Escherichia coli for synthesizing heme and its derivatives using glycerol and acetic acid as raw materials
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- MICROCYTO BIOTECHNOLOGY (BEIJING) CO LTD
- Filing Date
- 2025-07-09
- Publication Date
- 2026-07-14
Smart Images

Figure CN120699873B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to gene editing, gene recombination editing microbial strains, synthetic biology, and microbial biosynthesis technology. Specifically, it relates to a recombinant Escherichia coli strain that synthesizes heme derivatives and its preparation method. Background Technology
[0002] Heme is an important food ingredient. As a key coloring and flavoring component in artificial meat, heme plays a central role in mimicking the "meaty aroma," vibrant red appearance, and enhancing the overall taste and texture of traditional meat. By binding with plant proteins, heme significantly improves the sensory realism of artificial meat products. Heme metabolism in the body produces a series of high-value derivatives, among which bilirubin is particularly important. Bilirubin is not only the main pigment in bile and an important antioxidant in the body, but also a key pharmaceutical component for treating diseases such as neonatal jaundice, resulting in huge demand in the pharmaceutical and diagnostic fields. Currently, the production of heme and its derivatives (such as bilirubin) mainly relies on chemical synthesis or extraction from animal and plant tissues (such as animal blood). These methods generally suffer from problems such as complex processes, low product purity, numerous byproducts, and severe environmental pollution. Especially for high-value derivatives like bilirubin, their abundance in nature is extremely low, traditional extraction methods are extremely costly, and production is far from meeting the rapidly growing market demand due to limitations in raw material supply (such as animal bile).
[0003] Glycerol is a byproduct of the biodiesel industry, with ample supply and low price; acetic acid can be obtained in large quantities through various fermentation or chemical pathways. Both are significantly cheaper than traditional sugar raw materials. Glycerol molecules exist in a highly reduced state, and its metabolic pathway generates abundant reducing power (NADH / NADPH), which is crucial for the synthesis of reduced products such as heme and bilirubin, effectively improving carbon flux conversion efficiency. Acetic acid is a direct precursor of acetyl-CoA, a central molecule in cellular metabolism. Acetyl-CoA is not only an important precursor of 5-aminolevulinic acid (ALA), the starting molecule for heme synthesis, but also a hub for cellular energy metabolism and the tricarboxylic acid cycle (TCA), providing ample energy and carbon skeleton for biosynthesis. Therefore, developing heme biosynthetic routes using glycerol and acetic acid as mixed or single carbon sources holds promise for overcoming the production bottleneck of heme and its derivatives, and is of great significance for supporting the development of industries such as artificial meat and meeting the needs of the pharmaceutical field. Summary of the Invention
[0004] This invention aims to solve the following technical problem: how to metabolically engineer *Escherichia coli* to enable it to efficiently utilize glycerol and acetic acid as precursors to synthesize heme and its derivative compounds. Specifically, this invention focuses on addressing key issues in existing technologies, such as high raw material costs, insufficient precursor supply, and low synthesis efficiency.
[0005] In order to solve the above-mentioned technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, which is a recombinant bacterium obtained by modifying Escherichia coli as follows (1)-(18);
[0006] (1) Knock out the gene encoding pyruvate oxidase (poxB);
[0007] (2) Knock out the gene encoding pyruvate formate lyase (pflB);
[0008] (3) Knock out the gene encoding malate synthase (aceB);
[0009] (4) Knock out the gene encoding porphyrinogen peroxidase (yfeX);
[0010] (5) Enhance the expression of the phosphoenolpyruvate carboxylase gene (ppc);
[0011] (6) Enhance the expression of the glycerol transporter gene (glpF);
[0012] (7) Enhance the expression of the glycerol-3-phosphate dehydrogenase gene (glpD);
[0013] (8) Enhance the expression of the acetyl-CoA synthase gene (acs);
[0014] (9) Enhance the expression of the acetate kinase gene (ackA);
[0015] (10) Enhance the expression of the isocitrate lyase gene (aceA);
[0016] (11) Enhance the expression of the bile pigment synthase gene (hemB);
[0017] (12) Enhance the expression of the hydroxymethylcholine synthase gene (hemC);
[0018] (13) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE).
[0019] (14) Enhance the expression of coprophyrinogen oxidase gene (hemF);
[0020] (15) Enhance the expression of the protoporphyrinogen oxidase gene (hemG);
[0021] (16) Introduce glycine dehydrogenase (GYDH);
[0022] (17) Introduce the 5-aminolevulinic acid synthase gene (hemA);
[0023] (18) Introduce the ferrous chelate synthase gene (hemH).
[0024] The modifications in (3) and (10) above can be as follows: replacing the coding region of the malate synthase gene (aceB) and the upstream region of the isocitrate lyase gene (aceA) with the P119 promoter;
[0025] The modifications in (5)-(9) and (11)-(15) above can be as follows: the promoters of the phosphoenolpyruvate carboxylase gene (ppc), glycerol transport protein gene (glpF), glycerol 3-phosphate dehydrogenase gene (glpD), acetyl-CoA synthase gene (acs), acetate kinase gene (ackA), bile pigmentogen synthase gene (hemB), hydroxymethylcholesterol synthase gene (hemC), uroporphyrinogen decarboxylase gene (hemE), coproporphyrinogen oxidase gene (hemF), and protoporphyrinogen oxidase gene (hemG) can be replaced with the P119 promoter.
[0026] The modifications mentioned above (16) and (17) can be specifically as follows: introduced in the form of pS-GH plasmid.
[0027] The above (18) modification can be specifically as follows: introduced in the form of pY-H plasmid.
[0028] Furthermore, the glycine dehydrogenase (GYDH) may be derived from Mycobacterium tuberculosis.
[0029] Furthermore, the 5-aminolevulinic acid synthase gene (hemA) may be derived from Cereibacter sphaeroides.
[0030] Furthermore, the ferrous chelate gene (hemH) may be derived from Pantoea ananatis.
[0031] In a second aspect, the present invention provides a recombinant Escherichia coli, wherein the modifications (1)-(18) and the following modifications are made in the Escherichia coli:
[0032] (19) Strengthen the cytochrome c maturation protein A gene (ccmA).
[0033] The specific modification of (19) above can be: replacing the promoter of the cytochrome c mature protein A gene (ccmA) with the P119 promoter.
[0034] Thirdly, the present invention provides a recombinant Escherichia coli, wherein the modifications (1)-(18) and the following modifications are made in the Escherichia coli:
[0035] (20) Introduce the heme oxygenase gene (ho1);
[0036] (21) Introduce biliverdin reductase gene (bvr).
[0037] The modifications mentioned above (18), (20), and (21) can be specifically implemented by introducing the plasmid in the form of pY-HHB.
[0038] Furthermore, the heme oxygenase gene (ho1) may be derived from Prochlorococcus marinus.
[0039] Furthermore, the biliverdin reductase gene (bvr) may be derived from Mycobacterium paraintracellulare.
[0040] Fourthly, the present invention provides a method for constructing recombinant Escherichia coli with increased heme production, comprising the following steps: performing the modification according to the modification methods of (1)-(18) in the first aspect and (19) in the second aspect.
[0041] Fifthly, the present invention provides a method for constructing recombinant Escherichia coli with increased bilirubin production, comprising the following steps: performing the modifications according to the modifications (1)-(18) in the first aspect and (20) and (21) in the third aspect.
[0042] In a sixth aspect, the present invention provides a method for producing or increasing heme production, comprising the following steps: culturing the recombinant *Escherichia coli* described in the second aspect using glycerol as a carbon source, collecting the bacterial cells, and obtaining heme; and a method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant *Escherichia coli* described in the third aspect using glycerol and acetic acid as carbon sources, collecting the bacterial cells, and obtaining bilirubin.
[0043] In a seventh aspect, the present invention provides the use of the recombinant Escherichia coli described in the second aspect in the production or enhancement of heme production; and the use of the recombinant Escherichia coli described in the third aspect in the production or enhancement of bilirubin production.
[0044] Eighthly, the present invention provides a product for producing or increasing heme production, the active ingredient of which is the recombinant Escherichia coli described in the second aspect; and a product for producing or increasing bilirubin production, the active ingredient of which is the recombinant Escherichia coli described in the third aspect.
[0045] The above-mentioned products may be bacterial agents containing the recombinant bacteria or / and cultures of the recombinant bacteria.
[0046] The term "culture" refers to a liquid or solid product (i.e., fermentation product) that has grown a microbial community after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.
[0047] In a specific embodiment of the present invention, the composition and final concentration of the glycerol culture medium are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate can be added to a final concentration of 1% (g / 100 mL).
[0048] In a specific embodiment of the present invention, the originating Escherichia coli may be Escherichia coli MG1655, Escherichia coli BW25113, or Escherichia coli MC02.
[0049] In this invention, the nucleotide sequence of the P119 promoter is SEQ ID No. 3.
[0050] In this invention, the NCBI Reference Sequence number of the pyruvate oxidase (poxB) is CAD6018048.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 946132 (2025.6.25).
[0051] In this invention, the NCBI Reference Sequence number of the pyruvate formate lyase (pflB) is NP_415423.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 945514 (2025.6.25).
[0052] In this invention, the NCBI Reference Sequence number of the porphyrinogen peroxidase (yfeX) is NP_416926.4, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 946913 (2023.4.14).
[0053] In this invention, the NCBI Reference Sequence number of the phosphoenolpyruvate carboxylase (ppc) is NP_418391.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948457 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4153099-4153200(-)).
[0054] In this invention, the NCBI Reference Sequence number of the glycerol transporter (glpF) is NP_418362.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948422 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4118091-4118280(-)).
[0055] In this invention, the NCBI Reference Sequence number of the 3-phosphoglycerate dehydrogenase (glpD) is NP_417884.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 947934 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (3561941-3562012(+)).
[0056] In this invention, the NCBI Reference Sequence number of the bile pigment synthase (hemB) is NP_414903.4, the NCBI Reference Sequence number of its encoding gene is Gene ID: 945017 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (389728-389777(-)).
[0057] In this invention, the NCBI Reference Sequence number of the hydroxymethylcholine synthase (hemC) is YP_026260.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 947759 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (3990767-3990773(-)).
[0058] In this invention, the NCBI Reference Sequence number of the uroporphyrinogen decarboxylase (hemE) is NP_418425.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948497 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4197691-4197715(+)).
[0059] In this invention, the NCBI Reference Sequence number of coprophyrinogen oxidase (hemF) is NP_416931.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 946908 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (2553222-2553224(+)).
[0060] In this invention, the NCBI Reference Sequence number of the protoporphyrinogen oxidase (hemG) is NP_418292.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948331 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4034605-4034607(+)).
[0061] In this invention, the NCBI Reference Sequence of the cytochrome c maturation protein A gene (ccmA) is NP_416705.2, the NCBI Reference Sequence of its encoding gene is Gene ID: 946714 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (2297645-2297656(-)).
[0062] In this invention, the NCBI Reference Sequence number of the glycine dehydrogenase (GYDH) is NP_217296.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 888493 (2017.12.14).
[0063] In this invention, the NCBI Reference Sequence number of the 5-aminolevulinic acid synthase (hemA) is WP_011337894.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 3720398 (2024.12.19).
[0064] In this invention, the NCBI Reference Sequence number of the ferrous chelate (hemH) is WP_014605551.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 57267780 (2023.9.29).
[0065] In this invention, the NCBI Reference Sequence number of the heme oxygenase (ho1) is WP_011821074.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 60201361 (2023.4.10).
[0066] In this invention, the NCBI Reference Sequence number of the biliverdin reductase (bvr) is WP_008256343.1, and the NCBI Reference Sequence number of its encoding gene is AP022584.1 (708882-709289 (-)) (2020.2.6).
[0067] In this invention, the NCBI Reference Sequence number of the acetyl-CoA synthase (acs) is NP_418493.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948572 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4287372-4287500(-)).
[0068] In this invention, the NCBI reference sequence number of the acetic acid kinase (ackA) is NP_416799.1, the NCBI reference sequence number of its encoding gene is Gene ID:946775 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (2413391-2413469(+)).
[0069] In this invention, the NCBI Reference Sequence number of the malate synthase (aceB) is NP_418438.1, and the NCBI Reference Sequence number of its encoding gene is Gene ID: 948512 (2025.6.25).
[0070] In this invention, the NCBI Reference Sequence number of the isocitrate lyase (aceA) is NP_418439.1, the NCBI Reference Sequence number of its encoding gene is Gene ID: 948517 (2025.6.25), and the upstream sequence that was replaced is NC_000913.3 (4215478-4217108(+)).
[0071] The beneficial technical effects achieved by this invention are as follows:
[0072] This invention provides a recombinant Escherichia coli strain that can synthesize heme and its derivatives at a high level using glycerol and acetic acid as raw materials, thus providing a novel technical route for the synthesis of heme and its derivatives, which can be used for the large-scale production of heme and its derivatives. Attached Figure Description
[0073] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0074] Figure 1 HPLC elution chromatogram of bilirubin (sample). Detailed Implementation
[0075] The present disclosure will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present disclosure and are not intended to limit the scope of the present disclosure. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.
[0076] The liquid LB medium (pH 7.0) in the following examples contains 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the remainder is water. The solid medium is obtained by adding agarose to the liquid medium.
[0077] The specific *E. coli* strains used in the following examples can be one of *E. coli* MG1655, BW25113, or MC02. *E. coli* MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), and plasmid pKD46 (CGSC#: 7739) are products of the Yale University Genetic Collection Center for *E. coli*. *E. coli* MC02 is deposited at the China General Microbiological Culture Collection Center (CGMCC) (accession number CGMCC No. 34378). The sequence information of the pSB1s plasmid and pYB1k plasmid is described in patent CN119799606A. pKD46 plasmid: Contains a temperature-sensitive origin of replication, oriR101, which can replicate normally when cultured at 30℃, but will be automatically lost when cultured above 37℃; E. coli carrying pKD46 plasmid, after being cultured at 30℃ and induced by the addition of arabinose, express Gam, Exo, and Beta efficiently. Once the exogenous dsDNA is electroporated into the cell, it can undergo homologous recombination with the genomic target sequence; It also carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.9, and can be obtained by the public through gene synthesis: E. coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing recombination between the lox66 and lox71 sequences on the chromosome, thereby eliminating the DNA sequence located between the lox66 and lox71 sequences. In this patent, the kanamycin resistance gene between the lox66 and lox71 sequences, as shown in SEQ ID NO.1, can be eliminated; E. coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; carrying the streptomycin resistance gene serves as a selection marker.
[0078] Table 1. List of Sequence Fragments
[0079] Serial number Fragment name Sequence (5'-3')[[]END] SEQ IDNO.1 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc SEQ IDNO.2 LKL aaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccc SEQ IDNO.3 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ IDNO.4 RBS aggaggaattaacc SEQ IDNO.5 TrrnB tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ IDNO.6 linker gagggaaaaggcggcagtggctctggtagtgagggcggcgcgaaaggtggaggctct SEQ IDNO.7 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQ IDNO.8 poxBdown aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac SEQ IDNO.9 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQ IDNO.10 ppcup cgtaaattcctgctatttattcgtttgctgaagcgatttcgcagcatttgacgtcaccgcttttacgtgg SEQ IDNO.11 ppcdown atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcggcaaagtgctgggagaaaccatca SEQ IDNO.12 glpFup ccttctcctggtgacataatccacatcaatcgaaaatgttaataaatttgttgcgcgaatgatctaacaa SEQ IDNO.13 glpFdown atgagtcaaacatcaaccttgaaaggccagtgcattgctgaattcctcggtaccgggttgttgattttct SEQ IDNO.14 glpDup tacgtcgaagcggcagataaacgccataatgttatacatatcactctaaaatgttttttcaatgttacct SEQ IDNO.15 glpDdown atggaaaccaaagatctgattgtgatagggggcggcatcaatggtgctggtatcgcggcagacgccgctg SEQ IDNO.16 acsup ttcaacagcatgcataactgcatgttcctcaaagaattaatcaacttttgttgctgaccttcaaaaatta SEQ IDNO.17 acsdown atgagccaaattcacaaacacaccattcctgccaacatcgcagaccgttgcctgataaaccctcagcagt SEQ IDNO.18 ackAup gcaaaatggcatagactcaagatatttcttccatcatgcaaaaaaaatttgcagtgcatgatgttaatca SEQ IDNO.19 ackAdown atgtcgagtaagttagtactggttctgaactgcggtagttcttcactgaaatttgccatcatcgatgcag SEQ IDNO.20 aceup aacgaaaagagcacaacgatccttcgttcacagtggggaagttttcggatccatgacgaggagctgcacg SEQ IDNO.21 acedown atgaaaacccgtacacaacaaattgaagaattacagaaagagtggactcaaccgcgttgggaaggcatta SEQ IDNO.22 yfeXup cgaaaaaacacgtaaaatagcgctcaacaatgccacggattgcgtggcattattattttcaggaggaaca SEQ IDNO.23 yfeXdown gcgtttctgattcattgattaaaggccaggcagtaacattactgactggcctcagattgttgaccaagtg SEQ IDNO.24 hemBup aaagatgtcctggcctctcttccattctcttcttgtcaacatcgcgacaactttcgtaaaacatccctac SEQ IDNO.25 hemBdown atgacagacttaatccaacgccctcgtcgcctgcgcaaatctcctgcgctgcgcgctatgtttgaagaga SEQ IDNO.26 hemCup tacgtttcaccacaacactgacatcactctggcaaggatgttaggatggaccacggatgataatgacggt SEQ IDNO.27 hemCdown atgttagacaatgttttaagaattgccacacgccaaagcccacttgcactctggcaggcacactatgtca SEQ IDNO.28 hemEup tagcgcgccgtctgatagaagatacggtggcgatgtgtcgggcagagtatgagtgatgatacactgaccg SEQ IDNO.29 hemEdown atgaccgaacttaaaaacgatcgttatctgcgggcgctgctgcgccagcccgttgatgtcactccagtat SEQ IDNO.30 hemFup tgctgaaggcgtgatcagttatttccactggttcgacaaccagaaagcacattcgaaaaagcgataa SEQ IDNO.31 hemFdown atgaaacccgacgcacaccaggttaaacagtttctgctcaaccttcaggatacgatttgtcagcagctga SEQ IDNO.32 hemGup gtcgtctcgaggtctttacattgctggtgctctttaccccgactttctggcgtgaatgatggagtaa SEQ IDNO.33 hemGdown atgaaaacattaattcttttctcaacaagggacggacaaacgcgcgagattgcctcctacctggcttcgg SEQ IDNO.34 ccmAup ctgtattgattgccataaagggatagcgcacaagctgcccgatatgcgtgaagtcgagccaggtttttaa SEQ IDNO.35 ccmAdown atgggtatgcttgaagccagagagttactttgtgagcgggatgaacgaaccttatttagtggcttgtcat GYDH Gene ID: 888493 (December 14, 2017) hemA Gene ID: 3720398 (December 19, 2024) hemH Gene ID: 57267780 (September 29, 2023) ho1 Gene ID: 60201361 (April 10, 2023) bvr Gene ID: 66745074 (June 6, 2024)
[0080] Table 2 Primer Sequences
[0081] Primer or Sequence Name Nucleotide Sequence (5' to 3') kan-R tcgtcaagaaggcgatagaa poxB-1 tcccatcccttccccctccgtcagatgaac poxB-2 gtcgggtaacggtatcactgcgtaaatcaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcgaag pflB-2 ctaaaaaaggccccactttcgtggagc pflB-3 ccggaaaatttttctcacctgacc yfeX-1 cgaaaaaacacgtaaaatagcgctcaacaa yfeX-2 cacttggtcaacaatctgaggccagtcagt yfeX-3 gttaatttgcgtctgaacaaaccgccgccg ppc-1 cgtaaattcctgctatttattcgtttgctg ppc-2 tgatggtttctcccagcactttgccgagca ppc-3 cgcttatttaaagcgtcgtgaatttaatga glpF-1 ccttctcctggtgacataatccacatcaat glpF-2 agaaaatcaacaacccggtaccgaggaatt glpF-3 ttgcagattacggtttgccacacttttcat glpD-1 tacgtcgaagcggcagataaacgccataat glpD-2 cagcggcgtctgccgcgataccagcaccat glpD-3 caaacaagtgggcaaatttaccgcacagtt acs-1 ttcaacagcatgcataactgcatgttcctc acs-2 actgctgagggtttatcaggcaacggtctg acs-3 actttagagttagtcagtatcttcctcttt ackA-1 gcaaaatggcatagactcaagatatttctt ackA-2 ctgcatcgatgatggcaaatttcagtgaag ackA-3 atatacattatgccattggctgaaaattac ace-1 aacgaaaagagcacaacgatccttcgttca ace-2 taatgccttcccaacgcggttgagtccact ace-3 cattttaaatgagtagtcttagttgtgctg hemB-1 aaagatgtcctggcctctct hemB-2 tctcttcaaacatagcgcgc hemB-3 ccaaaaaataataaccaacagc hemC-1 tacgtttcaccacaacactgac hemC-2 tgacatagtgtgcctgccag hemC-3 acctcattttacggtttgcg hemE-1 tagcgcgccgtctgatagaa hemE-2 atactggagtgacatcaacggg hemE-3 gctatgacgatttgccgttac hemF-1 tgctgaaggcgtgatcagtt hemF-2 tcagctgctgacaaatcgtatc hemF-3 ggcgtttcgtcagaaaatcg hemG-1 gtcgtctcgaggtctttacattg hemG-2 ccgaagccaggtaggagg hemG-3 aatggatcctgattgccaacat ccmA-1 ctgtattgattgccataaagggatagcgca ccmA-2 atgacaagccactaaataaggttcgttcat ccmA-3 gcatgaccaggcggtgaaagatgggcaaac pSY-F ggttaattcctcctgttagcccaaaaaacg pSY-R tgcctggcggcagtagcgcggtggtcccac GYDH-1 gctaacaggaggaattaaccatgcgcgtcggtattccgaccgagaccaaa hemA-2 cgcgctactgccgccaggcatcaggcaacgacctcggcgcgattcag hemH-1 gctaacaggaggaattaaccatgacgaataaacagggtgttttaatt hemH-2 cgcgctactgccgccaggcactatttcgcgccctctgccagctgtc HHB-2 cgcgctactgccgccaggcattacgcgccccggtccaaaagatccga ara-F ctactgtttctccatacccgttttttgggc rrn-R gttccctactctcgcatggggagaccccac
[0082] Example 1: Construction of Escherichia coli strain HGC01-19
[0083] The relevant strains were prepared according to the following steps (1)-(2):
[0084] (1) Starting from Escherichia coli MC02, the gene poxB encoding pyruvate oxidase in the strain was knocked out to obtain strain HGC01.
[0085] The specific steps are as follows:
[0086] (1-a) Preparation of the target fragment HGC-1
[0087] The synthesized DNA fragment (GenScript) is as follows: from 5' to 3', it consists of: poxBup, LBL (from 5' to 3', it consists of lox66, the Kan resistance gene, and lox71), and poxBdown. Using poxB-1 / poxB-2 as primers, PCR amplification was performed using the synthesized DNA fragment as a template to obtain the targeting fragment HGC-1.
[0088] (1-b) Preparation of host bacteria containing pKD46 plasmid
[0089] The pKD46 plasmid was transformed into the originating *E. coli* MC02 via calcium chloride conversion. After overnight incubation on LB agar plates containing ampicillin at 30°C, clones were selected to obtain recombinant *E. coli* MC02 / pKD46 containing plasmid pKD46. Upon induction with arabinose, MC02 / pKD46 expressed three recombinant proteins of λ phage, thus endowing the host bacterium with homologous recombination capabilities. Then, competent MC02 / pKD46 cells were prepared by washing with 10% glycerol.
[0090] (1-c) Homologous recombination
[0091] The targeting fragment HGC-1 prepared in (1-a) was electroporated into MC02 / pKD46 competent cells prepared in (1-b). Cells were incubated overnight at 37°C on LB agar plates containing kanamycin (50 µg / ml). Clones were selected, and genomic DNA was extracted. PCR amplification was performed using poxB-3 / Kan-R primers. A positive result was indicated by the amplification of a target band of approximately 1000 bp. The positive clone was named HGC01-kan. Sequencing analysis showed that the relevant target sequence on the genome of MC011-kan was correct, and the coding region of the poxB gene was knocked out. HGC01-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.
[0092] (1-d) Elimination of resistance
[0093] The pSCre plasmid was transformed into the HGC01-kan strain, which had pKD46 eliminated, using the calcium chloride transformation method. The strain was incubated overnight at 30°C on LB agar plates containing 50 mg / L streptomycin and 0.2% L arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The strain was then incubated overnight at 42°C to eliminate the temperature-sensitive pSCre plasmid. The resulting strain was named HGC01.
[0094] (2) Obtaining strains HGC02, HGC03, HGC04, HGC05, HGC06, HGC07, HGC08, HGC09, HGC10, HGC11, HGC12, HGC13, HGC14, and HGC15
[0095] Using the same method as in Example 1 (1), starting from strain HGC01, strains HGC02, HGC03, HGC04, HGC05, HGC06, HGC07, HGC08, HGC09, HGC10, HGC11, HGC12, HGC13, HGC14, and HGC15 were obtained in sequence.
[0096] The difference between each strain construction process and Example 1 (1) is that different starting strains, different target fragments, and different primers were used. The specific starting strains, target fragments (including the specific sequences of the sequence fragments are shown in Table 1), primers, modified target sites, and obtained strain information used in each step are shown in Table 3.
[0097] Table 3. Construction process of HGC01-HGB20
[0098] Step number Starting strain Target practice segment name The target shooting clip contains a sequence of segments (5'-3'). Modify target Amplification primers Identification primers Obtain strain 1 MC02 HGC-1 poxBup, LKL, poxBdown Knockout of the pyruvate oxidase (poxB) gene poxB-1 / poxB-2 poxB-3 / KanR HGC01 2 HGC01 HGC-2 pflBup, LKL, pflBdown Knockout of the pyruvate formate lyase (pflB) gene pflB-1 / pflB-2 pflB-3 / KanR HGC02 3 HGC02 HGC-3 aceup, LKL, P119, acedown The upstream regions of the citrate synthase (aceB) gene and isocitrate lyase (aceA) gene were knocked out and replaced with the P119 promoter. ace-1 / ace-2 ace-3 / KanR HGC03 HGC03 HGC-5 ppcup, LKL, P119, ppcdown Replace the promoter of the phosphoenolpyruvate carboxylase (ppc) gene with the P119 promoter. ppc-1 / ppc-2 ppc-3 / KanR HGC04 HGC04 HGC-6 glpFup, LKL, P119, glpFdown Replace the promoter of the glycerol transporter (glpF) gene with the P119 promoter. glpF-1 / glpF-2 glpF-3 / KanR HGC05 HGC05 HGC-7 glpDup, LKL, P119, glpDdown Replace the promoter of the glycerol-3-phosphate dehydrogenase (glpD) gene with the P119 promoter. glpD-1 / glpD-2 glpD-3 / KanR HGC06 HGC07 HGC-8 yfeXup, LKL, yfeXdown Knockout of porphyrinogen peroxidase (yfeX) yfeX-1 / yfeX-2 yfeX-3 / KanR HGC08 HGC08 HGC-9 hemBup, LKL, P119, hemBdown Replace the promoter of the bile chromogen synthase (hemB) gene with the P119 promoter. hemB-1 / hemB-2 hemB-3 / KanR HGC09 HGC09 HGC-10 hemCup, LKL, P119, hemCdown Replace the promoter of the hydroxymethylcholine synthase (hemC) gene with the P119 promoter. hemC-1 / hemC-2 hemC-3 / KanR HGC10 HGC10 HGC-11 hemEup,LKL,P119,hemEdown Replace the promoter of the uroporphyrinogen decarboxylase (hemE) gene with the P119 promoter. hemE-1 / hemE-2 hemE-3 / KanR HGC11 HGC11 HGC-12 hemFup,LKL,P119,hemFdown Replace the promoter of the coproporphyrinogen oxidase (hemF) gene with the P119 promoter. hemF-1 / hemF-2 hemF-3 / KanR HGC12 HGC12 HGC-13 hemGup, LKL, P119, hemGdown Replace the promoter of the protoporphyrinogen oxidase (hemG) gene with the P119 promoter. hemG-1 / hemG-2 hemG-3 / KanR HGC13 HGC13 HGC-14 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A (ccmA) gene with the P119 promoter. ccmA-1 / ccmA-2 ccmA-3 / KanR HGC14 MC02 HGC-14 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A (ccmA) gene with the P119 promoter. ccmA-1 / ccmA-2 ccmA-3 / KanR HGC15
[0099] Example 2: Construction of plasmids pS-H, pY-H, and pY-HHB
[0100] (1) Preparation of skeleton fragments
[0101] Preparation of backbone fragment pS: pSB1s was obtained by PCR amplification using universal primers pSY-F / pSY-R, with plasmid pSB1s as a template.
[0102] Preparation of the backbone fragment pY: pY was obtained by PCR amplification using plasmid pYB1k as a template and universal primers pSY-F / pSY-R.
[0103] (2) Preparation of target gene fragments
[0104] Preparation of the target gene fragment GH: The DNA fragment containing GH was synthesized by Qingke Biotechnology, with GYDH, RBS, and hemA sequentially from 5' to 3' (Table 1). Using this DNA fragment as a template, PCR amplification was performed using primers GYDH-1 / hemA-2.
[0105] Preparation of the target gene fragment hemH: The DNA fragment containing hemH was synthesized by Qingke Biotechnology, and its sequence is hemH (Table 1). Using this DNA fragment as a template, PCR amplification was performed using primers hemH-1 / hemH-2.
[0106] Preparation of the target gene fragment HHB: The DNA fragment containing HHB was synthesized by Qingke Biotechnology, with the sequence 5'-3' containing hemH (without TAA), linker, ho1, RBS, and bvr, respectively. Using this DNA fragment as a template, PCR amplification was performed using primers hemH-1 / HHB-2.
[0107] All the above PCRs were performed using high-fidelity TransStart FastPfu DNA polymerase (Beijing TransGen Biotech Co., Ltd., product catalog AP221), and the target fragments were recovered by agarose gel electrophoresis.
[0108] (3) Gibson assembly method to obtain recombinant plasmids
[0109] The above-mentioned backbone fragment and the target gene fragment were ligated using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to selpxMeral hundred kilobases. Nat. methods. 2009; 6(5):343-345) to obtain a recombinant expression vector. *E. coli* DH5α competent cells (purchased from Beijing TransGen Biotech Co., Ltd., product catalog: CD201) were transformed using the CaCl2 method. The cells were evenly spread on LB agar plates containing streptomycin or kanamycin and incubated overnight at 37°C. Clones were selected, and those capable of amplifying the target fragment were identified using universal primers ara-F / rrn-R and sequenced. Positive clones were selected, and plasmids were extracted to obtain positive plasmids.
[0110] Plasmids pS-GH, pY-H, and pY-HHB were constructed using the exact same method, differing only in their backbone fragments and target gene fragments. Specific information is shown in Table 4.
[0111] Table 4. Plasmid Construction Information
[0112] Serial Number plasmid Skeletal Fragments Target gene fragment Antibiotics used in screening 1 pS-GH pS GH Streptomycin 2 pY-H pY hemH Kanamycin 3 pY-HHB pY HHB Kanamycin
[0113] Example 3: Production of heme and bilirubin using recombinant Escherichia coli
[0114] The test bacteria were recombinant Escherichia coli HGC20 and HGC21; the control bacteria were HGC22 and HGC23. Information on the relevant strains is shown in Table 5.
[0115] (1) Recombinant Escherichia coli HGC20, HGC21, HGC22, HGC23.
[0116] The plasmid obtained in Example 2 was transformed into the recombinant bacteria obtained in Example 1 using the calcium chloride transformation method. After overnight incubation at 37°C on LB agar plates containing streptomycin and kanamycin, clones were selected and stored at -80°C. Information on the relevant strains used in the construction process is shown in Table 5.
[0117] Table 5. Strains Information
[0118] strains Receptor bacteria plasmid HGC20 HGC14 pS-GH, pY-H HGC21 HGC13 pS-GH, pY-HHB HGC22 HGC15 pS-GH, pY-H HGC23 MC02 pS-GH, pY-HHB
[0119] (2) Using glycerol and acetic acid as raw materials, heme was synthesized by recombinant Escherichia coli HGC20.
[0120] The glycerol culture medium used and its final concentrations are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate can be added to a final concentration of 1% (g / 100 mL).
[0121] The recombinant strain HGC20 and the control strain HGC22, which had been cultured overnight, were inoculated at a rate of 1% into shake flasks containing 200 ml of LB medium containing streptomycin and kanamycin. The cultures were incubated at 37°C for 3-4 h until the OD600nm value reached 0.6-0.8. Then, arabinose was added to a final concentration of 0.2 g / L, and the cultures were incubated at 37°C for another 12 h. The cells were then collected by centrifugation at 8000 rpm for 10 min.
[0122] The collected bacterial cells were resuspended in shake flasks containing 10 mL of glycerol medium and incubated at 120 rpm and 37 °C for 24 h. The supernatant was collected by centrifugation and filtered. The heme content was determined by HPLC and converted to heme yield per liter (g / L). HPLC was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm); the mobile phase was methanol / phosphoric acid aqueous solution (40 / 60), the flow rate was 0.5 mL / min, and the column temperature was 35 °C. Heme standards were purchased from Aladdin (catalog number: H104216). The retention time of the heme standards was 16.9 min.
[0123] The results showed that the heme production of the control strain HGC22 was 0, while the average heme production of the recombinant strain HGC20 was 0.75 ± 0.05 g / L. The constructed strain was able to effectively synthesize heme using glycerol and acetic acid.
[0124] (3) Using glycerol and acetic acid as raw materials, bilirubin was synthesized by recombinant Escherichia coli HGC21.
[0125] The glycerol culture medium used and its final concentrations are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate can be added to a final concentration of 1% (g / 100 mL).
[0126] The recombinant strain HGC21 and the control strain HGC23, which had been cultured overnight, were inoculated at a rate of 1% into shake flasks containing 200 ml of LB medium containing streptomycin and kanamycin. The cultures were incubated at 37°C for 3-4 h until the OD600nm value reached 0.6-0.8. Then, arabinose was added to a final concentration of 0.2 g / L, and the cultures were incubated at 37°C for another 12 h. The cells were then collected by centrifugation at 8000 rpm for 10 min.
[0127] The collected bacterial cells were resuspended in shake flasks containing 10 mL of glycerol medium and transformed at 120 rpm and 37°C for 24 h. The cells were then centrifuged and collected as the 24 h sample. The untransformed bacterial cells were collected and collected as the 0 h sample. The samples were resuspended in 0.1 M potassium phosphate buffer (pH 7.0), sonicated, and centrifuged to collect the precipitate. The precipitate was extracted with dichloromethane, centrifuged, and the organic phase was collected. The bilirubin content was determined by HPLC. The HPLC results for the samples are shown below. Figure 1The difference in bilirubin content between the 24-hour and 0-hour samples was calculated and converted into bilirubin yield per liter (g / L) in the shake flask. HPLC was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm); the mobile phase was DMSO / acetonitrile / 0.5 M ammonium acid buffer (5:7:7), the flow rate was 0.5 mL / min, and the column temperature was 30 ℃. Bilirubin standards were purchased from Aladdin (catalog number: B104211). The retention time of the bilirubin standards was 20 min.
[0128] The results showed that the control strain HGC23 accumulated zero bilirubin during the 0-24 h period, while the recombinant strain HGC21 accumulated 1.77 ± 0.14 g / L of bilirubin. The constructed strain was able to effectively utilize glycerol to synthesize bilirubin.
[0129] The production characteristics of the relevant strains are shown in Table 6.
[0130] Table 6. Comparison of yields of different strains
[0131] strains Heme (g / L) Bilirubin accumulation (g / L) in 0-24 hours HGC20 0.75±0.05 - HGC22 0 - HGC21 - 1.77±0.14 HGC23 - 0
Claims
1. A recombinant Escherichia coli, said recombinant Escherichia coli comprising the following modifications: (1) Knock out the gene encoding pyruvate oxidase (poxB); (2) Knock out the gene encoding pyruvate formate lyase (pflB); (3) Knock out the gene encoding malate synthase (aceB); (4) Knock out the gene encoding porphyrinogen peroxidase (yfeX); (5) Enhance the expression of the phosphoenolpyruvate carboxylase gene (ppc); (6) Enhance the expression of the glycerol transporter gene (glpF); (7) Enhance the expression of the glycerol-3-phosphate dehydrogenase gene (glpD); (8) Enhance the expression of the acetyl-CoA synthase gene (acs); (9) Enhance the expression of the acetate kinase gene (ackA); (10) Enhance the expression of the isocitrate lyase gene (aceA); (11) Enhance the expression of the bile pigment synthase gene (hemB); (12) Enhance the expression of the hydroxymethylcholine synthase gene (hemC); (13) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE). (14) Enhance the expression of coprophyrinogen oxidase gene (hemF); (15) Enhance the expression of the protoporphyrinogen oxidase gene (hemG); (16) Introduce glycine dehydrogenase (GYDH); (17) Introduce the 5-aminolevulinic acid synthase gene (hemA); (18) Introduce the ferrous chelate synthase gene (hemH); (19) Enhance the cytochrome c maturation protein A gene (ccmA). in, Steps (5)-(9) and (11)-(15) are achieved by replacing the natural promoter of the gene with the P119 promoter; steps (3) and (10) are achieved by knocking out and replacing the coding region of the malate synthase gene (aceB) and the upstream region of the isocitrate lyase gene (aceA) with the P119 promoter.
2. The use of the recombinant Escherichia coli according to claim 1 in the production or improvement of heme production.
3. A product for producing or increasing heme production, wherein the active ingredient is the recombinant Escherichia coli as described in claim 1.
4. A method for constructing recombinant Escherichia coli with increased heme production, comprising the following steps: performing the modification according to the modification (1)-(19) of claim 1.
5. A method for producing or increasing heme production, comprising the following steps: culturing the recombinant Escherichia coli of claim 1 using glycerol and acetic acid as carbon sources, collecting the bacterial cells, and obtaining heme.
6. A recombinant Escherichia coli, said recombinant Escherichia coli comprising modifications to: (1) Knock out the gene encoding pyruvate oxidase (poxB); (2) Knock out the gene encoding pyruvate formate lyase (pflB); (3) Knock out the gene encoding malate synthase (aceB); (4) Knock out the gene encoding porphyrinogen peroxidase (yfeX); (5) Enhance the expression of the phosphoenolpyruvate carboxylase gene (ppc); (6) Enhance the expression of the glycerol transporter gene (glpF); (7) Enhance the expression of the glycerol-3-phosphate dehydrogenase gene (glpD); (8) Enhance the expression of the acetyl-CoA synthase gene (acs); (9) Enhance the expression of the acetate kinase gene (ackA); (10) Enhance the expression of the isocitrate lyase gene (aceA); (11) Enhance the expression of the bile pigment synthase gene (hemB); (12) Enhance the expression of the hydroxymethylcholine synthase gene (hemC); (13) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE). (14) Enhance the expression of coprophyrinogen oxidase gene (hemF); (15) Enhance the expression of the protoporphyrinogen oxidase gene (hemG); (16) Introduce glycine dehydrogenase (GYDH); (17) Introduce the 5-aminolevulinic acid synthase gene (hemA); (18) Introduce the ferrous chelate synthase gene (hemH); (20) Introduce the heme oxygenase gene (ho1); (21) Introduce biliverdin reductase gene (bvr); in, Steps (5)-(9) and (11)-(15) are achieved by replacing the natural promoter of the gene with the P119 promoter; steps (3) and (10) are achieved by knocking out and replacing the coding region of the malate synthase gene (aceB) and the upstream region of the isocitrate lyase gene (aceA) with the P119 promoter.
7. A method for constructing recombinant Escherichia coli with increased bilirubin production, comprising the following steps: performing the modification according to the modification methods (1)-(18), (20), (21) in claim 6.
8. A method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant Escherichia coli of claim 6 using glycerol and acetic acid as carbon sources, collecting the bacterial cells, and obtaining bilirubin.
9. The use of the recombinant Escherichia coli according to claim 6 in the production or improvement of bilirubin production.
10. A product for producing or increasing bilirubin production, wherein the active ingredient is the recombinant Escherichia coli as described in claim 6.