Corn transcription factor ZmCCHH4 and application thereof

Abstract

The present application relates to corn transcription factor ZmCCHH4 and application thereof, and the nucleotide sequence of the corn transcription factor ZmCCHH4 is shown as SEQ ID NO. 1. By constructing a gene editing knockout mutant corn material of the transcription factor ZmCCHH4, compared with the wild type, the protein content in the mutant corn kernel is increased, and the transcription factor ZmCCHH4 knockout mutation also causes the expression of 22kDa alpha-zein to be increased, thereby providing genetic resources for creating high-quality corn.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the maize transcription factor ZmCCHH4 and its applications. Background Technology

[0002] Maize (Zea mays) is one of the world's highest-yielding grass crops, serving not only as a food source but also as an important source of livestock feed and extensively used in industrial production. Therefore, maize plays a vital role in driving social progress. With the continuous improvement of people's living standards, the public's demands for food quality are also increasing, making the improvement of maize quality an important research topic. The main components of maize kernels include starch, protein, and oil, among which protein directly determines the nutritional value of maize. Therefore, the content and quality of maize protein are crucial traits that cannot be ignored in research.

[0003] Zein is a major storage protein in maize kernels, belonging to the category of water-insoluble, alcohol-soluble proteins. It plays a crucial role in the protein composition of maize, accounting for over 60% of the total protein, especially abundant in the endosperm. The main function of zein is as a storage protein, providing amino acids and other nutrients for plant growth and development. Zein is essential for maize seed development and germ growth. Zein in maize kernels is encoded by four gene families: α-zein (19kDa, 22kDa), β-zein (14kDa), γ-zein (16kDa, 27kDa), and δ-zein (10kDa, 15kDa). Zein is stored in the endosperm of maize kernels by forming protein bodies. Among all types of zein, α-zein (19kDa, 22kDa) accounts for approximately 70% of all zein and is primarily responsible for protein body filling. Previous studies have identified several transcription factors involved in the activation of 22kDa α-zein transcription, including Opaque2 and OHPs (Chaobin Li et al., Genome-Wide Characterization of cis-Acting DNA Targets Reveals the Transcriptional Regulatory Framework of Opaque2 in Maize, The Plant Cell. 2015), but there are no reports on transcription factors involved in the repression of 22kDa α-zein transcription.

[0004] Given the extremely high expression level of 22kDa α-zein in the endosperm and its important role in protein body formation and even the accumulation of storage proteins, finding other transcription factors involved in the transcriptional regulation of 22kDa α-zein will help increase the accumulation of prolactin and improve the protein content of maize kernels. Summary of the Invention

[0005] The purpose of this invention is to provide the maize transcription factor ZmCCHH4 and its application in increasing the total protein content of maize kernels, especially increasing the expression level of 22kDa α-zein, a storage protein in maize kernels.

[0006] This study found that after the ZmCCHH4 transcription factor was knocked out, the expression level of 22kDa α-zein in the mutant maize kernels increased.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] One of the technical solutions of the present invention is to provide the application of maize transcription factor ZmCCHH4 in improving the total protein content of maize kernels, wherein the nucleotide sequence of the gene encoding maize transcription factor ZmCCHH4 is shown in SEQ ID NO.1.

[0009] In some specific embodiments, the application of increasing the total protein content of corn kernels includes increasing the expression level of 22kDa α-zein, a storage protein in corn kernels.

[0010] The second technical solution of the present invention is to provide an application of a gene expression cassette that targets and knocks out the maize transcription factor ZmCCHH4 in improving the total protein content of maize kernels, wherein the nucleotide sequence of the gene encoding the maize transcription factor ZmCCHH4 is shown in SEQ ID NO.1.

[0011] In some specific embodiments, the gene expression cassette includes guide RNA, promoter, and terminator for the mutant target of maize transcription factor ZmCCHH4 as described in one of the above technical solutions.

[0012] More preferably, the promoter is the corn U6 promoter.

[0013] In some specific embodiments, the guide RNA of the maize transcription factor ZmCCHH4 mutant target is selected from any one or more of the RNAs shown in SEQ ID NO. 2 to 5.

[0014] The third technical solution of the present invention is to provide an application of a recombinant expression vector in increasing the total protein content of maize kernels, wherein the recombinant expression vector includes the gene expression cassette as described in the second technical solution above.

[0015] In some specific embodiments, the recombinant expression vector is a CRISPR-Cas9 vector.

[0016] The fourth technical solution of the present invention is to provide an application of recombinant host cells in increasing the total protein content of maize kernels, wherein the recombinant host cells include the recombinant expression vector as described in the third technical solution above.

[0017] In some specific embodiments, the recombinant host cell is strain EHA105.

[0018] The fifth technical solution of the present invention is to provide a method for increasing the total protein content of corn kernels, including knocking out the corn transcription factor ZmCCHH4 as described in one of the above technical solutions, wherein the nucleotide sequence of the gene encoding the corn transcription factor ZmCCHH4 is shown in SEQ ID NO.1.

[0019] In some specific embodiments, the method for knocking out the maize transcription factor ZmCCHH4 includes the following steps:

[0020] A knockout vector targeting the gene encoding the maize transcription factor ZmCCHH4 was constructed, and the knockout vector was transformed into Agrobacterium and then infected with maize.

[0021] The sixth technical solution of the present invention is to provide a breeding method for transgenic maize with high protein content, comprising the following methods:

[0022] The transgenic corn with high protein content is obtained by knocking out the corn transcription factor ZmCCHH4 in corn cells, culturing the corn cells, and then using the corn cells to regenerate corn.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention identified the transcription factor ZmCCHH4, which is associated with the regulation of protein content in maize kernels, through genome-wide association analysis (GWAS). By constructing a gene-edited knockout mutant of transcription factor ZmCCHH4 in maize, protein extraction and quantification experiments demonstrated that the protein content in maize kernels was increased in the ZmCCHH4 knockout mutant material. DAP-seq and EMSA experiments showed that transcription factor ZmCCHH4 can directly bind to the 22kDa α-zein gene promoter. Quantitative PCR experiments on the 22kDa α-zein gene confirmed that the ZmCCHH4 knockout mutation leads to increased expression of 22kDa α-zein, providing genetic resources for creating high-quality maize. Attached Figure Description

[0025] Figure 1The transcription factor ZmCCHH4 (Zm00001d035701), which is associated with the regulation of protein content in maize kernels, was identified by genome-wide association analysis (GWAS).

[0026] Figure 2 The genome-level editing of ZmCCHH4 in two positive events obtained from the CRISPR-Cas9 gene editing genetic transformation experiment for ZmCCHH4.

[0027] Figure 3 Results of ZmCCHH4 protein detection in CRISPR-Cas9 gene-edited mutant materials containing ZmCCHH4.

[0028] Figure 4 To demonstrate, through protein extraction and quantification experiments, that the protein content of maize kernels is increased in mutant materials of ZmCCHH4.

[0029] Figure 5 A is an EMSA experiment that confirmed that ZmCCHH4 can directly bind to the 22kDa α-zein gene promoter; Figure 5 B demonstrated through quantitative PCR experiments on the 22kDa α-zein gene that the ZmCCHH4 mutation leads to increased expression of 22kDa α-zein. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are implemented based on the technical solution of the present invention, providing detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0031] In the following embodiments, unless otherwise specified, the raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.

[0032] Example 1: Obtaining the transcription factor ZmCCHH4, which regulates the content of prolysins.

[0033] Through long-term genetic breeding and production practices, a large number of maize varietal resources have been accumulated, containing abundant natural genetic variations. Zein, encoded by multiple genes, exhibits significant differences among different maize varieties and directly affects the protein content and nutritional quality of maize. To fully explore and utilize the excellent natural variations related to protein content existing in the natural genetic population of maize, we conducted quantitative determination of zein in 388 maize varietals and genome-wide association analysis (GWAS). The genotype data of the 388 varietals were obtained from Professor Jianbin Yan's research group at Huazhong Agricultural University (Hui Li et al., Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels. Nature Genetics. 2012). A well-established high-performance liquid chromatography (HPLC) method (Chaobin Li et al., The ZmbZIP22 Transcription Factor Regulates 27-kDγ-Zein Gene Transcription during Maize Endosperm Development, The plant cell. 2018) was applied to 388 materials for quantitative analysis of gliadin to collect gliadin content data (Jin Ying, Study on gliadin in maize populations with natural genetic background, Master's thesis, Shanghai University, 2016). The total gliadin content data of each maize variety material were then subjected to boxplot, cluster analysis, and GWAS analysis.

[0034] In the GWAS analysis, 582 single nucleotide polymorphisms (SNPs) significantly associated with prolactin content were identified using a -log10 (P-value) greater than 5. Haplotype analysis was performed within a 20K range flanking the most significant SNP. One of the maize high-protein phenotype sites, Total zein4 (Tz4), was located at 41,698,858 bases on chromosome 6. A gene (Zm00001d035701) was located 1576 bases away from this significant SNP site. Figure 1 The gene encodes a maize zinc finger transcription factor (CCHH4). The gene sequence showed a significantly superior haplotype in the GWAS population. Therefore, this gene is a candidate gene that affects the content of maize gliadin and is named ZmCCHH4. Its nucleotide sequence is shown in SEQ ID NO.1.

[0035] ZmCCHH4 (SEQ ID NO.1):

[0036]

[0037] Example 2: Construction of a CRISPR-Cas9 gene editing vector for ZmCCHH4 and its application in genetic transformation.

[0038] A previously constructed CRISPR-Cas9 vector suitable for maize (Weiwei Qi et al., High-efficiency CRISPR / Cas9 multiplex gene editing using the glycine tRNA-processing system-based strategy in maize. BMC Biotechnology, 2016) was selected as the vector for Agrobacterium-mediated transformation of maize immature embryos. The vector was digested with Pst I, and the synthesized guide RNA sequence containing four ZmCCHH4 mutant targets, along with the maize U6 promoter and U6 terminator, was inserted into the vector.

[0039] The guide RNA sequences of the four ZmCCHH4 mutant targets were named guide RNA1, guide RNA2, guide RNA3, and guide RNA4, and their nucleotide sequences are shown in SEQ ID NO.2–5:

[0040] guide RNA1 (SEQ ID NO.2): GCACTCGCACTCACAGCCGC;

[0041] guide RNA2 (SEQ ID NO.3): GGATGGGTACAGAAACTCCA;

[0042] guide RNA3 (SEQ ID NO.4): CCCCAAGCCTGAACCCACCA;

[0043] guide RNA4 (SEQ ID NO. 5): TATGCAACGAGCCCAACTGT.

[0044] Furthermore, the EHA105 strain was transformed by electroporation. Immature embryos of the B104 maize line, 8-12 days after pollination and approximately 1.5 mm in size, were selected as recipient material for embryo transformation. The specific procedure is as follows:

[0045] (1) Infect with Agrobacterium for 10 min and co-culture at 20℃ for 3 days.

[0046] (2) Recovery culture at 28℃ for 7 days, and screening culture (dipromycin 1.5mg / L) at 28℃ for 14 days.

[0047] (3) Screening culture (3 mg / L of dipropionylphosphide) 28℃ for 14 days, 3-5 rounds.

[0048] (4) Obtain resistant callus - dark regeneration culture at 28℃ for 14-21 days.

[0049] (5) Positive seedlings were obtained by photoregeneration culture at 28℃ for 14-21 days.

[0050] (6) Transfer to a pot, pollinate and obtain offspring.

[0051] Results: 1000 immature embryos were selected as recipient material. After transformation and screening, 10 transgenic positive events were obtained. Each event was identified. The genome of each event plant was extracted using the TPS method. PCR primers spanning four targets were designed based on the genomic location of the mutation target in the guide RNA sequence. After amplification, the target fragment was cloned using TA. Positive clones were selected for sequencing, yielding events #1 and #2 with a ZmCCHH4 frameshift mutation. These were propagated and preserved to obtain homozygous mutants for further analysis. Figure 2 The figure shows the genome-level situation of events #1 and #2 with ZmCCHH4 frameshift mutations.

[0052] Example 3: Detection of ZmCCHH4 protein expression in transgenic frameshift mutant materials of ZmCCHH4

[0053] (1) Total protein was extracted from the seeds of the ZmCCHH4 mutant material with frameshift mutation and the wild-type material, respectively. The seeds were ground to powder grade using liquid nitrogen. The ground seed endosperm powder was placed into EP tubes, IP lysis buffer was added, and the mixture was lysed on ice for 20 min.

[0054] (2) Centrifuge and collect the supernatant. Take 4 μL of protein from each of the two samples, add 1 μL of 5×SDS protein loading buffer mixed with 1M DTT, denature at 99℃ for 10 minutes, and immediately place the protein samples on ice.

[0055] (3) SDS-PAGE electrophoresis: the stacking gel is 5%, and after electrophoresis at 80V for half an hour, the separating gel is 12.5%, and the electrophoresis time is about 2 hours.

[0056] (4) Transfer membrane at 200mA for 1 hour. Block at room temperature for 1 hour with 5% milk prepared with TBST.

[0057] (5) Dilute ZmCCHH4 antibody and Actin antibody (Sigma) at a ratio of 1 / 1000 in 5% milk. Hybridize at room temperature for 1 hour.

[0058] (6) Wash the membrane with TBST 6 times, 5 minutes each time.

[0059] (7) Hybridize with the corresponding secondary antibody at room temperature for 1 hour.

[0060] (8) Wash the membrane with TBST 6 times, 5 minutes each time.

[0061] (9) Add the chromogenic substrate and observe the phenomenon using a TANON chemiluminescence imaging system.

[0062] The results showed that the internal control protein Actin was present in both materials, while the ZmCCHH4 protein was only present in the wild-type genotype material. Figure 3 This indicates that the gene-edited transgenic frameshift mutant is a ZmCCHH4 deletion mutant.

[0063] Example 4: Determination and Analysis of Seed Protein Content in ZmCCHH4 Gene-Edited Mutants

[0064] (1) Weigh the seeds and grind them with liquid nitrogen to powder level.

[0065] (2) Take the ground seed endosperm powder, put it into an EP tube, and put it into a freeze dryer to freeze dry.

[0066] (3) Take 50 mg of freeze-dried endosperm powder and put it into an EP tube. Add 1 mL of petroleum ether, vortex mix, and incubate at room temperature on a shaker for 1 hour.

[0067] (4) Centrifuge at 12,000 rpm for 15 minutes and discard the supernatant.

[0068] (5) Add 1 mL of petroleum ether, vortex to mix, centrifuge at 12,000 rpm for 15 minutes, and discard the supernatant.

[0069] (6) The precipitate was placed in a freeze dryer and frozen dry.

[0070] (7) Add 1 mL of sodium borate buffer and 20 μL of mercaptoethanol. Vortex to mix, then incubate overnight (12 hours) in a 37°C shaker.

[0071] (8) Centrifuge at 12,000 rpm for 15 minutes, and transfer approximately 900 μL of the supernatant to a new tube. The supernatant is the total protein.

[0072] (9) Place 300 μL of total protein solution into a freeze dryer, freeze dry, add 200 μL of IPG solution, mix well and dissolve, and then test.

[0073] (10) Preparation of standard for standard curve: Dissolve protein standard completely with IPG solution, take 10 μL and dilute to 100 μL to make the final concentration 0.5 mg / mL; add standard to the standard wells of 96-well plate in the order of 0, 1, 2, 4, 8, 12, 16, 20 μL, add IPG solution to make up to 20 mL, and wait for detection.

[0074] (12) Add 20 μL of the sample prepared above into the sample well of the 96-well plate.

[0075] (13) Add 200 μL of G250 staining solution to each well and let stand at room temperature for 3-5 minutes.

[0076] (14) Measure the absorbance of A595 using an enzyme-linked immunosorbent assay (ELISA) reader.

[0077] (15) Calculate the protein concentration (mg / mg) in the sample based on the standard curve.

[0078] Results: The protein content in the seeds of both ZmCCHH4 gene-edited mutants was significantly higher than that in the wild-type seeds isolated from the same bar. Figure 4 The protein content of transgenic event #1 increased by 13.76% relative to the wild type, and that of transgenic event #2 increased by 14.37% relative to the wild type. Specific values ​​are shown in Table 1.

[0079] Table 1

[0080]

[0081] Example 5: Verification of the binding of ZmCCHH4 to the promoter of the 22kDa α-zein protein-encoding gene.

[0082] The ZmCCHH4 encoding gene was incorporated into the pGEX-4T-1 vector and expressed in prokaryotes to produce the ZmCCHH4-GST fusion protein. The purified fusion protein was then used for DAP-seq experiments. The DAP-seq experiments were used to analyze which gene promoter sequences the ZmCCHH4 transcription factor directly binds to.

[0083] Experimental results show that ZmCCHH4, a CCHH4 transcription factor with four C2H2 ZINC FINGER domains, has a major binding sequence of GGTANAA (where N is any one of A, T, C, or G), consistent with the binding sequence characteristics of CCHH4 transcription factors. Analysis of the target sequence for ZmCCHH4 revealed a promoter sequence for a 22 kDa α-zein protein-coding gene (Zm00001d048810).

[0084] Further EMSA experiments were conducted to verify that the ZmCCHH4 transcription factor can directly bind to the promoter of the 22kDa α-zein protein encoding gene (Zm00001d048810). The specific procedure is as follows:

[0085] (1) Design a suitable 22kDa α-zein protein-encoding gene promoter probe (SEQ ID NO.6), which was synthesized and labeled with biotin by Invitrogen;

[0086] 22kDa α-zein protein encoding gene promoter probe (SEQ ID NO.6):

[0087] GCGGTTTTGGTAGGTGAAACGTTGTTAGGTGAATGCGGATGTTGGCTGT TGTTGCACGTG;

[0088] (2) According to the instructions of LightShift Chemiluminescent EMSA Kit, add 20ng protein, 3ng probe, 2μL 10×Binding Buffer, 1μL 50% glycerol, 1μL 100mM MgCl2, 1μL Poly dI-dC, and 1μL 1% NP-40 to a 20μL system.

[0089] (3) Incubate at room temperature for 20 min, then add loading buffer. Stop 6% acrylamide gel electrophoresis when bromophenol blue reaches 2 / 3 of the gel height;

[0090] (4) Transfer 380mA onto the nylon membrane for UV crosslinking;

[0091] (5) Perform hybridization and development according to the instructions of the LightShift Chemiluminescent EMSA Kit.

[0092] Results: The ZmCCHH4 transcription factor induced a blocking band on the promoter probe of the 22kDa α-zein protein-encoding gene. Figure 5 A (in the figure, the competitor is a cold probe without biotin labeling) verifies that the ZmCCHH4 transcription factor can directly bind to the promoter of the 22kDa α-zein protein encoding gene.

[0093] Example 6: Detection of 22kDa α-zein transcription level in ZmCCHH4 mutant seeds

[0094] (1) Take 8-10 immature seeds.

[0095] (2) Total RNA was extracted from the frameshift mutant ZmCCHH4 material and the wild-type material using the TIANGEN plant polysaccharide and polyphenol total RNA extraction kit.

[0096] (3) Reverse transcription of RNA was performed using the TOYOBO reverse transcription kit.

[0097] (4) Using ubiquitin gene as internal reference, the transcription of 22kDa α-zein gene was detected by SYBR Green probe relative quantification method.

[0098] The results showed that, compared with the expression level in the wild type, the expression level of the 22kDa α-zein gene was increased in the ZmCCHH4 mutant. Figure 5 B).

[0099] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. The application of maize transcription factor ZmCCHH4 in increasing the total protein content of maize kernels, characterized in that, The nucleotide sequence of the gene encoding the maize transcription factor ZmCCHH4 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The application of increasing the total protein content of corn kernels includes increasing the expression level of 22kDa α-zein, a storage protein in corn kernels.

3. The application of a gene expression cassette that targets and knocks out the maize transcription factor ZmCCHH4 in improving the total protein content of maize kernels, wherein the nucleotide sequence of the gene encoding the maize transcription factor ZmCCHH4 is shown in SEQ ID NO.1; The gene expression cassette includes the guide RNA, promoter, and terminator of the maize transcription factor ZmCCHH4 mutant target. The guide RNA of the maize transcription factor ZmCCHH4 mutant target is composed of guide RNA1, guide RNA2, guide RNA3, and guide RNA4. The nucleotide sequence of the guide RNA1 is shown in SEQ ID NO.2; The nucleotide sequence of the guide RNA2 is shown in SEQ ID NO.3; The nucleotide sequence of the guide RNA3 is shown in SEQ ID NO.4; The nucleotide sequence of the guide RNA4 is shown in SEQ ID NO.

5.

4. The application of a recombinant expression vector in increasing the total protein content of maize kernels, wherein the recombinant expression vector comprises the gene expression cassette described in claim 3.

5. The application of a recombinant host cell in increasing the total protein content of maize kernels, wherein the recombinant host cell comprises a recombinant expression vector, and the recombinant expression vector comprises the gene expression cassette as described in claim 3.

6. A method for increasing the total protein content of corn kernels, characterized in that, This includes targeted knockout of maize transcription factor ZmCCHH4, the nucleotide sequence of which is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that, The method for knocking out the maize transcription factor ZmCCHH4 includes the following steps: A knockout vector targeting the gene encoding the maize transcription factor ZmCCHH4 was constructed, and the knockout vector was transformed into Agrobacterium and then infected with maize.

8. A breeding method for transgenic maize with high protein content, characterized in that, Including the following methods: By knocking out the maize transcription factor ZmCCHH4 in maize cells, culturing these maize cells, and then using these cells to regenerate maize, high-protein transgenic maize is obtained. The nucleotide sequence of the gene encoding the maize transcription factor ZmCCHH4 is shown in SEQ ID NO.1.

Images