abnormal development of egg nucleus Comparative Example 3 100 95 Oocyte developmental arrest Comparative Example 4 81 68 ovarian fibrosis Comparative Example 5 63 78 - Comparative Example 6 58 90 -

[0085] As shown in Table 1, the feeding method provided by the technical solution of this invention can efficiently induce sex reversal in male fish, ensuring individual survival rate while achieving a 100% success rate induction.

[0086] Comparative Examples 1-2 showed that adjusting the feeding duration of estradiol significantly affected the induction success rate and survival rate of pseudo-female fish. Shortening the feeding cycle maintained a high survival rate, but it led to incomplete sex reversal, resulting in facultative gonadal phenomena. Extending the feeding time caused abnormal oocyte nuclear development due to the cumulative effect of hormones, resulting in a decrease in individual survival rate. Comparative Examples 3-4 showed that the induction effect of estrogen exhibited a typical threshold effect, with gonadal development arrest occurring in the low-dose group. In the high-dose group, ovarian tissue fibrosis occurred due to the metabolic toxicity of excessive estrogen. Comparative Examples 5-6 showed the impact of the timing of estrogen feeding on the induction of male fish; feeding estradiol too early or too late both affected the induction success rate and survival rate of large yellow croaker individuals.

[0087] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A method for large-scale, efficient breeding of all-male large yellow croaker fry, characterized in that, The steps include the following: (1) Male large yellow croaker were fed with a diet gradient containing estradiol to induce sex reversal in male large yellow croaker and the pseudo-female large yellow croaker with genotype XY and gonadal morphology was identified and screened. (2) Inject oxytocin into pseudo-female large yellow croaker and normal male fish to induce spawning and fertilization. The hatched fry were selected and screened twice, and super male large yellow croaker with genotype YY was identified. (3) Inject oxytocin into normal female fish and sexually mature super-male large yellow croaker to induce spawning and fertilization, collect the fertilized eggs for incubation and cultivation, and obtain large-scale all-male large yellow croaker seedlings. The graded feeding method begins when male large yellow croakers are 45-52 days old and lasts for 73-80 days. The graded feeding method is as follows: when male large yellow croakers are 45-65 days old, they are fed a formulated feed with an estradiol content of 0.7-0.9 mg / kg; when they are 66-80 days old, they are fed a formulated feed with an estradiol content of 0.9-1.1 mg / kg; when they are 81-125 days old, they are fed a formulated feed with an estradiol content of 1.3-1.7 mg / kg; after 125 days old, they are switched to normal feed.

2. The method for large-scale breeding of all-male large yellow croaker fry according to claim 1, characterized in that, Male large yellow croakers fed using the gradient feeding method showed normal female ovarian morphology and oocytes at 150 days of age through histological sections.

3. The method for large-scale breeding of all-male large yellow croaker fry according to claim 1, characterized in that, The identification and screening of pseudo-female or super-male large yellow croaker utilizes PIT live electronic tagging technology, injecting wireless frequency tags into the tagged fish to achieve individual identification; the screening utilizes sex-specific molecular markers to perform PCR amplification and gel electrophoresis analysis on fin DNA, combined with observation of gonadal morphology in gonadal tissue sections, to screen pseudo-female or super-male large yellow croaker.

4. The method for large-scale breeding of all-male large yellow croaker fry according to claim 3, characterized in that, The PIT live electronic tagging was applied to 12-month-old large yellow croaker individuals.

5. A method for large-scale breeding of all-male large yellow croaker fry according to claim 1, characterized in that, The oxytocin used is LHRH-A3, and the injection dose is 1.5-2 μg / kg fish body weight.

6. The method for large-scale breeding of all-male large yellow croaker fry according to claim 1, characterized in that, In step (2), the ratio of sexually mature pseudo-female large yellow croaker to normal male fish is 2~2.5:

1.

7. The method for large-scale breeding of all-male large yellow croaker fry according to claim 1, characterized in that, The selection and screening operation in step (2) is carried out at 6 months and 12 months of age for the fish fry, respectively.

8. A method for large-scale breeding of all-male large yellow croaker fry according to claim 1 or 7, characterized in that, The selection criteria for the selection and screening operation in step (2) are: weight greater than average, good body color, no deformities, and a selection rate of 5-15%.

Images