Lactobacillus gasseri JY01 and application thereof

Abstract

The application provides a lactobacillus gasseri JY01, belongs to the technical field of probiotic application, the lactobacillus gasseri JY01 is preserved in Guangdong Microbial Culture Collection Center on May 21, 2025, and the preservation number is GDMCC NO.66341, and the nucleotide sequence is shown as SEQ ID No.1.It is obtained by isolating and purifying a pickled vegetable sample produced in Liaoning, China, has high production of gamma-aminobutyric acid (GABA), hypoglycemic effect, antioxidant property, gastrointestinal tract regulation and other functions, and has high application value and economic value.

Description

Technical Field

[0001] This invention relates to the field of probiotic application technology, specifically to Lactobacillus gasseri JY01 and its applications. Background Technology

[0002] Lactobacillus gasseri ( Lactobacillus gasseri Lactobacillus gasseri (Gastroenterobacter), a Gram-positive lactic acid bacterium, is widely distributed in the human gut and female reproductive tract, exhibiting excellent colonization ability and probiotic effects. It inhibits the growth of harmful bacteria by producing lactic acid and bacteriocins, helping to maintain the balance of the intestinal and vaginal microecology. It also shows potential in regulating immunity and improving metabolic health (such as anti-obesity and blood sugar reduction). Due to its superior physiological characteristics, Lactobacillus gasseri is widely used in functional foods, dietary supplements, and medical research.

[0003] Lactobacillus gasseri is a widely distributed and versatile lactic acid bacterium that can survive in fermented foods, meats, and the gastrointestinal tracts of mammals. As an important component of the normal intestinal microbiota and accompanying its host throughout life, it plays a vital role in maintaining intestinal microecological balance. In recent years, Lactobacillus gasseri has become a research hotspot due to its significant advantages and has gained attention in the food and health product industries.

[0004] Studies indicate that *Lactobacillus gasseri* exhibits multiple probiotic functions: 1. Improved metabolic health: Research has found that *Lactobacillus gasseri* can influence lipid metabolism and reduce body fat accumulation, thus showing potential in regulating weight and improving obesity-related metabolic disorders. For example, *Lactobacillus gasseri* strains have been shown to lower serum total cholesterol and LDL cholesterol levels, contributing to cardiovascular health. 2. Gastrointestinal protection: *Lactobacillus gasseri* can enhance intestinal barrier function, reduce the risk of leaky gut, and help alleviate intestinal inflammation. For example, *Lactobacillus gasseri* strains can reduce bloating and abdominal pain symptoms in patients with irritable bowel syndrome (IBS), improving digestive comfort. 3. Anti-Helicobacter pylori effect: *Lactobacillus gasseri* can inhibit the colonization of *Helicobacter pylori* through competitive rejection and secretion of antibacterial substances, and to some extent alleviate gastric inflammation. For example, studies have shown that *Lactobacillus gasseri* SBT2055 can significantly reduce gastric inflammatory responses in *Helicobacter pylori*-infected individuals, helping to improve gastric health.

[0005] Lactobacillus gasseri has a wide range of sources and possesses rich genetic and functional diversity. However, research on the isolation, identification, probiotic properties, and metabolic mechanisms of Lactobacillus gasseri is still relatively insufficient. Although some Lactobacillus gasseri with probiotic functions have been discovered, their numbers remain inadequate. While current research has made some progress in the function and application of Lactobacillus gasseri, its potential efficacy has not yet been fully explored and developed. Therefore, it is necessary to further explore more Lactobacillus gasseri with probiotic functions, and to conduct in-depth research on their functions based on the characteristics of their different sources, so that they can play a more effective role. For example, its efficacy can be determined based on the function and probiotic metabolites of Lactobacillus gasseri, thereby clarifying its application prospects in different fields. In general, there is broad room for development in in-depth research on the probiotic properties and application prospects of Lactobacillus gasseri. Summary of the Invention

[0006] To address the aforementioned defects and shortcomings in the prior art, this invention provides a strain of Lactobacillus gasseri (…). Lactobacillus gasseri The JY01 strain has multiple functions, including high production of γ-aminobutyric acid (GABA), lowering blood sugar, and antioxidant regulation of the gastrointestinal tract.

[0007] To solve the above technical problems: The first objective of this invention is to provide a strain of Lactobacillus gasseri ( Lactobacillus gasseri Lactobacillus gasseri strain JY01 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on May 21, 2025, with accession number GDMCC NO. 66341; the full 16S rDNA sequence of the Lactobacillus gasseri strain JY01 is shown in SEQ ID No: 1.

[0008] The second objective of this invention is to provide an application of Lactobacillus gasseri JY01 or its fermentation broth in increasing the yield of γ-aminobutyric acid (GABA), wherein the fermentation method of the fermentation broth is as follows: S1 Lactobacillus gasseri ( Lactobacillus gasseri JY01 was activated in MRS medium; S2. The activated bacterial solution is inoculated into a shake flask and fermented for 24-96 hours. The culture temperature was 37℃ and the rotation speed was 200 rpm. The components and concentrations of the fermentation broth are as follows: 20 g / L glucose, 10 g / L peptone, 4 g / L yeast extract, 5 g / L beef extract, 10 g / L LMSG, 2 g / L K2HPO4, 0.1 g / L LMgSO4, 1 mL / L Tween 80, 3 g / L anhydrous sodium acetate, 2 g / L ammonium citrate, 0.033 g / L LnSO4·H2O, pH=6.5.

[0009] The third objective of this invention is to provide a *Lactobacillus gasseri* (Lactobacillus gasseri) Lactobacillus gasseriApplication of JY01 or its fermentation broth in the preparation of blood sugar lowering products.

[0010] The fourth objective of this invention is to provide a *Lactobacillus gasseri* (Lactobacillus gasseri) Lactobacillus gasseri Application of JY01 or its fermentation broth in the preparation of antioxidant products.

[0011] The fifth objective of this invention is to provide a *Lactobacillus gasseri* (Lactobacillus gasseri) Lactobacillus gasseri Application of JY01 or its fermentation broth in the preparation of products for regulating the gastrointestinal tract.

[0012] The beneficial technical effects achieved by this invention: This invention provides a strain of Lactobacillus gasseri (… Lactobacillus gasseri JY01 is a sample of pickled vegetables produced in Liaoning, China. After separation and purification, it has multiple functions such as high production of γ-aminobutyric acid (GABA), lowering blood sugar, anti-oxidation, and regulating the gastrointestinal tract. It has high application value and economic value. Attached Figure Description

[0013] Figure 1 This is a colony image of Lactobacillus gasseri JY01, one of the products of this invention; Figure 2 This is a phylogenetic tree of Lactobacillus gasseri JY01 according to the present invention; Figure 3 This is a bar chart showing the GABA production capacity of Lactobacillus gasseri JY01 according to the present invention, wherein 3A is the standard curve of GABA and 3B is the amount of GABA produced by Lactobacillus gasseri JY01 at different times. Figure 4 This is a bar chart illustrating the inhibition of α-amylase by Lactobacillus gasseri JY01, a product of the present invention. Figure 5 A bar chart showing the total antioxidant capacity of Lactobacillus gasseri JY01 according to the present invention; Figure 6 This is a curve showing the acid resistance of Lactobacillus gasseri JY01, a product of this invention. Figure 7 This is a bar chart of hydrophobic Lactobacillus gasseri JY01, a product of the present invention. Figure 8 This is a bar chart showing the self-coagulation ability of Lactobacillus gasseri JY01, a product of this invention. Detailed Implementation

[0014] The present invention will be further described below with reference to specific embodiments. These embodiments are only used to more clearly illustrate the technical solutions of the present invention and should not be construed as limiting the scope of protection of the present invention.

[0015] The present invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all obtainable through conventional commercial channels. The experimental materials involved in the following embodiments are as follows: Lactobacillus gasseri ( Lactobacillus gasseri JY01 strain: isolated from a kimchi sample produced in Liaoning, China, and stored in a glycerol tube at -78°C.

[0016] Lactobacillus gasseri ( Lactobacillus gasseri JY01 strain fermentation broth: The strain was inoculated onto MRS solid medium plates and incubated upside down in a 37℃ constant temperature anaerobic incubator for 24 hours to obtain colonies. Single colonies were picked and cultured in MRS liquid medium to obtain the fermentation broth.

[0017] MRS plate culture medium: 5g beef extract, 10g peptone, 4g yeast extract, 2g triammonium citrate, 3g anhydrous sodium acetate, 20g glucose·H2O, 2g dipotassium hydrogen phosphate, 1mL Tween 80, 0.2g MgSO4·7H2O, 0.037g manganese sulfate, 15g agar, add ROH2O to make up to 1L, adjust pH to 6.5, autoclave at 121℃ for 20min to prepare MRS plates.

[0018] MRS liquid culture medium: 5g beef extract, 10g peptone, 4g yeast extract, 2g triammonium citrate, 3g anhydrous sodium acetate, 20g glucose·H2O, 2g dipotassium hydrogen phosphate, 1mL Tween 80, 0.2g magnesium sulfate·MgSO4·7H2O, 0.037g manganese sulfate, add ROH2O to make up to 1L, adjust pH to 6.5, autoclave at 121℃ for 20min to prepare MRS liquid culture medium.

[0019] MRS slant culture medium: 5g beef extract, 10g peptone, 4g yeast extract, 2g triammonium citrate, 3g anhydrous sodium acetate, 20g glucose·H2O, 2g dipotassium hydrogen phosphate, 1mL Tween 80, 0.2g magnesium sulfate·MgSO4·7H2O, 0.037g manganese sulfate, add ROH2O to 1L, adjust pH to 6.5, autoclave at 121℃ for 20min, pour into a tilted test tube before the medium solidifies, and plug the mouth of the tube with cotton, allowing it to solidify to form the tilted culture medium.

[0020] Example 1 Lactobacillus gasseri ( Lactobacillus gasseri Isolation and identification of JY01 Lactobacillus gasseri JY01 was isolated from a sample of pickled vegetables produced in Liaoning, China. The specific process is as follows: One gram of pickled vegetables purchased from Liaoning Province was suspended in 9 mL of sterile physiological saline solution (NSS, 0.85% (w / v)) and homogenized to obtain a pickling bacteria suspension. One mL of this pickling bacteria suspension was then thoroughly mixed with 9 mL of sterile water to obtain 10... -2 Gradient, and so on, yielding 10 respectively. -3 10 -4 and 10 -5 The concentrations were determined. Using sterile pipettes, 100 μL of bacterial suspension from each serial dilution was taken and evenly spread onto MRS agar plates. The plates were incubated at 37°C for 2 days. Milky-white, raised colonies were selected, and single colonies were streaked onto fresh MRS agar plates and incubated at 37°C for 48 hours to obtain pure bacterial colonies. Results are as follows... Figure 1 As shown.

[0021] The obtained pure bacterial colonies were transferred to MRS slant agar, and the 16S rDNA of the strain was sequenced using universal 16S rDNA primers (SEQ ID NO: 2: F: AGAGTTTGATCCTGGCTCAG, SEQ ID NO: 2: R: TACGGCTACCTTGTTACGACTT). The gene sequence is shown in SEQ ID NO: 1, and a phylogenetic tree was constructed, as follows: Figure 2 As shown.

[0022] SEQ ID NO:1:

[0023] Example 2 Lactobacillus gasseri ( Lactobacillus gasseri )JY01's ability to produce γ-aminobutyric acid (GABA) was tested. 1) Construction of the γ-aminobutyric acid (GABA) standard curve: GABA standard solutions with mass concentrations of 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, 0.5 g / L, 0.6 g / L, 0.7 g / L, 0.8 g / L, 0.9 g / L, and 1.0 g / L were accurately prepared using ultrapure water. 0.5 ml of the standard solution was placed in an ice bath, and 0.2 ml of 0.2 mol / L (pH=9) borate buffer solution, 1 ml of phenol solution, and 0.4 ml of sodium hypochlorite solution were added. After thorough shaking, the mixture was reacted in a 100°C water bath for 7 min, followed immediately by ice bath cooling for 9 min. Once the liquid turned blue-green, 2 ml of distilled water was added, and the absorbance was measured at a wavelength of 630 nm. A standard curve was plotted with GABA concentration on the x-axis and absorbance on the y-axis, as shown below. Figure 3 As shown in 3A.

[0024] 2) Lactobacillus gasseri ( Lactobacillus gasseri Fermentation culture: Activated bacterial culture was inoculated into fermentation medium using MRS medium at an inoculation rate of 4%. Culture conditions were 37℃ and 200 rpm on a shaker. Every 24 hours, 1 mL of fermentation broth was collected, centrifuged at 5000 rpm for 3 minutes, and the supernatant was collected. The absorbance of the supernatant was measured at 630 nm. The absorbance values ​​were substituted into a standard curve to calculate the GABA content. A blank medium served as the control group. Results are as follows: Figure 3 As shown in 3B, at the start of fermentation, the GABA content gradually increases, reaching 1.94 g / L after 24 hours. However, after 48 hours, the GABA content decreases slightly to 1.38 g / L. Then, after 72 hours, the GABA content surges, reaching a high of 3.22 g / L after 96 hours of fermentation. Therefore, the optimal fermentation time is 96 hours, and the yield is 3.22 g / L. Thus, the *Lactobacillus gasseri* JY01 provided by this invention has a high GABA production capacity.

[0025] GABA can effectively improve sleep quality, lower blood ammonia levels, has anticonvulsant and antihypertensive effects, improves brain function, stabilizes mental state, promotes growth hormone secretion and enhances brain activity, accelerates brain metabolism, regulates airway allergic reactions, and has antitussive effects. Therefore, the Lactobacillus gasseri JY01 of this application can be used to prepare pharmaceuticals and related products that relieve or treat the above symptoms.

[0026] Example 3 Lactobacillus gasseri ( Lactobacillus gasseri )Detection of the blood sugar lowering ability of JY01 Lactobacillus gasseri ( Lactobacillus gasseri JY01 bacterial culture was inoculated into MRS liquid medium at an inoculum size of 4% and cultured at 37℃ and 200 rpm for 24 h to obtain the fermentation broth. 25 μL of the fermentation broth was mixed with 25 μL of 1 mg / mL α-amylase solution in a 1.5 mL centrifuge tube and incubated at 37℃ for 10 min. Then, 50 μL of 1.5% soluble starch was added, and the mixture was incubated at 37℃ for 15 min. The reaction was then terminated with 50 μL of DNS reagent. The reaction mixture was transferred to a 100℃ boiling water bath and incubated for 5 min. After cooling to room temperature, the mixture was transferred to a 96-well plate, and the absorbance (OD) at 540 nm was measured using a microplate reader. The inhibition rate of α-amylase by *Lactobacillus gasseri* JY01 was calculated using the standard curve method. The results are shown below. Figure 4 As shown. The formula for calculating the inhibition rate of α-amylase is as follows: α-Amylase inhibition rate (%) = (OD(540nm)) 初始 -OD(540nm) 检测点 ) / OD(540nm) 初始 from Figure 4 As can be seen, compared with the blank culture medium, the co-fermentation culture of Lactobacillus gasseri JY01 and α-amylase for 48 h showed an inhibition rate of 95.5% against α-amylase. Therefore, it can be concluded that Lactobacillus gasseri JY01 has a good ability to inhibit α-amylase and can be used in the preparation of hypoglycemic drugs, preparations and other related products.

[0027] Example 4 Lactobacillus gasseri ( Lactobacillus gasseri )Detection of antioxidant capacity of JY01 Lactobacillus gasseri in the stationary phase ( Lactobacillus gasseri JY01 was cultured in MRS liquid medium at an inoculum size of 4%. After 24 hours, the bacterial suspension was collected, and 200 μL of pre-cooled PBS was added. The suspension was then sonicated to fully disrupt the bacterial cells and release their internal antioxidant enzymes, vitamin C, vitamin E, and carotene. The supernatant was collected by centrifugation at 4°C, 12000 rpm, and for 5 minutes. The total antioxidant capacity of the fermentation broth was determined using a T-AOC (FRAR method) specific ELISA kit (TO1005). The T-AOC (FRAR method) detection principle is as follows: under acidic conditions, substances reduce Fe... 3+ - Tripyridine triazine (Fe 3+ -TPTZ) produces blue Fe 2+ The ability of -TPTZ reflects its total antioxidant capacity. Results are as follows: Figure 5As shown: the blank culture medium MRS has no antioxidant capacity, while the total antioxidant capacity of the fermentation broth of Lactobacillus gasseri strain JY01 is 0.6465 mmol / g, indicating that Lactobacillus gasseri strain JY01 has certain antioxidant properties and can scavenge activated oxygen and free radicals generated in the body.

[0028] Example 5 Lactobacillus gasseri ( Lactobacillus gasseri Detection of JY01's ability to regulate the gastrointestinal tract 1. Acid resistance test: Lactobacillus gasseri in the stable phase ( Lactobacillus gasseri JY01 was expanded into 50 ml LMR S liquid medium at pH values ​​of 6.5, 4.0, and 3.0, with an inoculum size of 4%. The medium was incubated at 37℃ and 200 rpm for 24 h. The OD (600 nm) values ​​were measured at 0 h, 6 h, 12 h, and 24 h. The concentration of Lactobacillus gasseri JY01 under different culture conditions was calculated using the standard curve method. Blank medium served as a control. Results are as follows: Figure 6 As shown, when Lactobacillus gasseri JY01 was grown in medium at pH=4 for 24 hours, its OD (600nm) was 1.55, while at pH=3 for 24 hours, its OD600 was still 0.6, with a survival rate of approximately 27%. This indicates that Lactobacillus gasseri JY01 has strong acid resistance and can survive in relatively acidic environments.

[0029] 2. Colonization Experiment: The Lactobacillus gasseri JY01 bacterial count in the late logarithmic phase was adjusted to an equivalent standard bacterial concentration (OD600nm = 1 ± 0.05, 1 x 10⁻⁶) using sterile phosphate-buffered saline. 8 The bacterial suspension was centrifuged (CFU / mL) at 12000 rpm for 10 min at 4°C. The bacterial pellet was washed twice with 0.1 mol / mL sterile phosphate-buffered saline (PBS) (pH 7.2 ± 0.2) and then resuspended in 0.1 mol / mL sterile phosphate-buffered saline (PBS). 3 mL of the bacterial suspension was transferred to 1 mL of xylene, incubated at room temperature for 10 min, rapidly vortexed for 2 min, and then incubated at room temperature for 20 min. After the mixture separated into layers, the lower aqueous phase was collected, and the absorbance at 600 nm was measured. The hydrophobicity of *Lactobacillus gasseri* JY01 was calculated using the formula: Hydrophobicity (%) = 1 - OD(600 nm). 检测点 / OD(600nm) 初始 The result is as follows Figure 7 As shown, the hydrophobicity of Lactobacillus gasseri JY01 was determined to be 22.32%, indicating that Lactobacillus gasseri JY01 can colonize the human gastrointestinal tract well.

[0030] 3. Adhesion test: Lactobacillus gasseri JY012 was incubated in MRS liquid medium for 37℃ for 4 hours. The bacterial count was then adjusted to an equal concentration of standard cells (A600 = 1 ± 0.05, 1 x 10⁻⁶) using sterile phosphate-buffered saline. 8 The bacterial cell pellet was collected by centrifugation at 4°C, 12000 rpm, and 10 min using 0.1 mol / mL sterile phosphate-buffered saline (pH = 7.2 ± 0.2). The pellet was washed twice with 0.1 mol / mL sterile phosphate-buffered saline and resuspended. It was then incubated at room temperature for 0 h, 2 h, 4 h, and 6 h, and the absorbance at 600 nm was measured. The autocoagulation rate of *Lactobacillus gasseri* JY01 was calculated using the formula: Autocoagulation rate (%) = 1 - OD(600 nm) 检测点 / OD(600nm) 初始 The result is as follows Figure 8 As shown, the autoaggregation rate of Lactobacillus gasseri JY01 strain reached 16.7% after 6 hours of incubation. The autoaggregation ability of bacteria has a significant impact on bacterial adhesion to intestinal cells, and coagulation eliminates the colonization of gastrointestinal pathogens by preventing pathogens from attaching to host tissues, indicating that this strain has a good ability to clear pathogens.

[0031] The present invention has been disclosed above with reference to preferred embodiments, but it is not intended to limit the present invention. All technical solutions obtained by adopting equivalent substitutions or equivalent transformations fall within the protection scope of the present invention.

Claims

1. A type of Lactobacillus gasseri ( Lactobacillus gasseri JY01, characterized in that: The Lactobacillus gasseri ( Lactobacillus gasseri JY01 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on May 21, 2025, with accession number GDMCC NO. 66341.

2. The Lactobacillus gasseri as described in claim 1 ( Lactobacillus gasseri The application of JY01 or its fermentation broth in the preparation of γ-aminobutyric acid is characterized by: The fermentation method of the fermentation broth is as follows: S1 Lactobacillus gasseri ( Lactobacillus gasseri JY01 was activated in MRS medium; S2. The activated bacterial solution is inoculated into a shake flask and fermented for 24-96 hours. The culture temperature was 37℃ and the rotation speed was 200 rpm. The components and concentrations of the fermentation broth are as follows: 20 g / L glucose, 10 g / L peptone, 4 g / L yeast extract, 5 g / L beef extract, 10 g / L LMSG, 2 g / L K2HPO4, 0.1 g / L LMgSO4, 1 mL / L Tween 80, 3 g / L anhydrous sodium acetate, 2 g / L ammonium citrate, 0.033 g / L LnSO4·H2O, pH=6.

5.

3. The Lactobacillus gasseri as described in claim 1 ( Lactobacillus gasseri Application of JY01 or its fermentation broth in the preparation of hypoglycemic drugs.

4. The Lactobacillus gasseri as described in claim 1 ( Lactobacillus gasseri Application of JY01 or its fermentation broth in the preparation of antioxidant products.

5. The Lactobacillus gasseri as described in claim 1 ( Lactobacillus gasseri Application of JY01 or its fermentation broth in the preparation of products for regulating the gastrointestinal tract.

Images