A novel biosynthetic pathway for producing 3'-phosphoadenosine-5'-phosphosulfate and application thereof
By constructing a six-enzyme cascade reaction pathway using ribose and adenosine as substrates, the problem of high production cost and low efficiency of PAPS was solved, realizing efficient biosynthesis and large-scale production of PAPS, and promoting the development of enzyme engineering and metabolic engineering.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGNAN UNIV
- Filing Date
- 2025-06-27
- Publication Date
- 2026-07-31
AI Technical Summary
Existing technologies for PAPS production are characterized by high production costs, low efficiency, and ATP supply limitations, making large-scale production difficult and hindering the synthesis of sulfated compounds and the development of enzyme engineering.
Using ribose and adenosine as substrates, a novel PAPS biosynthetic pathway was constructed through a six-enzyme cascade reaction involving ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine sulfotransferase, and adenosine phosphate sulfate kinase. PAPS cell factories were then built in Escherichia coli and Bacillus subtilis.
The efficient biosynthesis of PAPS was achieved, with an in vitro multi-enzyme cascade catalytic molar conversion rate of 22.85%, and PAPS yields of 7.60 g/L and 5.03 g/L in a 5-L fermenter, providing an economical and efficient production solution.
Smart Images

Figure CN120718878B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a novel biosynthetic pathway for the production of 3'-adenosine-5'-phosphate sulfuric acid and its application, belonging to the field of bioengineering technology. Background Technology
[0002] 3'-phosphoadenosine-5'-phosphosulfate (PAPS) is a high-energy compound with the molecular formula C6H2O. 10 H 14 N5O 13 P2S, with a molecular weight of 507.27 g·mol⁻¹ -1 PAPS contains two phosphate groups and one sulfate group, attached to the 3' and 5' positions of adenosine, respectively. In reductase-catalyzed reactions, the high-energy sulfate bond easily breaks, releasing the sulfate group to form sulfite or sulfur-containing compounds, thus contributing to the synthesis and sulfation modification of compounds such as amino acids, proteins, hormones, and flavonoids in vivo. PAPS exhibits good solubility in water and is relatively stable under physiological conditions (37℃, pH 7.4), with a half-life of approximately 24 hours. It can be stored for extended periods at low temperatures (below 0℃) without significant degradation. At 60℃, the half-life is only a few minutes, while at 80℃ it decomposes almost instantaneously. In acidic or alkaline environments, it is easily hydrolyzed, generating adenosine monophosphate and inorganic sulfate, leading to the loss of its biological activity.
[0003] Currently, the dual-enzyme method for synthesizing PAPS using ATP as a substrate can achieve high conversion rates. However, due to the high cost and easy decomposition of ATP, and the cumbersome operation of this method, it is not conducive to large-scale production. Biosynthesis based on the natural PAPS synthesis pathway is limited by ATP supply, resulting in low yields. There are no research reports on PAPS cell factories, either domestically or internationally. De novo synthesis of functional glycosaminoglycan derivatives such as heparin sulfate and chondroitin sulfate using cell factories and whole-cell catalytic systems is limited by PAPS supply, leading to insufficient production performance, low synthesis efficiency, and high production costs. Therefore, it is necessary to explore novel, high-efficiency, and low-cost PAPS biosynthesis strategies to achieve efficient PAPS production and supply. This would provide new ideas for constructing sulfated compound cell factories, and simultaneously expand the sulfonyltransferase resource library, promoting the development of enzyme engineering and metabolic engineering, which has significant scientific and application value. Summary of the Invention
[0004] This invention provides a novel PAPS biosynthetic pathway that uses ribose and adenosine as substrates to synthesize PAPS through a six-enzyme cascade reaction catalyzed by ribokinase (RBSK), phosphoribosylpyrokinase (PRS), phosphoribosyltransferase (APRT), adenine thiotransferase (APSST), adenosine phosphate sulfate kinase (APSK), and polyphosphokinase 2 (PPK2).
[0005] The first objective of this invention is to provide a novel biosynthetic pathway for the production of 3'-adenosine-5'-phosphate sulfate, comprising the following enzymes: ribokinase (RBSK), phosphoribosyl pyrophosphate kinase (PRS), phosphoribosyltransferase (APRT), adenine thiotransferase (APSST), adenosine phosphate sulfate kinase (APSK), and polyphosphokinase 2 (PPK2).
[0006] In one embodiment of the present invention, the ribokinase is derived from human; phosphoribosylpyrokinase is derived from Bacillus amyloliquefaciens; phosphoribosyltransferase is derived from Schizosoma micranthum; adenine sulfonase is derived from bovine; adenosine phosphate sulfate kinase is derived from Penicillium chrysogenum; and polyphosphokinase 2 is derived from spherocytes.
[0007] In one embodiment of the present invention, the nucleotide sequence of the gene encoding the ribokinase is shown in SEQ ID NO. 1; the nucleotide sequence of the gene encoding the phosphoribosyl pyrophosphate kinase is shown in SEQ ID NO. 2; the nucleotide sequence of the gene encoding the phosphoribosyltransferase is shown in SEQ ID NO. 3; the nucleotide sequence of the gene encoding the adenine thiotransferase is shown in SEQ ID NO. 4 or SEQ ID NO. 7; the nucleotide sequence of the gene encoding the adenosine phosphate sulfate kinase is shown in SEQ ID NO. 5; and the nucleotide sequence of the gene encoding the polyphosphokinase 2 is shown in SEQ ID NO. 6.
[0008] In this invention, the APSST enzyme can preferably be a variant APSST with a histidine at position 8 mutated to methionine and a leucine at position 117 mutated to aspartic acid. * The nucleotide sequence of its encoding sequence is shown in SEQ ID NO.7.
[0009] The second objective of this invention is to provide the application of the described synthetic pathway in the production of 3'-adenosine-5'-phosphate sulfuric acid, specifically by using the enzyme in the described synthetic pathway as a catalyst and ribose and adenosine as substrates to catalyze the reaction to obtain 3'-adenosine-5'-phosphate sulfuric acid.
[0010] In one embodiment of the present invention, the amounts of enzymes added in the synthesis pathway are as follows: ribokinase 0.005–0.015 mM, phosphoribosylpyrokinase 0.01–0.03 mM, phosphoribosyltransferase 0.05–0.07 mM, adenine thiotransferase 0.05–0.15 mM, adenosine phosphate sulfate kinase 0.05–0.15 mM, and polyphosphokinase 2 0.05–0.15 mM.
[0011] In one embodiment of the present invention, the amount of ribose added is 1-10 mM, and the amount of adenosine added is 1-10 mM.
[0012] In one embodiment of the present invention, the reaction conditions for the catalytic reaction are 25-35°C, 200-300 rpm, and 10-60 min.
[0013] A third objective of the present invention is to provide a nucleic acid vector comprising coding sequences for enzymes such as ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine thiotransferase, adenosine phosphate sulfokinase, and polyphosphokinase 2, wherein the coding sequences of the enzymes are located within one, two, or more expression frames.
[0014] A fourth objective of this invention is to provide an engineered bacterium that expresses the synthetic pathway described above, wherein the engineered bacterium expresses the following enzymes: ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine thiotransferase, adenosine phosphate sulfokinase, and polyphosphokinase 2.
[0015] In one embodiment of the present invention, the engineered bacteria have the cysH gene knocked out.
[0016] In one embodiment of the present invention, the host cell of the engineered bacteria is Escherichia coli or Bacillus subtilis.
[0017] In one embodiment of the present invention, the Escherichia coli is Escherichia coli BL21(DE3) and the Bacillus subtilis is Bacillus subtilis 168.
[0018] In one embodiment of the present invention, when the host of the engineered bacteria is Escherichia coli, the invention further includes inserting three copies of the adenine thiotransferase encoding gene as shown in SEQ ID NO.7 into the cysH gene site in the genome, and inserting three copies of the adenine thiotransferase encoding gene as shown in SEQ ID NO.7 into the rph pseudogene site.
[0019] In one embodiment of the present invention, when the host of the engineered bacteria is Bacillus subtilis, it further includes inserting six copies of the encoding gene for adenine thiotransferase, as shown in SEQ ID NO.7, into the cysH gene site in the genome.
[0020] The fifth object of the present invention is to provide the application of the engineered bacteria in the fermentation production of 3'-adenosine-5'-phosphate sulfate, wherein the application uses ribose and adenosine as substrates to synthesize 3'-adenosine-5'-phosphate sulfate de novo using the engineered bacteria.
[0021] In one embodiment of the present invention, the application specifically involves fermenting the engineered bacteria using a culture medium supplemented with ribose and adenosine.
[0022] In one embodiment of the present invention, the culture medium is LB medium or TB medium.
[0023] In one embodiment of the invention, ribose and adenosine are added during the fermentation process.
[0024] In one embodiment of the present invention, the fermentation is shake-flask fermentation, and the fermentation conditions are an inoculum size of 2-5% and an initial OD value of [missing information]. 600 The concentration is 0.8–1.0, the fermentation temperature is 30–38℃, the rotation speed is 220 rpm, and the fermentation cycle is 30–36 hours.
[0025] In one embodiment of the present invention, the fermentation is carried out in a fermenter, and the fermentation conditions are: inoculum size 5-15%, liquid volume 20-60%, and initial OD of fermentation. 600 The optimal concentration is 0.8–1.0, the fermentation temperature is 30–38℃, the rotation speed is 300–700 rpm, the pH is controlled at 6.5–7.5, the aeration rate is 1–2 vvm, and the fermentation cycle is 30–36 h.
[0026] Beneficial effects
[0027] This invention constructs a novel PAPS biosynthesis pathway, achieving an in vitro multi-enzyme cascade catalytic molar conversion rate of 22.85%. The PAPS synthesis pathway is applied to industrial chassis strains Escherichia coli and Bacillus subtilis to construct PAPS cell factories, achieving efficient PAPS biosynthesis in a 5-L fermenter with PAPS yields of 7.60 g / L and 5.03 g / L, respectively. This provides a scalable and cost-effective solution for the production of sulfated compounds. Attached Figure Description
[0028] Figure 1 Schematic diagram of the synthesis pathway for novel PAPS.
[0029] Figure 2 HPLC-MS chromatogram of PAPS.
[0030] Figure 3 Schematic diagram of pET-Duet-RBSK-PRS-APRT plasmid.
[0031] Figure 4 pRSF-Duet-APSK * - Schematic diagram of the APSST-PPK2 plasmid.
[0032] Figure 5 Results of shake-flask fermentation of recombinant Escherichia coli.
[0033] Figure 6 Fermentation results of recombinant Escherichia coli in a 5-L fermenter.
[0034] Figure 7 Schematic diagram of pTA-RBSK-PRS-APRT plasmid.
[0035] Figure 8 pHT-APSK * - Schematic diagram of the APSST-PPK2 plasmid.
[0036] Figure 9 Fermentation and results analysis of recombinant Bacillus subtilis in a 5-L fermenter. Detailed Implementation
[0037] Plasmids were constructed using classical molecular biology techniques.
[0038] Table 1. Carrier-related characteristics
[0039]
[0040] The culture media involved in the following examples are as follows:
[0041] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, sterilized at 121°C for 20 min.
[0042] LB solid medium: LB liquid medium with 2% agar added.
[0043] TB liquid culture medium: KH2PO4 2.31g / L, K2HPO4·3H2O 16.42g / L, yeast extract 24g / L, peptone 12g / L, glycerol 4g / L.
[0044] The detection methods used in the following embodiments are as follows:
[0045] PAPS determination by HPLC-MS: Analysis was performed using an HPLC system equipped with a polyamine column (YMC Pack polyamine II, 250 mm × 4.6 mm). 0.7 mM KH₂PO₄, after filtration and ultrasonic degassing, was used as the mobile phase at a flow rate of 0.6 mL / min. Throughout the procedure, the column temperature was maintained at 30 °C, and the detection wavelength was 254 nm.
[0046] The sequences involved in the following embodiments:
[0047] SEQ ID NO.1:
[0048] ATGGCAGCTTCAGGAGAACCCCAGAGGCAATGGCAAGAGGAAGTTGCTGCTGTGGTGGTCGTCGGCTCCTGCATGACTGATCTCGTGAGCTTGACCTCTCGCCTGCCAAAGACGGGTGAGACAATTCACGGCCATAAATTCTTCATTGGTTTTGGAGGTAAGGGTGCCAACCAGTGTGTTCAAGCGGCGCGTCTGGGTGCTATGACCAGCATGGTATGCAAAGTGGGCAAGGACAGCTTCGGCAATGACTACATTGAAAACTTGAAGCAAAACGATATTTCCACCGAGTTCACCTATCAGACCAAAGACGCCGCTACTGGCACCGCAAGCATTATTGTGAACAACGAAGGTCAGAACATTATCGTGATCGTGGCGGGTGCGAATCTGCTGCTCAACACCGAGGACCTGCGCGCAGCGGCGAACGTGATCTCTCGTGCAAAAGTCATGGTGTGCCAACTGGAAATCACCCCAGCGACCAGCCTGGAAGCTCTCACGATGGCACGCCGTTCAGGTGTTAAGACCTTGTTTAACCCGGCTCCGGCCATTGCGGACCTGGACCCGCAGTTTTACACCCTGTCCGATGTTTTTTGTTGTAATGAGAGCGAAGCCGAGATCCTGACCGGCCTGACGGTTGGCAGTGCAGCGGACGCGGGCGAAGCAGCCCTGGTTCTGCTGAAACGTGGTTGCCAGGTTGTTATCATCACCCTTGGCGCGGAGGGCTGCGTGGTCCTGAGCCAGACTGAGCCGGAACCGAAGCACATCCCGACCGAGAAAGTGAAGGCGGTTGATACCACCGGTGCGGGTGATTCGTTCGTGGGTGCGCTGGCGTTTTACCTGGCGTATTACCCGAATTTGTCTTTGGAGGACATGCTGAATCGTTCCAACTTCATCGCCGCGGTTAGCGTTCAAGCGGCGGGTACGCAGAGCAGCTATCCGTATAAAAAAGACTTACCGCTGACGCTGTTC
[0049] SEQ ID NO.2:
[0050] ATGAGTAACGAATATGGCGATAAAAATTTGAAGATTTTCTCTTTGAACAGTAACCCCGAACTGGCAAAGGAGATTGCCGACAACGTTGGCGTACAGCTTGGTAAATGTTCCGTGACGCGCTTCAGTGATGGTGAGGTACAAATCAACATCGAAGAATCAATCCGTGGATGCGACTGTTACATTATTCAATCAACTTCAGCACCTGTCAATGAACACATCATGGAGTTGTTAATTATGGTTGATGCGTTGAAGCGTGCATCTGCTAAGACTATCAACATTGTTATTCCATACTACGGATATGCCCGTCAGGATCGCAAGGCACGCAGCCGCGAACCCATTACTGCCAAGTTATTTGCAAACTTGTTGGAAACCGCCGGTGCCACGCGTGTGATCGCTTTGGATATTCACGCTCCGCAGATTCAGGGGTTCTTCGATATCCCGATCGACCATCTGATGGGCGTCCCAATCCTGGGTCATTATTTTGAAGGCAAGGATTTAAAAGACATCGTCATTGTGTCTCCTGATCACGGGGGAGTCACGCGCGCTCGTAAACTTGCAGACCGCTTGAAAGCACCAATTGCCATCATTGACAAGCGTCGTCCCCGCCCCAACGAAGTGGAGGTCATGAATATCGTCGGAAATGTAGAGGGAAAGACCGCCATCCTTATTGATGACATCATTGATACAGCGGGCACAATCACATTGGCTGCTAACGCGCTTGTGGAGAATGGAGCAGCGGAGGTTTACGCGTGCTGCACTCATCCGGTACTGTCCGGTCCAGCGGTGGAGCGCATCAATAATTCTAAGATCAAGGAATTAGTTGTTACAAACTCAATCAAGTTGCCAGAGGAGAAGAAAATTGAACGTTTCAAGCAATTGAGTGTAGGGCCCTTACTGGCAGAAGCCATCATCCGCGTGCACGAAAAGCAGAGTGTCTCGTACCTGTTTTCG
[0051] SEQ ID NO.3:
[0052] ATGTCAGATGACAGGATAAATTATCTAAAAAACAAGCTGGTGCAGTACCCGGATTTTCCGAAAAAAGGTATCCTGTTCGAAGACATCATGCCGATTTTTCAGGACCCGAGAGCATTCGGCATTCTGATCGACCTGCTGCTTGAGGCCGTTGAAACCGAGTTCAACAACATCGATGTTATTGTGGGTCTGGAGGCGCGTGGTTTTCTGTTCGGCCCTACGTTGGCGCTGCGCGCGAACTGCGCGTTTGTTCCGGTTCGTAAGCCGAATAAGCTGCCGGGTGATCTGGTGGTGGTTTCCTACAATAAAGAGTATAGCACCGACAGCTTCGCGATTCAAAAAGGTACGATCAAACCAGGCCAGCGTGTTCTGATTGTCGATGACATCCTTGCCACCGGCGGTACGGCTCTGGCGGCAGATGAGCTGGTCACCCGTCTGGGTGGTGAATTAGTGGGCCACTTGTTCTTGTTGGAGTTAACCTTTCTGCAAGGTCGTAAGCGCTTGATGGCACCGACCTATACCTTGCTGACTGGCCAAGACGAGGCTCCGGATGGCTCTGAGTTCGCG
[0053] SEQ ID NO.4:
[0054] ATGTCATTTAGGTTCGGACAACACCTAATAAAGCCGAGCGTTGTCTTTCTGAAAACCGAACTGAGCTTCGCCTTGGTTAACCGCAAGCCGGTTGTTCCGGGTCATGTGCTGGTGTGCCCGCTGAGACCTGTTGAACGTTTTCGCGACATGAGCCCGGAGGAGGTTGCAGACTTGTTTCAAGCGGCGCAGCGCGTGGGCACGGTGGTCGAGAAGCACTTCCAAGGTACTTCGCTGACCTTTTCCATGCAGGATGGTCCAGAGGCCGGCCAGACCGTAAAACACGTGCACGTTCATATTCTGCCGCGTAAAGCGGGCGACTTCCATCGTAATGATTCTATCTATGATGCATTGGAAAAGCACGATCGTGAAGACAAAGACTCCCCGGCACTGTGGCGTAGCGAAGAGGAGATGGCTGCTGAAGCGGCGGCGTTACGTGTGTACTTCCAA
[0055] SEQ ID NO.5:
[0056] ATGTCCACTAATATCACCTTCCATGCCTCTGCACTGACTCGTTCGGAACGTACAGAATTACGCAATCAGCGCGGCCTTACAATCTGGCTGACTGGGCTGTCGGCATCGGGTAAGTCAACTTTGGCCGTAGAATTAGAGCACCAACTTGTTCGTGACCGCGGCGTACACGCCTATCGTCTTGATGGAGATAACATTCGTTTCGGACTTAACAAGGACTTAGGTTTCAGCGAGGCGGACCGCAATGAAAACATTCGCCGTATCGCGGAAGTGGCAAAACTTTTCGCCGACTCCAATAGCATCGCAATTACTTCTTTTATTAGTCCATATCGTAAGGATCGCGATACAGCGCGTCAGCTTCACGAGGTAGCGACACCTGGGGAGGAGACCGGGCTGCCGTTTGTTGAGGTTTACGTTGACGTGCCCGTGGAGGTAGCAGAACAACGTGACCCGAAAGGACTTTATAAGAAGGCCCGTGAAGGAGTGATCAAGGAATTTACGGGCATTTCCGCACCTTATGAAGCTCCAGCTAACCCTGAAGTACACGTTAAAAATTACGAATTACCCGTCCAAGATGCTGTGAAACAAATTATTGACTATCTGGATTCTAAGGGCTACCTGCCTGCGAAGAAGGAGCTCGAG
[0057] SEQ ID NO.6:
[0058]
[0059] SEQ ID NO.7:
[0060] ATGTCATTTAGGTTCGGACAAATGCTAATAAAGCCGAGCGTTGTCTTTCTGAAAACCGAACTGAGCTTCGCCTTGGTTAACCGCAAGCCGGTTGTTCCGGGTCATGTGCTGGTGTGCCCGCTGAGACCTGTTGAACGTTTTCGCGACATGAGCCCGGAGGAGGTTGCAGACTTGTTTCAAGCGGCGCAGCGCGTGGGCACGGTGGTCGAGAAGCACTTCCAAGGTACTTCGCTGACCTTTTCCATGCAGGATGGTCCAGAGGCCGGCCAGACCGTAAAACACGTGCACGTTCATATTCTGCCGCGTAAAGCGGGCGACTTCCATCGTAATGATTCTATCTATGATGCAGATGAAAAGCACGATCGTGAAGACAAAGACTCCCCGGCACTGTGGCGTAGCGAAGAGGAGATGGCTGCTGAAGCGGCGGCGTTACGTGTGTACTTCCAA
[0061] SEQ ID NO.8:
[0062] ATGTCCAAACTCGATCTAAACGCCCTGAACGAACTGCCGAAGGTAGATCGCATTCTGGCGCTGCGGGAAACTAACGCCCAACTGGAAAAACTGGACGCTGAAGGCCGCGTAGCCTGGGCGCTGGATAATCTGCCCGGTGAATATGTGCTTTCTTCCAGCTTCGGCATTCAGGCGGCGGTGAGC CTGCATCTGGTGAATCAGATTCGGCCGGATATTCCAGTGATCCTCACCGATACCGGTTATCTGTTTCCGGAAACCTACCGCTTTATTGACGAGTTAACGGACAAACTCAAGCTCAACCTGAAAGTGTACCGTGCTACCGAAAGCGCCGCCTGGCAGGAAGCACGCTACGGCAAACTGTGGGAAC AGGGCGTTGAAGGCATTGAAAAGTACAATGACATCAACAAAGTCGAACCGATGAACCGGGCGCTGAAAGAACTTAACGCGCAAACCTGGTTTGCTGGCCTGCGCCGAACAATCCGGCAGCCGCGCCAATTTACCGGTGCTGGCAATTCAGCGTGGCGTATTTAAAGTGCTGCCGATTATCGA CTGGGATAACCGAACTATTTATCAGTACCTGCAAAAACATGGCCTGAAATATCACCCATTATGGGATGAAGGATATTTATCGGTCGGTGATACCCATACAACCCGTAAATGGGAACCTGGCATGTCGGAAGAAGAAACACGTTTCTTTGGCTTAAAAAGGGAATGTGGATTGCACGAAGGGTAA
[0063] Example 1: Screening of enzymes in the synthetic pathway
[0064] 1. Screening for ribokinase (RBSK):
[0065] (1) The chemically synthesized ribokinases are derived from: Escherichia coli ribokinase (NCBI number: 948260), Saccharomyces cerevisiae ribokinase (NCBI number: 850402), and human ribokinase as shown in SEQ ID NO.1;
[0066] (2) The ribokinase obtained in step (1) was ligated to the pET-28a vector to prepare recombinant vectors;
[0067] (3) The prepared recombinant vectors were introduced into E. coli BL21(DE3) strains respectively to prepare recombinant strains;
[0068] The prepared recombinant strains were inoculated into LB liquid medium and cultured at 220 rpm and 37 ℃ for 8–12 h to prepare seed culture.
[0069] The resulting seed culture was inoculated into TB liquid medium at an inoculum rate of 2% (v / v) and cultured at 220 rpm and 37°C until OD reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction, and incubate at 220 rpm and 25°C for 16 h. After centrifugation, collect the bacterial cells separately;
[0070] (4) Measure the R5P production of whole cells after induction expression obtained in step (3).
[0071] The reaction conditions were as follows: 10 g / L of the prepared wet bacterial cells were added to 10 mL of Tris-HCl buffer (50 mM, pH 7.0). The reaction system also contained 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, and 5 mM MgCl2. The mixture was incubated at 37 °C for 10 h. After the reaction, a portion of the conversion solution was centrifuged at 10,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm microfiltration membrane and analyzed by HPLC to determine the R5P content in the reaction solution after the reaction.
[0072] The results showed that the R5P production of the recombinant strain expressing ribokinase from Escherichia coli was 3.05 mM.
[0073] The R5P production of the recombinant strain of ribokinase from Saccharomyces cerevisiae was 1.85 mM.
[0074] The R5P production of the recombinant strain of human ribokinase was 3.97 mM.
[0075] 2. Screening for phosphoribosyl pyrokinase (PRS):
[0076] (1) The chemical synthesis is derived from: phosphoribosyl pyrokinase of Escherichia coli (NCBI number: 945772), phosphoribosyl pyrokinase of Mycobacterium tuberculosis (NCBI number: BAH25337), and phosphoribosyl pyrokinase of Bacillus amyloliquefaciens shown in SEQ ID NO.2;
[0077] (2) The phosphoribosyl pyrokinases obtained in step (1) and the human ribokinase shown in SEQ ID NO.1 were respectively linked to the pET-28a vector to prepare recombinant vectors;
[0078] (3) The prepared recombinant vectors were introduced into E. coli BL21(DE3) strains respectively to prepare recombinant strains;
[0079] The prepared recombinant strains were inoculated into LB liquid medium and cultured at 220 rpm and 37 ℃ for 8–12 h to prepare seed culture.
[0080] The resulting seed culture was inoculated into TB liquid medium at an inoculum rate of 2% (v / v) and cultured at 220 rpm and 37°C until OD reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction, and incubate at 220 rpm and 25°C for 16 h. After centrifugation, collect the bacterial cells separately;
[0081] (4) PRPP production was determined by whole-cell reaction of the bacterial cells after induction of expression obtained in step (3);
[0082] The reaction conditions were as follows: 10 g / L of the prepared wet bacterial cells were added to 10 mL of Tris-HCl buffer (50 mM, pH 7.0). The reaction system also contained 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, and 5 mM MgCl2. The mixture was incubated at 37 °C for 10 h. After the reaction, a portion of the conversion solution was centrifuged at 10,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm microfiltration membrane and analyzed by HPLC to determine the PRPP content in the reaction solution after the reaction.
[0083] The results showed that the PRPP production of the recombinant strain expressing phosphoribosyl pyrophosphate kinase from Escherichia coli was 2.80 mM.
[0084] The PRPP production of the recombinant strain of Mycobacterium tuberculosis, which expressed phosphoribosyl pyrophosphate kinase, was 2.92 mM.
[0085] The PRPP production of the recombinant strain of Bacillus amyloliquefaciens, which expresses phosphoribosyl pyrophosphate kinase, was 3.35 mM.
[0086] 3. Screening for phosphoribosyltransferase (APRT)
[0087] (1) The chemical synthesis was derived from: the phosphoribosyltransferase of Arabidopsis thaliana (NCBI number: 839636), the phosphoribosyltransferase of Escherichia coli (NCBI number: 945113), and the phosphoribosyltransferase of Schizosaccharomyces cerevisiae shown in SEQ ID NO.3;
[0088] (2) The human ribokinase shown in SEQ ID NO.1, the phosphoribosyl pyrokinase shown in SEQ ID NO.2 from Bacillus amyloliquefaciens, and the phosphoribosyltransferases from different sources obtained in step (1) were respectively linked to the pET-28a vector to prepare recombinant vectors;
[0089] (3) The prepared recombinant vectors were introduced into E. coli BL21(DE3) strains respectively to prepare recombinant strains;
[0090] The prepared recombinant strains were inoculated into LB liquid medium and cultured at 220 rpm and 37 ℃ for 8–12 h to prepare seed culture.
[0091] The resulting seed culture was inoculated into TB liquid medium at an inoculum rate of 2% (v / v) and cultured at 220 rpm and 37°C until OD reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction, and incubate at 220 rpm and 25°C for 16 h. After centrifugation, collect the bacterial cells separately;
[0092] (4) AMP production was measured by reacting the whole cells of the induced bacterial cells obtained in step (3);
[0093] The reaction conditions were as follows: 10 g / L of the prepared wet bacterial cells were added to 10 mL of Tris-HCl buffer (50 mM, pH 7.0). The reaction system also contained 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, 5 mM MgCl2, and 5 mM adenosine. The mixture was incubated at 37 °C for 10 h. After the reaction, a portion of the conversion solution was centrifuged at 10,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm microfiltration membrane and analyzed by HPLC to determine the AMP content in the reaction solution after the reaction.
[0094] The results showed that the AMP production of the recombinant strain expressing the phosphoribosyltransferase derived from Arabidopsis thaliana was 0.33 mM.
[0095] The AMP production of the recombinant strain expressing phosphoribosyltransferase from Escherichia coli was 1.11 mM.
[0096] The AMP production of the recombinant strain of *Schizosaccharomyces cerevisiae*, which expressed phosphoribosyltransferase, was 1.76 mM.
[0097] 4. Screening for adenosine phosphate kinase (APSK)
[0098] (1) The chemical synthesis is derived from: adenosine phosphate sulfate kinase from Escherichia coli (NCBI number: 947221), adenosine phosphate sulfate kinase from Saccharomyces cerevisiae (NCBI number: 853869), and adenosine phosphate sulfate kinase from Penicillium chrysogenum as shown in SEQ ID NO.5;
[0099] (2) The bovine adenine thiotransferase (APSST*) shown in SEQ ID NO.7 and the adenosine phosphate sulfate kinases from different sources obtained in step (1) were respectively linked to the pET-28a vector to prepare recombinant vectors;
[0100] (3) The prepared recombinant vectors were introduced into E. coli BL21(DE3) strains respectively to prepare recombinant strains;
[0101] The prepared recombinant strains were inoculated into LB liquid medium and cultured at 220 rpm and 37 ℃ for 8–12 h to prepare seed culture.
[0102] The resulting seed culture was inoculated into TB liquid medium at an inoculum rate of 2% (v / v) and cultured at 220 rpm and 37°C until OD reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction, and incubate at 220 rpm and 25°C for 16 h. After centrifugation, collect the bacterial cells separately;
[0103] (4) Measure the PAPS production of the whole cells after induced expression obtained in step (3);
[0104] The reaction conditions were as follows: 10 g / L of the prepared wet bacterial cells were added to 10 mL of Tris-HCl buffer (50 mM, pH 7.0). The reaction system also contained 20 mM AMP, 200 mM Na2SO4, 4 mM ATP, and 20 mM MgCl2. The mixture was incubated at 37 °C for 10 h. After the reaction, a portion of the conversion solution was centrifuged at 10,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm microfiltration membrane and analyzed by HPLC to determine the PAPS content in the reaction solution after the reaction.
[0105] The results showed that the PAPS production of the recombinant strain expressing adenosine phosphate sulfate kinase from Escherichia coli was 10.28 mM.
[0106] The PAPS production of the recombinant strain of Saccharomyces cerevisiae, which expressed adenosine phosphate sulfate kinase, was 9.11 mM.
[0107] The PAPS production of the recombinant strain of Penicillium chrysogenum, expressing adenosine phosphate sulfate kinase, was 14.12 mM.
[0108] 5. Screening for polyphosphokinase 2 (PPK2)
[0109] (1) The chemical synthesis is derived from: polyphosphokinase 2 from Escherichia coli (NCBI number: 946971) and polyphosphokinase 2 from spherocytes as shown in SEQ ID NO. 6;
[0110] (2) The polyphosphokinase 2 from different sources obtained in step (1) were respectively linked to the vector to prepare recombinant vectors;
[0111] (3) The prepared recombinant vectors were introduced into E. coli BL21(DE3) strains respectively to prepare recombinant strains;
[0112] The prepared recombinant strains were inoculated into LB liquid medium and cultured at 220 rpm and 37 ℃ for 8–12 h to prepare seed culture.
[0113] The resulting seed culture was inoculated into TB liquid medium at an inoculum rate of 2% (v / v) and cultured at 220 rpm and 37°C until OD reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction, and incubate at 220 rpm and 25°C for 16 h. After centrifugation, collect the bacterial cells separately;
[0114] (4) ATP production was measured by whole-cell reaction of the bacterial cells after induction of expression obtained in step (3);
[0115] The reaction conditions were as follows: 10 g / L of the prepared wet bacterial cells were added to 10 mL of Tris-HCl buffer (50 mM, pH 7.0). The reaction system also contained 20 mM ADP, 20 mM sodium hexapolyphosphate, and 20 mM MgCl2. The mixture was incubated at 37 °C for 10 h. After the reaction, a portion of the conversion solution was centrifuged at 10,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm microfiltration membrane and analyzed by HPLC to determine the ATP content in the reaction solution after the reaction.
[0116] The results showed that the ATP production of the recombinant strain expressing polyphosphokinase 2 from Escherichia coli was 12.38 mM.
[0117] The ATP production of the recombinant strain expressing polyphosphokinase 2 derived from spherocytes was 18.21 mM.
[0118] Example 2: Construction of a novel PAPS biosynthetic pathway in vitro
[0119] (1) Expression pathway enzyme carrier
[0120] The sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.5, and SEQ ID NO.6 were chemically synthesized to form RBSK, PRS, APRT, and APSST, respectively. * The encoding genes for APSK and PPK2 enzymes were extracted and ligated into the pET28a vector to prepare recombinant vectors: pET28a-RBSK, pET28a-PRS, pET28a-APRT, and pET28a-APSST. * , pET28a-APSK, pET28a-PPK2.
[0121] (2) The prepared recombinant vectors were transformed into Escherichia coli BL21 cells, and after induction expression and Ni column affinity purification, six pure enzymes were obtained.
[0122] These six purified enzymes (RBSK, PRS, APRT, APSST) * The amounts of APSK and PPK2 enzymes added were 0.01 mM, 0.02 mM, 0.06 mM, 0.1 mM, 0.1 mM, and 0.1 mM, respectively. Ribose (5 mM) and adenosine (5 mM) were mixed and added to 10 mL of Tris-HCl buffer (50 mM, pH 7.5) to construct a multi-enzyme cascade system, namely the in vitro PAPS biosynthetic pathway. Figure 1 React at 30℃ and 220rpm for 20 minutes, then immediately stop the reaction at 4℃ to obtain the reaction solution;
[0123] (3) The obtained reaction solution was centrifuged at 12,000 rpm for 15 min. The supernatant was subjected to two freeze-thaw cycles at -80℃. A 50 μL sample was diluted 5 times and immediately centrifuged at 4℃ for 12,000 rpm for 15 min. The supernatant was then analyzed by ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS), and PAPS was successfully detected. Figure 2 The molar conversion rate of adenine to PAPS reached 22.85%, confirming the feasibility of this pathway.
[0124] Example 3: Construction of PAPS-producing engineered Escherichia coli
[0125] The specific steps are as follows:
[0126] (1) Gene editing of Escherichia coli BL21(DE3) was performed using the CRISPR-Cas9 system.
[0127] Build APSST * Integration Frame: Primers cysH-F1, cysH-R1, cysH-F2, and cysH-R2 (Table 2) were designed based on the gene cysH (SEQ ID NO. 8) encoding the PAPS degrading enzyme (NP_417242.1). Using E. coli BL21(DE3) genome as a template, the upstream and downstream homologous arms of the cysH gene were amplified using primers cysH-F1 / cysH-R1 and cysH-F2 / cysH-R2, respectively. PCR system: 1 μL of 50 ng / μL genomic DNA, 1 μL each of 10 μM primers cysH-F1 and cysH-R1, 25 μL of 2×PrimeSTAR MAX Premix, and 2 μL of ddH2O2. PCR conditions: 98℃ pre-denaturation for 5 min; temperature cycling: 98℃ for 10 s, 57℃ for 15 s, 72℃ for 1 min, 30 cycles; termination at 4℃. The PCR products were verified by 1% agarose gel electrophoresis and then purified using the PCR Purification Kit.
[0128] Synthesize three copies of APSST based on the sequence shown in SEQ ID NO.8 (cysH gene). * Gene fragments.
[0129] Using cysH-F1 / cysH-R2 as primers, the upstream fragment of cysH, three copies of the APSST* gene, and the downstream fragment of cysH were assembled by fusion PCR to obtain the APSST gene inserted at the cysH gene site. * Integration box.
[0130] Construction of pTargetF plasmid: Based on the CRISPR / Cas9 gene editing principle, Suzhou Genewise Biotech Co., Ltd. synthesized a specific guide sgRNA sequence with the target recognition gene cysH and ligated it into the pTargetF plasmid to construct pTargetF-cysH.
[0131] Transformation with pCas9 plasmid: The pCas9 plasmid was electroporated into E. coli BL21(DE3) cells, plated on LB agar plates containing 50 mg / L kanamycin, and cultured at 30°C for 24 h. Positive transformants were screened and sequenced to obtain E. coli BL21(DE3)-pCas9 strain. The cells were cultured in LB medium containing 50 μg / mL kanamycin and 0.01 M arabinose to induce homologous recombinase expression. Cells were collected to prepare electroporated competent cells.
[0132] Gene editing: APSST * The integration box and pTargetF-cysH plasmid were co-electroporated into E.coli BL21(DE3)-pCas9 competent cells. After 1 h of recovery, the cells were plated on LB agar plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin hydrochloride and incubated at 30 °C for 24 h. Positive transformants were selected for colony PCR verification.
[0133] Elimination of pTargetF plasmid: Positive transformants were transferred into LB medium, and 0.43 mM IPTG was added to induce the expression of endonuclease on the pCas9 plasmid, which cleaved pTargetF-cysH. After culturing for 12 h, the plasmids were streaked onto LB monoclonal antibody plates containing 50 μg / mL kanamycin and LB double antibody plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin hydrochloride, respectively. The plates were incubated at 30 °C for 12 h. Strains with pTargetF-cysH plasmid eliminated could only grow on monoclonal antibody plates and could not grow on double antibody plates.
[0134] Following steps (1) to (5), integrate three copies of APSST at the rph pseudogene locus. * The genes and related primers are shown in Table 2.
[0135] After gene editing, the strain was cultured at 42°C to eliminate the pCas9 plasmid, resulting in a cysH-knockout, six-copy inserted APSST. * The recombinant strain E. coli BL21(DE3)(ΔcysH,3APPST * ;Δrph,3APPST * ).
[0136] Table 2 Primers and Sequences
[0137]
[0138]
[0139] (2) Construction of pathway enzyme expression vector
[0140] Construction of the pET-Duet-RBSK-PRS-APRT vector: The encoding genes for RBSK, PRS, and APRT enzymes were synthesized according to the sequences shown in SEQ ID NO. 1–3, and ligated into the pET-Duet vector, so that RBSK, PRS, and APRT are each promoted by the T7 promoter. Figure 3 ).
[0141] Construct pRSF-Duet-APSK-APSST * -PPK2 vector: APSK and APSST were synthesized according to the sequences shown in SEQ ID NO.5, 7, and 6, respectively. * The PPK2 enzyme encoding gene is ligated into the pRSF-Duet vector, enabling APSK and APSST to be expressed. * Both PPK2 and PPK2 are booted by the T7 bootloader. Figure 4 ).
[0142] (3) Construction of recombinant Escherichia coli
[0143] The vectors pET-Duet-RBSK-PRS-APRT and pRSF-Duet-APSK-APSS*-PPK2 were co-electroporated into the recombinant strain E. coli BL21(DE3)(ΔcysH,3APPST) constructed in Example 2. * ;Δrph,3APPST * In this study, a recombinant bacterium carrying two plasmids was obtained and named strain E. coli BL21(DE3)(ΔcysH,3APPST). * ;Δrph,3APPST * )-PAPS, preserved using glycerol.
[0144] Example 4: Shake-flask fermentation of recombinant Escherichia coli
[0145] The E. coli BL21(DE3)(ΔcysH,3APPST constructed in Example 3 was used. * ;Δrph,3APPST * The PAPS strain was streaked onto agar plates, and a single colony was picked and inoculated into LB liquid medium containing 100 μg / mL ampicillin and 50 μg / mL kanamycin, and incubated overnight at 37°C and 220 rpm. At a 3% inoculum rate, 5 mL of the seed culture was transferred to a 500 mL shake flask containing 145 mL of TB medium, and 100 μg / mL ampicillin, 50 μg / mL kanamycin, 10 mg / mL adenosine, 10 mg / mL ribose, and 20 mM sodium sulfate were added.
[0146] Fermentation conditions: initial temperature 37℃, rotation speed 220 rpm, OD 600When the concentration reached 0.7, 0.1 mg / mL IPTG was added, and the induction temperature was 16℃. The fermentation speed was 200-250 rpm, and fermentation continued for 35 h. After fermentation, the final volume was measured, cells were collected by centrifugation and lysed, and the cell lysate was collected by centrifugation. The PAPS yield was determined by HPLC. E. coli BL21(DE3) was used as a control.
[0147] The results are as follows Figure 5 As shown, the recombinant strain E. coli BL21(DE3)(ΔcysH,3APPST) * ;Δrph,3APPST * PAPS was fermented in shake flasks, and the PAPS yield was 5.08 g / L.
[0148] Example 5: Fermentation of recombinant Escherichia coli in a 5-L fermenter
[0149] Seed culture preparation was the same as in Example 4. 2.25 L of fermentation medium was prepared, and 250 mL of seed culture was injected into the fermenter through the inoculation port at a 10% inoculation rate, maintaining sterility throughout the process to achieve an initial volume of 2.5 L. Fermentation conditions: initial rotation speed 400 rpm, initial aeration rate 1.0 vvm, initial pH 7.0, temperature 37℃; OD 600 When the pH reached 2.5, IPTG (0.4 mM), adenosine (10 mg / mL), ribose (10 mg / mL), and sodium sulfate (20 mM) were added through the feed inlet, and fermentation continued for 20 hours. Throughout the fermentation cycle, concentrated ammonia was automatically added to maintain the pH in the tank at 7.0. After fermentation, the final volume was measured, cells were collected by centrifugation and lysed, and the supernatant of the cell lysate was collected. PAPS yield was determined by HPLC. E. coli BL21(DE3) was used as a control.
[0150] The results are as follows Figure 6 As shown, the recombinant strain E. coli BL21(DE3)(ΔcysH,3APPST) * ;Δrph,3APPST * PAPS was fermented in a 5-L tank, and the PAPS yield was 7.60 g / L.
[0151] Example 6: Construction of PAPS-producing Bacillus subtilis engineered strain
[0152] The specific steps are the same as in Example 3. First, Bacillus subtilis 168 is used as the chassis strain to construct an APSST strain with the cysH gene knocked out and six copies inserted. * The recombinant strain B. subtilis 168(ΔcysH,6APSST) *The primers used are shown in Table 3, and APSST* is inserted into the cysH site. Further, the pTA-RBSK-PRS-APRT vector was constructed. Figure 7 ) and pHT-APSK-APSST-PPK2 vector ( Figure 8 ), jointly electrotransformed to B. subtilis 168(ΔcysH,6APSST) * A recombinant bacterium carrying two plasmids was obtained and named strain B. subtilis 168(ΔcysH,6APPST). * )-PAPS, preserved using glycerol.
[0153] Table 3 Primers and Sequences
[0154]
[0155] Example 7: Fermentation of recombinant Bacillus subtilis in a 5-L fermenter
[0156] The B. subtilis 168(ΔcysH,6APSST) constructed in Example 6 was used. * PAPS strains were streaked onto plates, and single colonies were picked and inoculated into LB broth containing 100 μg / mL chloramphenicol and 50 μg / mL kanamycin. The cultures were incubated overnight at 37°C and 220 rpm. Fermentation conditions: initial aeration rate 400 rpm, initial aeration rate 1.0 vvm, initial pH 7.0, temperature 37°C; OD 600 When the pH reached 12.5, xylose (0.4 mM), adenosine (10 mg / mL), ribose (10 mg / mL), and sodium sulfate (20 mM) were added through the feed inlet, and fermentation continued for 20 hours. Throughout the fermentation cycle, concentrated ammonia was automatically added to maintain the pH in the tank at 7.0. After fermentation, the final volume was measured, cells were collected by centrifugation and lysed, and the cell lysate was collected by centrifugation. PAPS yield was determined by HPLC. B. subtilis 168 was used as a control.
[0157] The results are as follows Figure 9 As shown, the recombinant strain B. subtilis 168(ΔcysH,6APSST) * PAPS was fermented in a 5-L tank, and the PAPS yield was 5.03 g / L.
[0158] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An enzyme composition for producing 3'-adenosine-5'-phosphate sulfate, characterized in that, It is composed of the following enzymes: ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine thiotransferase, adenosine phosphate sulfokinase, and polyphosphokinase 2; The nucleotide sequences of the gene encoding the ribokinase are shown in SEQ ID NO. 1; the nucleotide sequences of the gene encoding the phosphoribosylpyrophosphate kinase are shown in SEQ ID NO. 2; the nucleotide sequences of the gene encoding the phosphoribosyltransferase are shown in SEQ ID NO. 3; the nucleotide sequences of the gene encoding the adenine sulfonyltransferase are shown in SEQ ID NO. 4 or SEQ ID NO. 7; the nucleotide sequences of the gene encoding the adenosine phosphate sulfate kinase are shown in SEQ ID NO. 5; and the nucleotide sequences of the gene encoding the polyphosphokinase 2 are shown in SEQ ID NO.
6.
2. The use of the enzyme composition according to claim 1 in the production of 3'-adenosine-5'-phosphate sulfate, characterized in that, Specifically, the enzyme in the enzyme composition is used as a catalyst, and ribose and adenine are used as substrates to catalyze the reaction to obtain 3'-adenosine phosphate-5'-phosphate sulfate.
3. Use according to claim 2, characterized in that, The enzymes added to the enzyme composition are ribokinase (0.005-0.015 mM), phosphoribosylpyrokinase (0.01-0.03 mM), phosphoribosyltransferase (0.05-0.07 mM), adenine thiotransferase (0.05-0.15 mM), adenosine phosphate sulfate kinase (0.05-0.15 mM), and polyphosphokinase 2 (0.05-0.15 mM).
4. Use according to claim 2, characterized in that, The amount of ribose added is 1~10 mM, and the amount of adenine added is 1~10 mM.
5. Use according to claim 2, characterized in that, The reaction conditions for the catalytic reaction are 25~35℃, 200~300 rpm, and 10~60 min.
6. A nucleic acid vector, characterized in that, The nucleic acid vector contains coding sequences encoding the following enzymes: ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine thiotransferase, adenosine phosphate sulfokinase, and polyphosphokinase 2, wherein the coding sequences of the enzymes are located within one, two, or more expression frames. The nucleotide sequences of the gene encoding the ribokinase are shown in SEQ ID NO. 1; the nucleotide sequences of the gene encoding the phosphoribosylpyrophosphate kinase are shown in SEQ ID NO. 2; the nucleotide sequences of the gene encoding the phosphoribosyltransferase are shown in SEQ ID NO. 3; the nucleotide sequences of the gene encoding the adenine sulfonyltransferase are shown in SEQ ID NO. 4 or SEQ ID NO. 7; the nucleotide sequences of the gene encoding the adenosine phosphate sulfate kinase are shown in SEQ ID NO. 5; and the nucleotide sequences of the gene encoding the polyphosphokinase 2 are shown in SEQ ID NO.
6.
7. An engineered bacterium expressing the enzyme composition of claim 1, characterized in that, The engineered bacteria express the following enzymes: ribokinase, phosphoribosylpyrokinase, phosphoribosyltransferase, adenine thiotransferase, adenosine phosphate sulfokinase, and polyphosphokinase 2; The nucleotide sequences of the gene encoding the ribokinase are shown in SEQ ID NO. 1; the nucleotide sequences of the gene encoding the phosphoribosyl pyrophosphate kinase are shown in SEQ ID NO. 2; the nucleotide sequences of the gene encoding the phosphoribosyltransferase are shown in SEQ ID NO. 3; the nucleotide sequences of the gene encoding the adenine sulfonyl transferase are shown in SEQ ID NO. 7; the nucleotide sequences of the gene encoding the adenosine phosphate sulfate kinase are shown in SEQ ID NO. 5; and the nucleotide sequences of the gene encoding the polyphosphokinase 2 are shown in SEQ ID NO.
6. The host cells of the engineered bacteria are Escherichia coli or Bacillus subtilis; When the host of the engineered bacteria is Escherichia coli, it also includes bacteria in the genome. cysH Three copies of the gene encoding adenine sulfonyltransferase, as shown in SEQ ID NO.7, were inserted at the gene locus. rph The pseudogene site inserts three copies of the gene encoding adenine thiotransferase as shown in SEQ ID NO. 7; when the host of the engineered bacteria is Bacillus subtilis, it also includes [the gene] in the genome. cysH The gene locus is inserted with six copies of the gene encoding adenine thiotransferase, as shown in SEQ ID NO.
7.
8. The application of the engineered bacteria according to claim 7 in the fermentation production of 3'-adenosine-5'-phosphate sulfuric acid, characterized in that, The application uses ribose and adenine as substrates to synthesize 3'-adenosine-5'-phosphate sulfate using the engineered bacteria.
9. Use according to claim 8, characterized in that, Specifically, the engineered bacteria are fermented in a culture medium supplemented with ribose and adenine.
10. Use according to claim 9, characterized in that, The culture medium is LB medium or TB medium.
11. Use according to claim 9, characterized in that, This also includes adding ribose and adenine during the fermentation process.
12. Use according to claim 9, characterized in that, The fermentation is a shake-flask fermentation, with fermentation conditions including an inoculum size of 2-5% and an initial OD value of [missing information]. 600 The concentration is 0.8~1.0, the fermentation temperature is 30~38℃, the rotation speed is 220 rpm, and the fermentation cycle is 30~36 h.
13. Use according to claim 9, characterized in that, The fermentation is carried out in a fermenter, with fermentation conditions of 5-15% inoculum, 20-60% liquid volume, and initial OD of fermentation. 600 The optimal concentration is 0.8~1.0, fermentation temperature is 30~38℃, rotation speed is 300~700 rpm, pH is controlled at 6.5~7.5, aeration rate is 1~2 vvm, and fermentation cycle is 30~36 h.