Use of leucine-rich repeat membrane protein-15 in preparation of anti-cardiomyocyte pyroptosis drugs

By applying leucine-enriched repeatable membrane protein-15 (LRRC15) and its viral vector, pyroptosis of cardiomyocytes after myocardial infarction was inhibited, solving the problem of cardiac function damage after myocardial infarction and achieving the recovery of cardiac function and improvement of patients' quality of life.

CN120678889BActive Publication Date: 2026-07-21ZHEJIANG UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2025-05-20
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Currently, there are no effective drugs to inhibit pyroptosis of myocardial cells after myocardial infarction, which leads to cardiac function damage and scar repair, affecting the patient's quality of life.

Method used

By using leucine-enriched repeat membrane protein-15 (LRRC15) and its related viral vectors, the cleaved caspase3/GSDME pathway was inhibited through overexpression or knockout of the LRRC15 gene, thereby reducing cardiomyocyte pyroptosis and promoting cardiac function recovery.

Benefits of technology

LRRC15 significantly reduces pyroptosis of cardiomyocytes after myocardial infarction, improves cardiac function recovery, provides a new intervention target for the treatment of myocardial infarction, and improves the quality of life of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120678889B_ABST
    Figure CN120678889B_ABST
Patent Text Reader

Abstract

The application relates to the field of biological medicine, and discloses application of leucine-rich repeat membrane protein-15 in preparation of anti-cardiomyocyte pyroptosis drugs. The application first finds that the leucine-rich repeat membrane protein-15 has the effect of inhibiting cardiomyocyte pyroptosis, and in particular can reduce cardiomyocyte pyroptosis after acute myocardial infarction, thereby providing a new intervention target for treating acute myocardial infarction and promoting recovery of heart function. The application provides a new drug and treatment scheme for clinical treatment, and has important significance for improving the clinical treatment effect of myocardial infarction diseases and improving the life quality of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more particularly to the application of leucine-enriched repeatable membrane protein-15 in the preparation of anti-myocardial pyroptosis drugs. Background Technology

[0002] When an acute myocardial infarction occurs, the myocardial tissue below the blocked blood vessel lacks blood supply, leading to ischemic death of the myocardial tissue, impaired cardiac function, and even malignant arrhythmias and cardiac rupture, ultimately causing the patient's death. Although percutaneous coronary intervention can significantly reduce mortality after acute myocardial infarction, myocardial cell death always occurs after a myocardial infarction, eventually leading to scar repair, reduced cardiac function, and placing a huge burden on patients and their families.

[0003] Cardiovascular disease is the leading cause of death among urban and rural residents, with myocardial infarction being one of the primary causes of death from cardiovascular disease. Therefore, inhibiting myocardial cell death after myocardial infarction is of great value in promoting myocardial repair and preserving cardiac function. However, there are currently no effective drugs to inhibit myocardial death after myocardial infarction. Therefore, developing drugs to treat myocardial death after myocardial infarction has significant social and economic benefits and promising application prospects.

[0004] Leucine-enriched repeat membrane protein-15 (LRRC15) is an important member of the leucine-enriched repeat (LRR) family. It is a type I transmembrane protein, with approximately 500-550 amino acids involved in protein-protein interactions extracellularly, 20-25 amino acids in the transmembrane region, and 50-100 amino acids involved in intracellular signal transduction. It is named for the 15 leucine-enriched repeat fragments contained in its extramembrane portion. LRRC15 plays a crucial role in tumor cell invasion, migration, and stem cell differentiation. In tumor tissues, LRRC15... + Tumor stromal fibroblasts (CAF) can inhibit CD8 + T-cell immune responses promote tumor growth, and eliminating LRRC15+ CAF enhances the efficacy of tumor immunotherapy (CN115943165A). Intravenous injection of the monoclonal antibody ABBV-085, which targets LRRC15, can significantly improve survival time in osteosarcoma and undifferentiated pleomorphic sarcoma, with some patients achieving partial remission. However, the role of LRRC15 in the heart has not yet been reported.

[0005] Pyroptosis is one of the important modes of cell death. The molecular signaling pathways that cause pyroptosis include: (1) activation of cleaved caspase 1 / 11, which cleaves GSDMD in the Gasdermins family, causing the N-terminus of GSDMD (NT-GSDMD) to form a gap in the cell membrane, leading to pyroptosis; (2) activation of cleaved caspase 3, which cleaves GSDME in the Gasdermins family, causing the N-terminus of GSDME (NT-GSDME) to form a gap in the cell membrane, leading to pyroptosis. Studies have found that myocardial cell pyroptosis can be caused by myocardial infarction, and inhibiting myocardial pyroptosis can partially restore cardiac function. However, no drugs that inhibit pyroptosis have been found for clinical treatment of myocardial infarction. Therefore, studying drugs to inhibit the above pathways and reduce myocardial pyroptosis in the treatment of acute myocardial infarction has great application potential. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides the application of leucine-enriched repeatable membrane protein-15 in the preparation of anti-pyroptosis drugs. This invention is the first to discover that leucine-enriched repeatable membrane protein-15 has an inhibitory effect on cardiomyocyte pyroptosis, particularly reducing cardiomyocyte pyroptosis after acute myocardial infarction, providing a new intervention target for promoting cardiac function recovery after acute myocardial infarction.

[0007] The specific technical solution of this invention is as follows: In a first aspect, the present invention provides the application of leucine-enriched repeatable membrane protein-15 (LRRC15) in the preparation of anti-myocardial pyroptosis drugs.

[0008] This invention is the first to discover that leucine-enriched repeatable membrane protein-15 has an inhibitory effect on cardiomyocyte pyroptosis. Specifically, using in vitro cardiomyocyte hypoxia models and in vivo myocardial infarction models, this invention found that overexpression of LRRC15 can inhibit cardiomyocyte pyroptosis and promote the recovery of cardiac function after myocardial infarction.

[0009] Furthermore, the myocardial pyroptosis refers to myocardial pyroptosis that occurs after myocardial infarction.

[0010] Secondly, the present invention provides the application of leucine-enriched repeatable membrane protein-15 in the preparation of drugs for the treatment of myocardial infarction.

[0011] This invention discovers that leucine-enriched repeat membrane protein-15 can reduce pyroptosis of cardiomyocytes after acute myocardial infarction, and therefore can be used to treat myocardial infarction. This provides a new intervention target for promoting the recovery of cardiac function after acute myocardial infarction.

[0012] Furthermore, the myocardial infarction is an acute myocardial infarction.

[0013] Furthermore, the drug comprises leucine-enriched repeatable membrane protein-15, and pharmaceutically acceptable carriers and / or excipients.

[0014] Furthermore, the drug is a pharmaceutical preparation administered by injection, oral administration, nasal mucosa, lung, rectum, oral mucosa, or skin; even further, the injection includes intramyocardial injection, intradermal injection, subcutaneous injection, intramuscular injection, and intravenous injection.

[0015] Thirdly, the present invention provides the use of adenoviruses and / or adeno-associated viruses that overexpress leucine-enriched repeat membrane protein-15 in the preparation of anti-pyroptosis drugs.

[0016] Fourthly, the present invention provides the use of adenoviruses and / or adeno-associated viruses that overexpress leucine-enriched repeat membrane protein-15 in the preparation of drugs for the treatment of myocardial infarction.

[0017] By inserting the leucine-enriched repeat membrane protein-15 gene sequence into a viral vector and transfecting it, overexpression of leucine-enriched repeat membrane protein-15 in cardiomyocytes can be achieved, thereby playing a role in anti-myocardial pyroptosis or treating myocardial infarction.

[0018] Furthermore, the adenovirus and / or adeno-associated virus overexpressing leucine-enriched repeat membrane protein-15 is a viral vector with an inserted leucine-enriched repeat membrane protein-15 gene sequence.

[0019] Fifthly, this invention provides the application of leucine-enriched repeatable membrane protein-15 gene as a target in screening anti-pyroptosis drugs or drugs for the treatment of myocardial infarction.

[0020] Since this invention has discovered a high correlation between the leucine-enriched repeat membrane protein-15 gene and myocardial pyroptosis and myocardial infarction, it can be used alone or in combination with other related targets to screen for drugs that can overexpress the leucine-enriched repeat membrane protein-15 gene, thereby serving as anti-pyroptosis drugs and myocardial infarction treatment drugs.

[0021] In a sixth aspect, the present invention provides a method for inhibiting pyroptosis of cardiomyocytes under in vitro conditions, comprising: adding leucine-enriched repeat membrane protein-15 and / or an adenovirus overexpressing leucine-enriched repeat membrane protein-15 to an in vitro cardiomyocyte culture system, thereby inhibiting in vitro cardiomyocyte pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0022] This invention discovers that by applying leucine-enriched repeat membrane protein-15 (LEP-15) or an adenovirus overexpressing LEP-15 to cardiomyocytes in vitro, the content of LEP-15 in cardiomyocytes can be increased, thereby inhibiting pyroptosis of cardiomyocytes in vitro by suppressing the cleaved caspase3 / GSDME pathway. Therefore, LEP-15 or an adenovirus overexpressing LEP-15 can serve as a research tool.

[0023] Furthermore, leucine-enriched repeat membrane protein-15, adenoviruses overexpressing leucine-enriched repeat membrane protein-15, and adeno-associated viruses can serve as inhibitors of the cleaved caspase3 / GSDME pathway.

[0024] In a seventh aspect, the present invention provides the application of the leucine-enriched repeat membrane protein-15 gene in constructing a myocardial pyroptosis model: knocking out or knocking down the leucine-enriched repeat membrane protein-15 gene in in vitro or in vivo cardiomyocytes, activating the cleaved caspase3 / GSDME pathway, thereby obtaining a myocardial pyroptosis model.

[0025] By reducing the expression of the leucine-rich repeat membrane protein-15 gene in cardiomyocytes, the cleavedcaspase3 / GSDME pathway can be activated, thereby obtaining a model of myocardial pyroptosis.

[0026] Eighthly, the present invention provides a method for constructing an in vitro model of myocardial pyroptosis, comprising: knocking out or knocking down the leucine-enriched repeat membrane protein-15 gene of in vitro cardiomyocytes, culturing the in vitro cardiomyocytes, and promoting myocardial cell pyroptosis by activating the cleaved caspase3 / GSDME pathway, thereby obtaining an in vitro model of myocardial pyroptosis.

[0027] Compared with the prior art, the beneficial effects of the present invention are: This invention is the first to discover that leucine-enriched repeatable membrane protein-15 has an inhibitory effect on cardiomyocyte pyroptosis, particularly reducing pyroptosis after acute myocardial infarction, providing a new intervention target for promoting cardiac function recovery after acute myocardial infarction. This offers new drugs and treatment options for clinical treatment, and is of great significance for improving the clinical treatment effect of myocardial infarction and improving the quality of life of patients. Attached Figure Description

[0028] Figure 1 The results of pyroptosis in neonatal mouse cardiomyocytes induced by overexpression of LRRC15 adenovirus under a hypoxic-ischemic model were obtained using Sytox staining. A is a light micrograph of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of each group of cells.

[0029] Figure 2 The results of Western blot analysis were obtained for protein expression in neonatal rat cardiomyocytes after overexpression of LRRC15 adenovirus and induction of pyroptosis under hypoxic-ischemic conditions. AB shows the expression and statistical graph of pyroptosis proteins (cleaved caspase3, GSDME, NT-GSDME) in neonatal rat cardiomyocytes under hypoxic-ischemic conditions. CD shows the expression of pyroptosis proteins in neonatal rat cardiomyocytes after pyroptosis induced by hypoxic-ischemic conditions following overexpression of LRRC15.

[0030] Figure 3 Four-week-old mice were injected via tail vein injection with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15). OE ) and its control virus (AAV9-LRRC15) OENC A myocardial infarction model was established, and the results of cardiac function in mice were statistically analyzed using echocardiography 3 days later; A is a Doppler ultrasound image of the mouse heart, with white arrows representing the size of the mouse heart chambers; B is a statistical graph of mouse cardiac function (EF, FS, LVIDd, LVIDs).

[0031] Figure 4 Four-week-old mice were injected via tail vein injection with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15). OE ) and its control virus (AAV9-LRRC15) OENC A myocardial infarction model was established, and samples were collected 3 days later for TTC staining to observe the results of myocardial infarction area in mice; A is a gross image of the mouse heart after myocardial infarction, with white representing the myocardial infarction area and red representing the non-myocardial infarction area; B is a statistical chart of myocardial infarction area in mice.

[0032] Figure 5 We transfected neonatal rat cardiomyocytes with siLRRC15 to knock down LRRC15. After 48 hours of in vitro culture, we used Western blot to detect the expression and statistical graph of pyroptosis proteins (cleaved caspase3, GSDME, NT-GSDME) in cardiomyocytes.

[0033] Figure 6 The results of sytox staining of dead cells in neonatal mouse cardiomyocytes transfected with siLRRC15 and cultured for 48 hours are shown. A is a light micrograph of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of each group of cells.

[0034] Figure 7The results of echocardiography were used to statistically analyze the cardiac function of mice in the whole-gene LRRC15 knockout mice (LRRC15 KO) and their age-matched wild-type control mice. A is a Doppler echocardiogram of the mouse heart, with white arrows representing the size of the mouse heart chambers. B is a statistical graph of the mouse cardiac function (EF, FS, LVIDd, LVIDs). Detailed Implementation

[0035] The present invention will be further described below with reference to embodiments. The terminology used in the embodiments of the present invention is for describing specific implementations and not for limiting the scope of protection of the present invention. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention, and the scope of protection of the present invention is defined by the appended claims and any equivalents thereof.

[0036] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; the reagents and biological materials described are commercially available unless otherwise specified.

[0037] General Implementation Examples In a first aspect, the present invention provides the application of leucine-enriched repeating membrane protein-15 in the preparation of anti-myocardial pyroptosis drugs.

[0038] Furthermore, the myocardial pyroptosis refers to myocardial pyroptosis that occurs after myocardial infarction.

[0039] Secondly, this invention provides the application of leucine-enriched repeatable membrane protein-15 in the preparation of a therapeutic agent for myocardial infarction. Further, the myocardial infarction is acute myocardial infarction.

[0040] Further, the drug comprises leucine-enriched repeatable membrane protein-15, and a pharmaceutically acceptable carrier and / or excipient. Further still, the drug is a pharmaceutical preparation for administration by injection, oral administration, nasal mucosa, lung, rectum, oral mucosa, or skin; further still, the injection includes intramyocardial injection, intradermal injection, subcutaneous injection, intramuscular injection, and intravenous injection.

[0041] Thirdly, the present invention provides the use of adenoviruses and / or adeno-associated viruses that overexpress leucine-enriched repeat membrane protein-15 in the preparation of anti-pyroptosis drugs.

[0042] Fourthly, the present invention provides the use of adenoviruses and / or adeno-associated viruses that overexpress leucine-enriched repeat membrane protein-15 in the preparation of drugs for the treatment of myocardial infarction.

[0043] Furthermore, the adenovirus and / or adeno-associated virus overexpressing leucine-enriched repeat membrane protein-15 is a viral vector with an inserted leucine-enriched repeat membrane protein-15 gene sequence.

[0044] Fifthly, this invention provides the application of leucine-enriched repeatable membrane protein-15 gene as a target in screening anti-pyroptosis drugs or drugs for the treatment of myocardial infarction.

[0045] In a sixth aspect, the present invention provides a method for inhibiting pyroptosis of cardiomyocytes under in vitro conditions, comprising: adding leucine-enriched repeat membrane protein-15 and / or an adenovirus overexpressing leucine-enriched repeat membrane protein-15 to an in vitro cardiomyocyte culture system, thereby inhibiting in vitro cardiomyocyte pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0046] Furthermore, leucine-enriched repeat membrane protein-15, adenoviruses overexpressing leucine-enriched repeat membrane protein-15, and adeno-associated viruses can serve as inhibitors of the cleaved caspase3 / GSDME pathway.

[0047] In a seventh aspect, the present invention provides the application of the leucine-enriched repeat membrane protein-15 gene in constructing a myocardial pyroptosis model: knocking out or knocking down the leucine-enriched repeat membrane protein-15 gene in in vitro or in vivo cardiomyocytes, activating the cleaved caspase3 / GSDME pathway, thereby obtaining a myocardial pyroptosis model.

[0048] Eighthly, the present invention provides a method for constructing an in vitro model of myocardial pyroptosis, comprising: knocking out or knocking down the leucine-enriched repeat membrane protein-15 gene of in vitro cardiomyocytes, culturing the in vitro cardiomyocytes, and promoting myocardial cell pyroptosis by activating the cleaved caspase3 / GSDME pathway, thereby obtaining an in vitro model of myocardial pyroptosis. Specific Implementation Example 1: LRRC15 overexpressing adenovirus (AD-LRRC15) OE ) and its control virus (AD-LRRC15) OENC Preparation of ) Adenovirus packaging was performed using the AdMax adenovirus packaging system established by Professor Frank L. Graham. HEK293 cells were co-transfected with an adenovirus shuttle plasmid carrying the LRRC15 gene and an helper packaging plasmid lacking most of the adenovirus genome (E1 / E3 deletion). The Cre-loxP recombinase digestion system was then used to generate a non-replicating recombinant adenovirus carrying the foreign gene. The steps are as follows: (1) Construction and amplification of recombinant plasmid: The vector plasmid GV314 was selected, with the element sequence CMV-MCS-3FLAG-SV40-EGFP. The vector was digested with restriction endonucleases and fused with the DNA fragment of LRRC15 to construct the recombinant plasmid. The primers for LRRC15 amplification were: P1: AGGTCGACTCTAGAGGATCCCGCCACCATGCCCGTGAAACATTATCTC; P2:TCCTTGTAGTCCATACCGGTGCACTCATTGGGAGCCTTCATCTG.

[0050] The recombinant plasmid was transformed into competent cells for amplification and extraction.

[0051] (2) Adenovirus amplification: a. Adenovirus overexpression packaging: The recombinant plasmid expressing LRRC15 and the helper packaging plasmid pBHGloxdeltaE1,3Cre (Microbix. Canada, sequence download website: http: / / www.microbix.com / Plasmid-Sequences / pBHGloxdeltaE13Cre.zip) were co-transfected into HEK293 cells. When HEK293 cells showed cytopathic effect (CPE) under a microscope, with 50% of cells detaching from the cell wall, the cells were collected by low-speed centrifugation and resuspended in 2 ml DMEM. The cells were then subjected to repeated freeze-thaw cycles at -70℃ / 37℃ with shaking three times, followed by centrifugation at 4℃ and 7000 g for 5 min. The viral supernatant was collected to obtain the first round of viral packaging solution. The obtained cell supernatant was added to more HEK293 cell culture medium to infect cells again. The cells were collected by low-speed centrifugation again and resuspended in 10 ml DMEM. The cells were then subjected to repeated freeze-thaw cycles at -70℃ / 37℃ with shaking three times, followed by centrifugation at 4℃ and 7000 g for 5 min. min, to obtain the original virus solution.

[0052] b. Packaging of the control virus overexpressing adenovirus: The control plasmid expressing the LRRC15 recombinant plasmid and the helper packaging plasmid pBHGloxdeltaE1,3Cre (Microbix. Canada, sequence download website: http: / / www.microbix.com / Plasmid-Sequences / pBHGloxdeltaE13Cre.zip) were co-transfected into HEK293 cells. When HEK293 cells showed cytopathic effect (CPE) under a microscope, with 50% of the cells detaching from the cell wall, the cells were collected by low-speed centrifugation and resuspended in 2 ml DMEM. The cells were then subjected to repeated freeze-thaw cycles at -70℃ / 37℃ with shaking for 3 times, followed by centrifugation at 4℃ and 7000 g for 5 min. The viral supernatant was collected to obtain the first round of packaging virus stock solution. The obtained cell supernatant was added to more HEK293 cell culture medium to infect the cells again. The cells were collected by low-speed centrifugation again and resuspended in 10 ml DMEM. The cells were then subjected to repeated freeze-thaw cycles at -70℃ / 37℃ with shaking for 3 times, followed by centrifugation at 4℃ and 7000 g for 5 min. Centrifuge at 7000 g for 5 min at ℃ to obtain the original virus solution.

[0053] (3) Adenovirus purification: Purification was performed using the Adeno-X™ Virus Purification Kit (BD Biosciences): (a) Take out the BD Adeno-X purification device, filter 10 ml of crude virus extract through a 0.45 μm filter membrane, and store the filtrate in a collection bottle; (b) Add 4 μl of 25 U / μl Benzonase to the virus filtrate, mix well, incubate at 37°C for 30 min, then add 10 ml of 1×dilution buffer and mix well. (c) Assemble the filtration device. After using sterile PBS to purge the air from the filter and the cannula, insert the cannula into the virus filtrate in the collection bottle. Pull the syringe outward at a speed of 5 ml / min to allow the virus filtrate to flow through the filter. (d) Use 1×Wash Buffer to wash the filter; (e) Elute adenovirus using a 5 ml BD Luer-Lok syringe: Draw 3 ml of 1×Elution Buffer into the syringe; connect the syringe and filter notch, push 1 ml of Elution Buffer through the filter into a 5 ml sterile centrifuge tube; incubate the filter at room temperature for 5 min, then push the remaining Elution Buffer through the filter to collect the remaining adenovirus.

[0054] Example 2: LRRC15 overexpression of adeno-associated virus (AAV9-LRRC15) OE) and its control virus (AAV9-LRRC15) OENC Preparation of ) The Gilead AAV Helper-Free System, consisting of three plasmids—a viral vector, a pAAV-RC vector, and a pHelper vector—was used. The steps are as follows: (1) Construction and amplification of recombinant plasmid: The vector plasmid GV571 was selected, with the element sequence cTNTp-MCS-3Flag-T2A-EGFP. The vector was digested with restriction endonucleases and fused with the DNA fragment of LRRC15 to construct the recombinant plasmid. The primers for LRRC15 amplification were: P1: AGGTCGACTCTAGAGGATCCCGCCACCATGCCCGTGAAACATTATCTC; P2:TCCTTGTAGTCCATACCGGTGCACTCATTGGGAGCCTTCATCTG.

[0055] The recombinant plasmid was transformed into competent cells for amplification and extraction.

[0056] (2) Amplification of adeno-associated virus: a. Packaging of adeno-associated virus overexpressing LRRC15: The recombinant plasmid expressing LRRC15, pHelper (carrying adenovirus-derived genes), and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging). The adeno-associated virus collection procedure was the same as that for adenovirus collection.

[0057] b. Packaging of control virus overexpressing LRRC15 adeno-associated virus: The control plasmid expressing LRRC15 recombinant plasmid, pHelper (carrying adenovirus-derived genes), and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). The adeno-associated virus collection procedure was the same as that for adenovirus collection.

[0058] (3) Purification of adeno-associated virus: (a) Add solid CsCl to the virus concentrate until the density is 1.41 g / ml (refractive index 1.372), which is approximately 6.5 g of CsCl per 10 ml of virus solution. Shake to dissolve. The dissolution of CsCl will absorb heat and generate cold. (b) Add the sample to the ultracentrifuge tube and fill the remaining space of the tube with the pre-prepared 1.41 g / ml CsCl solution; (c) Centrifuge at 175,000 g for 24 hours to establish a density gradient. Collect samples of different densities sequentially and perform titer determination. Collect the fraction enriched with AAV particles; (d) Repeat the above process once; (e) The virus stock solution obtained by concentration using the Amicon-15 ultrafiltration device was mixed with glycerol to make the concentration 5%.

[0059] Example 3: LRRC15 reduces cardiomyocyte death in neonatal rats.

[0060] Primary cardiomyocytes from lactating mice were isolated, cultured in high-glucose DMEM medium containing 10% fetal bovine serum, and transfected with AD-LRRC15. OENC (Control virus overexpressing LRRC15 adenovirus, prepared in Example 1) Adenovirus and AD-LRRC15 OE Adenovirus (prepared in Example 1) was cultured for 48 hours, then replaced with serum-free medium containing 10 nM SYTOX GREEN staining solution, and cultured in an oxygen-deficient incubator at 0.5% oxygen concentration for 12 hours. The hypoxic cells were then removed and photographed using a fluorescence microscope.

[0061] Figure 1 This image shows the results of pyroptosis induced in neonatal mouse cardiomyocytes under a hypoxic-ischemic (HD) model after overexpression of LRRC15 adenovirus, followed by Sytox staining of dead cells. In the image, A is a light micrograph of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of cells in each group, showing the proportion of red fluorescent cells in the total number of cells in the field of view. The results indicate that under the HD model, cardiomyocyte death was significantly reduced in the LRRC15 adenovirus overexpression group compared to the LRRC15 adenovirus overexpression control group, suggesting that LRRC15 reduces cardiomyocyte death in neonatal mice.

[0062] Example 4: LRRC15 reduces myocardial pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0063] Primary cardiomyocytes from lactating mice were isolated and evenly seeded in 12-well plates. The cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum and transfected with AD-LRRC15. OENC (Control virus overexpressing LRRC15 adenovirus, prepared in Example 1) Adenovirus and AD-LRRC15 OEAdenovirus (prepared in Example 1) was cultured for 48 hours, then replaced with serum-free medium and cultured in a 0.5% hypoxic incubator for another 48 hours. The culture supernatant was discarded, and the cells were gently washed twice with PBS buffer. 100 μL / well of RIPA cell lysis buffer containing a protease phosphatase inhibitor was added. The cells were incubated on ice for 5 minutes, and protein was scraped into 1.5 ml EP tubes using a cell scraper. The tubes were then lysed on ice for 15 minutes, followed by centrifugation at 12,000 g for 30 minutes at 4°C. 90 μL of the supernatant was transferred to a new EP tube for BCA protein concentration determination. After protein concentration determination, the protein was diluted to the same concentration using SDS-Page loading buffer. The protein was then boiled in a 98°C metal bath for 10 minutes. Western blot protein electrophoresis and membrane transfer were then performed. After transfer, the membrane was blocked with PBST solution containing 5% skim milk for 1 hour. Then, primary antibodies against cleaved caspase 3 (CST, 9661s) and GSDME (abcam, ab215191) were prepared at a 1:1000 volume ratio using primary antibody dilution buffer and incubated overnight at 4°C. The membrane was washed four times with PBST for 7 minutes each time. Then, the prepared HRP-conjugated secondary antibody was added and incubated at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each time. Finally, band imaging was performed using ECL developing solution. The Actin internal control was incubated with HRP direct-labeled antibody (1:55000 dilution) at room temperature for 1 hour, washed four times with PBST for 7 minutes each time, and then band imaging was performed using developing solution. Grayscale values ​​were calculated using Bio-RadImage Lab Software 6.1.

[0064] Figure 2 The results of protein expression were detected by Western blot after overexpressing LRRC15 adenovirus in neonatal rat cardiomyocytes and inducing pyroptosis in a hypoxic-ischemic model. Figure 2 In the figures, AB shows the expression and statistical graph of pyroptosis proteins (cleaved caspase3, GSDME, and NT-GSDME) in neonatal mouse cardiomyocytes under hypoxic-ischemic conditions. CD shows the expression of pyroptosis proteins in neonatal mouse cardiomyocytes after hypoxic-ischemic pyroptosis induced by LRRC15 overexpression. It can be seen that in the HD model, cleaved caspase3 and NT-GSDME were significantly increased, indicating that pyroptosis mediated by cleaved caspase3 / GSDME occurred in cardiomyocytes. However, after LRRC15 overexpression, cleaved caspase3 and NT-GSDME were significantly reduced compared to the control group, indicating that LRRC15 reduces cardiomyocyte pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0065] Example 5: LRRC15 overexpression improves the recovery of cardiac function after myocardial infarction.

[0066] Four-week-old male C57 mice were injected via the tail vein with AAV9-LRRC15 prepared with physiological saline. OENC Adeno-associated virus (a control virus overexpressing LRRC15 adeno-associated virus, prepared in Example 2) and AAV9-LRRC15 OE Adeno-associated virus (prepared in Example 2) (1*10) ^12 (per mouse). Four weeks later, mice were anesthetized with 2% pentobarbital, endotracheally intubated, the skin of the anterior chest region was cut open, the muscles were bluntly dissected, and the heart was exposed using a chest support. The left anterior descending coronary artery was ligated with 7-0 silk suture until the apex of the heart turned white and the electrocardiogram showed ST segment elevation, indicating a successful myocardial infarction model. The rib cage and skin were then sutured. The mice were fed for another 3 days, and Doppler echocardiography of the mouse heart was collected using a mouse echocardiogram machine. The ejection fraction (EF), free speed (FS), lower LVIDs (LVIDd), and lower LVIDs (LVIDs) were then calculated and statistically analyzed.

[0067] Figure 3 Four-week-old mice were injected via tail vein injection with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15). OE ) and its control virus (AAV9-LRRC15) OENC A myocardial infarction model was established, and the results of cardiac function in mice were statistically analyzed using echocardiography 3 days later. Figure 3 In the image, A is a Doppler ultrasound image of the mouse heart, with white arrows representing the size of the mouse's heart chambers. B is a statistical graph of mouse cardiac function (EF, FS, LVIDd, LVIDs). The study found that the NS group and AAV9-LRRC15 showed improvement after myocardial infarction. OENC The cardiac function of the mice in the group was significantly reduced, while AAV9-LRRC15 OE The cardiac function of the mice in this group was higher than that in the previous two groups. This indicates that LRRC15 can improve the recovery of cardiac function after myocardial infarction.

[0068] Example 6: Overexpression of LRRC15 reduces the area of ​​myocardial infarction after myocardial infarction.

[0069] Four-week-old male C57 mice were injected via the tail vein with AAV9-LRRC15 prepared with physiological saline. OENC Adeno-associated virus (a control virus overexpressing LRRC15 adeno-associated virus, prepared in Example 2) and AAV9-LRRC15 OE Adeno-associated virus (prepared in Example 2) (1*10) ^12(Per mouse), after 4 weeks, mice were anesthetized with 2% pentobarbital, endotracheally intubated, the skin of the anterior chest region was cut open, the muscles were bluntly dissected, and the heart was exposed using a chest support. The anterior descending coronary artery of the mouse was ligated with 7-0 silk suture until the apex of the heart turned white and the electrocardiogram showed ST segment elevation, indicating a successful myocardial infarction model. Then the rib cage and skin were sutured. The mice were kept in the thorax for another 3 days. After echocardiography, the mice were anesthetized and sacrificed. The thoracic cavity was opened and the heart was perfused with PBS. Using a mouse heart slice mold, transverse slices of the heart were made, with a thickness of 1 mm. The heart slices were immersed in 2% red tetrazolium solution and incubated at 37°C in the dark for 30 minutes, with the container gently shaken every 5 minutes to ensure thorough staining. The heart slices were then removed, fixed in 4% formaldehyde, and photographed using a stereomicroscope. White areas represent myocardial infarction areas, and red areas represent non-myocardial infarction areas. The percentage of white areas in the total area was calculated.

[0070] Figure 4 Four-week-old mice were injected via tail vein injection with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15). OE ) and its control virus (AAV9-LRRC15) OENC A myocardial infarction model was established, and samples were taken 3 days later for TTC staining to observe the infarct area in mice. Figure 4 In the diagram, A shows a gross cardiac image of a mouse after myocardial infarction, with white representing the infarcted area and red representing the non-infarcted area. B is a statistical chart of the infarcted area in mice. AAV9-LRRC15 was found after myocardial infarction. OENC The infarct area was significantly larger in the NS group mice than in the AAV9-LRRC15 group mice. OE The infarct area was significantly reduced in the group. This indicates that overexpression of LRRC15 can significantly reduce the infarct area after myocardial infarction.

[0071] Example 7: Knockdown of LRRC15 activates the cleaved caspase3 / GSDME pathway, promoting myocardial pyroptosis.

[0072] Primary cardiomyocytes from lactating mice were isolated and evenly seeded in 12-well plates. The cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum. The cells were transfected with siRNA to knock down LRRC15 and its control siRNA NC (siLRRC15 and siLRRC15NC). After 48 hours of culture, the culture supernatant was discarded, and the cells were gently washed twice with PBS buffer. 100 μL / well of RIPA cell lysis buffer containing a protease phosphatase inhibitor was added. The cells were incubated on ice for 5 minutes, and protein was scraped into 1.5 ml EP tubes using a cell scraper. The tubes were then lysed on ice for 15 minutes. After centrifugation at 12,000 g for 30 minutes at 4°C, 90 μL of the supernatant was transferred to a new EP tube for BCA protein concentration determination. After protein concentration determination, the protein was diluted to the same concentration with SDS-Page loading buffer. The protein was then boiled in a metal bath at 98°C for 10 minutes. Western blot protein electrophoresis and membrane transfer were then performed. After transfer, the membrane was blocked with PBST solution containing 5% skim milk for 1 hour. Then, primary antibodies against cleaved caspase 3 (CST, 9661s) and GSDME (abcam, ab215191) were prepared at a 1:1000 volume ratio using primary antibody dilution buffer and incubated overnight at 4°C. The membrane was washed four times with PBST for 7 minutes each time. Then, the prepared HRP-conjugated secondary antibody was added and incubated at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each time. Finally, band imaging was performed using ECL developing solution. The Actin internal control was incubated at room temperature for 1 hour with HRP direct-labeled antibody (1:55000 dilution), washed four times with PBST for 7 minutes each time, and then band imaging was performed using developing solution. Grayscale values ​​were calculated using Bio-Rad Image Lab Software 6.1.

[0073] Figure 5 Rat cardiomyocytes were transfected with siLRRC15 to knock down LRRC15. After 48 hours of in vitro culture, the expression and statistical analysis of pyroptosis proteins (cleaved caspase 3, GSDME, and NT-GSDME) in cardiomyocytes were detected by Western blot. It was found that cleaved caspase 3 and NT-GSDME were significantly increased in the siLRRC15 transfected group compared to the siLRRC15 NC group, indicating that LRRC15 knockdown led to cleaved caspase / GSDME-mediated pyroptosis in cardiomyocytes.

[0074] Example 8: Knockdown of LRRC15 induces cardiomyocyte death Primary cardiomyocytes from lactating mice were isolated and cultured in high-glucose DMEM medium containing 10% fetal bovine serum. They were then transfected with siRNA to knock down LRRC15 and its control siRNA NC (siLRRC15 and siLRRC15 NC). After 48 hours of culture, the medium was replaced with serum-free medium containing 10 nM SYTOX GREEN staining solution and cultured for 12 hours. The cells were then photographed using a fluorescence microscope.

[0075] Figure 6 The results of dead cell staining using Sytox were obtained after transfecting neonatal mouse cardiomyocytes with siLRRC15 and culturing them for 48 hours. Figure 6 In the image, A shows a light micrograph of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of cells in each group. The study found that cardiomyocytes transfected with siLRRC15 showed significantly greater cell death compared to the siLRRC15 NC group, suggesting that knocking down LRRC15 leads to cell death.

[0076] Example 9: Cardiac function was suppressed in LRRC15 knockout mice. LRRC15 knockout mice (LRRC15 KO) were bred using Crespr-Cas9 technology. After 12 months of feeding, Doppler echocardiography of the mouse heart was collected using a mouse echocardiogram machine. Then, the EF, FS, LVIDd, and LVIDs of the mice were calculated and statistically analyzed.

[0077] Figure 7 The results of echocardiography were used to analyze the cardiac function of LRRC15 knockout mice (LRRC15 KO) and their age-matched wild-type control mice. Figure 7 In the image, A shows a Doppler ultrasound image of the mouse heart, with white arrows representing the size of the mouse heart chambers. B is a statistical graph of mouse cardiac function (EF, FS, LVIDd, LVIDs). The results showed that cardiac function in the LRRC15 KO group was significantly lower than in the wt group, suggesting that knocking down LRRC15 significantly reduces cardiac function in mice.

Claims

1. Application of leucine-enriched repeatable membrane protein-15 in the preparation of drugs for the treatment of acute myocardial infarction.

2. The application according to claim 1, characterized in that: The drug comprises leucine-enriched repeatable membrane protein-15, and pharmaceutically acceptable carriers and / or excipients.

3. The application according to claim 1, characterized in that: The drug is a pharmaceutical preparation administered by injection or oral administration.

4. The application according to claim 3, characterized in that: The injection can be intramyocardial, intradermal, subcutaneous, intramuscular, or intravenous.

5. The application according to claim 1, characterized in that: The drug is a pharmaceutical preparation that is administered via the nasal mucosa, lungs, rectum, oral mucosa, or skin.

6. Application of adenoviruses and / or adeno-associated viruses that overexpress leucine-enriched repeat membrane protein-15 in the preparation of drugs for the treatment of acute myocardial infarction.

7. The application of leucine-enriched repeating membrane protein-15 gene in constructing a myocardial pyroptosis model, characterized by: A model of myocardial pyroptosis was obtained by knocking down the leucine-enriched repeat membrane protein-15 gene in in vitro cardiomyocytes.