Plant genetic transformation method based on haploid inducer lines
By using plant genetic transformation methods based on haploid inducible lines, gene transformation and editing were achieved in wheat haploid embryos through Agrobacterium-mediated transformation. This solved the problem of low efficiency in traditional methods, enabling efficient and stable gene transfer and editing, and shortening the breeding cycle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-08-27
- Publication Date
- 2026-05-26
AI Technical Summary
Existing technologies make it difficult to quickly and efficiently achieve haploid gene transformation and gene editing in wheat. Traditional methods are inefficient, highly dependent on genotype, and difficult to apply on a large scale, and have failed to successfully transform haploid embryos.
Plant genetic transformation using haploid inducible lines was employed. Haploid embryos with visual markers were obtained through hybridization. The target gene or gene editing vector was introduced using Agrobacterium-mediated transformation. Callus regeneration was induced by combining screening agent culture medium, and chromosome doubling was performed to obtain homozygous plants. Transgenic plants were identified by PCR, histochemical staining, and phenotypic observation.
This study achieved efficient gene transfer and editing of wheat haploid embryos, resulting in stable transgenic and gene-edited homozygous plants, shortening the breeding cycle, and ensuring genetic stability and the absence of additional mutations.
Smart Images
Figure CN120738280B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a plant genetic transformation method based on haploid inducible lines. Background Technology
[0002] Wheat is one of the world's most important food crops, providing food for nearly one-third of the global population. Improving its yield and quality through genetic engineering is of great strategic significance for ensuring global food security and promoting sustainable agricultural development. Transgenic technology has become a powerful tool for functional gene analysis and trait improvement. When combined with traditional breeding methods, it provides a promising strategy for wheat variety development. A key challenge in wheat transgenic and gene-editing research is the need for rapid generation of homozygous individuals for phenotypic validation. Due to the existence of three subgenomes (A, B, and D) with a large number of functionally redundant homologous genes, multiple generations of self-pollination are required to stabilize transgenic and gene-edited traits (Zhang et al., 2016; Howells et al., 2018). Chromosomal doubling after haploid induction provides a rapid pathway to generating homozygous lines, which is crucial for fixing target traits and constructing genetic populations (Fu et al., 2022).
[0003] Traditional methods for inducing wheat haploidy, including anther culture, microspore culture, and chromosome elimination using maize pollen, are limited by low efficiency, strong genotype dependence, and technical complexity, making them difficult to scale up for breeding practice. Although previous attempts to directly transform haploid tissues (such as anthers or callus) using Agrobacterium or gene gun methods have failed to yield transgenic haploid wheat (Brisibe et al., 2000; Amoah et al., 2001). To date, no studies have reported successful transformation of haploid embryos in any plant species. This leaves a critical technological gap in wheat functional genomics research, thus urgently requiring the development of a rapid and stable genetic method for achieving transgenic and gene-edited wheat through the transformation of haploid embryos. Summary of the Invention
[0004] The purpose of this invention is to provide a plant genetic transformation method based on haploid inducible lines.
[0005] A plant genetic transformation method based on haploid inducible lines is carried out according to the following steps:
[0006] 1) Haploid induction and identification: Using wheat haploid induction lines carrying visual marker genes and haploid induction genes as male parents, hybridization with wheat varieties is carried out to obtain F1 generation grains. Haploids and diploids are distinguished by the color of the embryo part of the F1 generation grains.
[0007] 2) Transformation of haploid embryos: Haploid embryos 15-18 days after hybridization are collected and transformed into the target gene or gene editing vector using Agrobacterium-mediated transformation.
[0008] 3) Regeneration and identification of transgenic plants: Callus tissue was induced and regenerated on a culture medium containing screening agents. T0 generation transgenic positive plants were identified by PCR, histochemical staining and phenotypic observation.
[0009] 4) Chromosome doubling: T0 generation haploid transgenic plants were treated with colchicine or propionamide to obtain homozygous double haploid plants, and ploidy was verified by flow cytometry and chromosome counting.
[0010] Step 1) The visualized marker gene is a purple embryo gene marker, including ZmC1 and ZmR Gene. ZmC1 and ZmR Gene markers indicate the color of the embryo portion of the grain.
[0011] Step 1) The haploid-inducing gene is... MTL Homologous genes PLD3 Gene or DMP Gene.
[0012] Step 1) The wheat haploid induction line is HIPE, a haploid induction line with purple embryos; the wheat variety is Fielder.
[0013] Step 1) The haploid is white, and the diploid is purple.
[0014] Step 2) The target gene is GUS and / or Ruby .
[0015] Step 2) The gene editing vector is a targeted gene editing vector. TaWaxy The CRISPR / Cas9 system for genes.
[0016] Step 3) The histochemical staining is GUS dyeing.
[0017] Step 3) The phenotypic observation is Ruby Red marker.
[0018] The plants mentioned are wheat, corn, rice, barley, millet, tomato, or Arabidopsis thaliana.
[0019] The beneficial effects of this invention are: wheat haploid embryos readily undergo gene transfer via Agrobacterium-mediated transformation, enabling efficient delivery of transgenic and gene-editing vectors. In the T1 generation, double haploid (DH) transgenic and gene-edited plants were analyzed by phenotypic evaluation, histochemical staining, PCR, PCR / RE, and sequencing. No abnormalities were observed. Ruby or GUS The segregation phenomenon of genetically modified organisms, all TaWaxy All mutations were stably inherited without any additional mutations, confirming the genetic stability and heritability of the T0 generation editing. Therefore, this invention can be used to conduct Agrobacterium-mediated transformation experiments using wheat haploid embryos as explants, thereby achieving rapid and stable inheritance of transgenic and gene-edited wheat, significantly shortening the breeding cycle. Attached Figure Description
[0020] Figure 1 The results show the identification of F1 generation embryos from crosses between HIPE and other wheat varieties; Ha is haploid and Di is diploid.
[0021] Figure 2 Linearized carrier diagram; (a): pWMB110-Ruby (b): pWMB110-GUS (c): pWMB110- SpCas9-TaWaxy ; Ubi : ubiquitin promoter; NLS: nuclear localization signal. Nos Nos is the terminator; TaU3 :wheat U3 promoter; 35S Cauliflower mosaic virus 35S promoter; bar : Glufosinate resistance gene.
[0022] Figure 3 Flow cytometry analysis of callus ploidy; Ha is haploid; Di is diploid.
[0023] Figure 4 The results show the chromosome identification of transgenic haploid, double haploid, and diploid control plants; Ha is haploid; Di is diploid.
[0024] Figure 5 In T0 generation transgenic plants bar PCR identification results of the gene; M: DL2000 DNA marker; 1: positive control; 2: wild-type Fielder (negative control); 3-10: T0 generation haploid transgenic plants.
[0025] Figure 6 For T0 generation haploid and double haploid plants GUSGene PCR detection results; M: DL5000 DNA marker; 1, positive control (containing pWMB110-GUS 1) Plasmid of expression vector); 2) Negative control: wild-type Fielder plants; 3-10, T0 generation plants.
[0026] Figure 7 For T0 generation haploid and double haploid plants Ruby Gene PCR detection results; M: DL5000 DNA marker; 1, positive control (containing pWMB110-Ruby 1. Plasmid of expression vector); 2. Negative control: wild-type Fielder plants; 3-10: T0 generation plants.
[0027] Figure 8 For histochemical staining identification results; in T0 generation plants GUS The expression status was compared with that of the control group.
[0028] Figure 9 for Ruby Phenotypic comparison of the gene in T0 generation plants and control group; bar = 10 cm.
[0029] Figure 10 T1 generation transgenic plants GUS and Ruby PCR identification of genes; (a) GUS Genetic testing; (b) Ruby Genetic testing; M: DL5000 DNA marker; 1: GUS and Ruby From each containing GUS and Ruby 1: Amplification in the plasmid of the expression vector (positive control); 2: Wild-type Fielder (negative control); 3-10: T1 generation double haploids GUS or Ruby Genetically modified plants.
[0030] Figure 11 In T0 generation transgenic plants Cas9 PCR identification results of the gene; M: DL2000 DNA marker; 1: positive control; 2: wild-type Fielder (negative control); 3-10: T0 generation haploid transgenic plants.
[0031] Figure 12 For T0 generation transgenic plants TaWaxy PCR / RC detection results of the gene; M: DL2000 DNA marker; a and b: T0 generation transgenic plants TaWaxy-7A and TaWaxy-7DGene PCR / RC detection results: 1. PCR amplification products from control plants without enzyme digestion; 2. PCR amplification products from control plants after restriction endonuclease digestion. Bgl PCR amplification products digested with restriction enzyme II; 3-10, digested with restriction endonuclease Bgl PCR amplification products of T0 generation plants digested with enzyme II.
[0032] Figure 13 for TaWaxy - gW830 Representative mutation types at the site; red text indicates PAM regions; blue text indicates... sgRNA "-" indicates a missing base; the rightmost number indicates the number of missing bases.
[0033] Figure 14 In T0 generation transgenic wheat plants TaWaxy The results of Sanger sequencing peak diagram identification of gene mutations.
[0034] Figure 15 For T0 generation TaWaxy I2-KI staining comparison of mature seeds of gene-edited mutants and wild-type Fielder (left).
[0035] Figure 16 In T1 generation transgenic plants TaWaxy PCR / RC detection results for gene editing; (a) TaWaxy-7A Genes; (b) TaWaxy-7D Gene; M: DL2000 DNA marker; 1, PCR amplification product of control plants without restriction enzyme digestion; 2, PCR amplification product of control plants after restriction endonuclease digestion. Bgl PCR amplification products digested with restriction enzyme II; 3-10, digested with restriction endonuclease Bgl PCR amplification products of T1 generation plants digested with enzyme II. Detailed Implementation
[0036] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0037] The wheat variety used in the following examples is Fieder, which can be obtained from the National Crop Germplasm Bank of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. The haploid inducible line with purple embryos (HIPE) is a bidirectional promoter specifically expressed by the embryo and aleurone layer in our previous laboratory experiments. pBD68 (Provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences) Driving the anthocyanin gene in maize ZmR Genes and ZmC1Gene expression, the obtained purple-embryo plants and the obtained wheat mtl-ABD Homozygous mutants were hybridized, and the F2 and F3 generations were compared. 2-3 The identification was carried out on behalf of the agent to obtain the contents. ZmR Genes and ZmC1 Genetic mtl-ABD Homozygous individuals were used as the male parent to obtain F1 hybrid grains. Haploid grains were quickly identified by the color of the embryo region (Tang et al., 2023. A fast technique for visual screening of wheat haploids generated from TaMTL-edited mutants carrying anthocyanin markers, Plant Communications, 3.).
[0038] The plasmids and strains mentioned in the experimental examples are from the following sources: The plant gene editing vector pWMB110-Cas9-TaWaxy is described in the following literature: Liu et al. 2020 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium -mediated CRISPR system. Journal of Experimental Botany, 71:1337-1349. Plant expression vector. pWMB110-Ruby and pWMB110-GUS This is documented in the following literature: Shi K, Huang WH, Zhu MX, Teng SZ, Zhang JL, DuanZZ, Zhu CC, Hu T, Wang K, Wang Z. Efficient genetic transformation and genomeediting via an Agrobacterium ‐mediated in commercial oat( Avena sativa L.) cultivars. Journal of Integrative Plant Biology, 2025, 67(7): 1697-1699. Example 1
[0039] (I) Haploid Induction and Identification
[0040] During the wheat flowering stage, markers carrying purple embryos ( ZmC1 and ZmR The wheat haploid inducible line (HIPE) with a genetic predisposition is used as the male parent and crossed with a wheat variety (such as Fielder) to obtain the hybrid F1 generation. After hybridization, haploids (white) and diploids (purple) can be distinguished by the color of the embryo part of the grain.
[0041] (II) Genetic transformation of haploid embryos
[0042] Young F1 hybrid seeds, 15-18 days post-hybridization, were sterilized with 75% alcohol for 1 min, followed by sterilization with 15% sodium hypochlorite for 8 min, and washed three times with sterile water. The embryos were then removed in a laminar flow hood, and haploid (white) embryos were selected based on the color of the embryo portion. Figure 1 ), will contain Figure 2 medium-sized vector plasmids ( pWMB110-Ruby and pWMB110-GUS Agrobacterium (a vector) infects and transforms wheat haploid embryos.
[0043] The specific steps are as follows:
[0044] 1) Before infection, the above-mentioned... pWMB110-Ruby and pWMB110-GUS Agrobacterium vector added to Kana 50mg L -1 In YEP liquid medium, it was cultured overnight with shaking at 200 rpm and 28°C in the dark.
[0045] 2) Collect Agrobacterium cells by centrifugation at 3,500 rpm for 10 min at room temperature, discard the supernatant, and resuspend at 1 mL of cells / mL MS resuspending solution [(1 / 10 MS basal medium (Beijing Ximeijie Technology Co., Ltd., catalog number: M519, glucose 10 g / L)]. -1 [ ], resuspend the bacterial precipitate, and obtain separately pWMB110-Ruby and pWMB110-GUS Agrobacterium GV3101 resuspension of the vector.
[0046] 3) Select F1 embryos from hybrids 15-18 days after cross-fertilization, and use... pWMB110-Ruby and pWMB110-GUS The vector was infected with Agrobacterium GV3101 resuspension, and then spread evenly on AS basic co-medium (1 / 2 MS basic medium, 10 g / L glucose). -1 8 g / L agar -1 Cultured at 25℃ for 3 days.
[0047] 4) After co-culture, the immature embryos were transferred to recovery medium WLS-RES (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1Cb (carbenicillin) 400 mg / L -1 Cef (cephalosporin) 100 mg / L -1 Cultivate in the dark for 5 days.
[0048] 5) After recovery culture, the immature embryos were transferred to the first selection medium WLS-P5 (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 PPT (glufosinate) 15 mg / L -1 Cb 400 mg L -1 Cef 100 mg L -1 Cultivate in the dark for 14 days.
[0049] 6) Then transfer the callus to the first screening medium WLS-P10 (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 PPT 10 mg L -1 Cb 400 mg L -1 Cultivate in darkness for 21 days.
[0050] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basal medium, PPT 5 mg / L). -1 ), and cultured under light for 2 weeks.
[0051] 8) Isolate the wheat shoots and place them on MSF-P5 rooting medium (MS medium, PPT 5 mg / L). -1 IBA 0.5mg / L -1 ), and cultured for 21 days.
[0052] Once the seedlings have developed roots, transplant them into the soil and obtain... pWMB110-Ruby and pWMB110-GUS The transgenic plants (from which the transgenic plants were respectively generated) pWMB110-Ruby Agrobacterium GV3101 infection resuspension and pWMB110-GUS / Originated from Agrobacterium GV3101 infection resuspension).
[0053] (III) Regeneration and Identification of Transgenic Plants
[0054] Callus tissue was induced and plantlets regenerated on a culture medium containing a screening agent. The ploidy of the transformed callus tissue and regenerated plantlets was identified. The ploidy of the callus tissue was analyzed by flow cytometry using Jindi Future Biotechnology (Beijing) Co., Ltd. Figure 3 The chromosome number of transgenic plants before doubling was identified using the droplet method. Figure 4 The specific operation steps are as follows:
[0055] (1) When the transgenic seedlings grow to about 10 cm tall, select candidate seedlings from the culture tank, cut off 1 cm long root tips, and place them in a 0.5 mL centrifuge tube that has been moistened with a spray bottle and has a small hole drilled at the top. Place the tube on ice. After taking the root tips, put the transgenic seedlings back into the original culture tank; then put the centrifuge tube containing the root tip sample into a nitrous oxide canister, introduce gas for about 3 minutes, close the gas inlet valve, and after 2 hours of treatment, remove the centrifuge tube from the nitrous oxide canister and place it on ice.
[0056] (2) Fix the root tip with 90% acetic acid for 5 min, then rinse with water 3 times; put it in 70% ethanol and store it in a -20℃ refrigerator for later use.
[0057] (3) Use tweezers to remove the root tip, place it on filter paper to absorb the moisture, cut off the milky white part of the root tip on a glass slide, put it into the prepared enzymatic hydrolysis solution, and incubate at 37°C for 50 minutes.
[0058] (4) After enzymatic hydrolysis of the root tip, wash twice with a small amount of 70% alcohol, add 60 μL of alcohol, crush the root tip with a dissecting needle and dissolve it in the alcohol in the tube. Centrifuge at 6000 rpm for 2 min, discard the supernatant, and invert at room temperature for a few minutes;
[0059] (7) Add 30 μL of 100% acetic acid to the centrifuge tube and gently vortex it on a vortex mixer to mix it thoroughly.
[0060] (8) Prepare a cardboard box in advance, moisten it with water, put a glass slide in the box, and use a pipette to draw 7 μL of the suspension in step 6 and drop it onto the glass slide;
[0061] (9) Chromosome samples were stained with 4',6-diamidinyl-2-phenylindole (DAPI) and then observed under a BX61 fluorescence microscope (Olympus, Tokyo, Japan). Figure 4 ).
[0062] After verification, before doubling, Figure 3 , 4 In this study, haploids have a peak at FLC=50 and 21 chromosomes, while diploids have a peak at FLC=100 and 42 chromosomes.
[0063] (iv) Doubling treatment of haploid transgenic seedlings
[0064] Before transplanting the transgenic plants, 10 mM colchicine was added to the surface of the culture medium to double the chromosomes. After 32 h of chromosome doubling treatment, the seedlings were removed from the culture medium, rinsed with running water for 3 min, and then transplanted into flower pots for cultivation in a culture room.
[0065] (V) Identification of T0 generation transgenic positive plants
[0066] (1) Extraction of genomic DNA from wheat T0 generation transgenic plants
[0067] The extraction procedure for genomic DNA from wheat T0 generation transgenic plants was performed according to the instructions in the plant DNA extraction kit (CW0531M NuClean Plant Genomic DNA Kit) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd.
[0068] (2) Detection of T0 generation overexpression vector transgenic plants
[0069] use bar (Depend on bar-F and bar-R composition), GUS (Depend on GUS-F and GUS-R (Composition) and Ruby (Depend on Ruby-F and Ruby-R Gene-specific primers were used to detect the obtained T0 generation transgenic plants and screen for transgenic positive plants. Primers were synthesized by Shanghai Sangong Company; 2×Es Taq MasterMix (Dye) (CW0690L) used for PCR was purchased from CWBIO Reagent Company. Primer sequences are as follows:
[0070] bar-F : ACCATCGTCAACCACTACATCG (SEQ ID NO: 1);
[0071] bar-R :GCTGCCAGAAACCCACGTCATG (SEQ ID NO: 2);
[0072] GUS-F :CGAAAGCAAGCTGACCGACA (SEQ ID NO: 3);
[0073] GUS-R :GTACGGATAGTGTGCGGTCC (SEQ ID NO: 4);
[0074] Ruby-F :TTTAGCCCTGCCTTTCATACGCT (SEQ ID NO: 5);
[0075] Ruby-R :CGAGCCTTCTTCTAATGCCAGAT (SEQ ID NO: 6).
[0076] The specific PCR amplification conditions are as follows:
[0077] bar Gene: 95 ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30 s, (2) annealing: 60ºC / 20 s, (3) extension: 72ºC / 20 s, for a total of 28 cycles; finally extend at 72ºC for 5 min.
[0078] GUS Gene: 95 ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30 s, (2) annealing: 60ºC / 20 s, (3) extension: 72ºC / 1 min, for a total of 35 cycles; finally extend at 72ºC for 5 min.
[0079] Ruby Gene: 95 ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30 s, (2) annealing: 60ºC / 20 s, (3) extension: 72ºC / 1 min, for a total of 35 cycles; finally extend at 72ºC for 5 min.
[0080] PCR products were analyzed using a 1% agarose gel electrophoresis gel, and the results are as follows: Figure 5 , 6 As shown in Figure 7. From Figure 5 It can be seen that all T0 generation transgenic plants were positive; Figure 6 This indicates that lanes 3, 6, and 8-10 are turns. GUS Gene-positive plants; Figure 7 This indicates that lanes 4, 6, and 7 are turns. Ruby Gene-positive plants.
[0081] (3) Phenotypic identification of T0 generation overexpression vector transgenic plants
[0082] Converse pWMB110-GUS Histochemical staining was performed on leaves of gene-positive plants. Fresh leaves were immersed in 2 mL centrifuge tubes containing GUS staining solution (Biorigin (Beijing) Inc.) and incubated overnight at 37°C. The leaves were then washed three times with anhydrous ethanol. The staining results were observed and photographed. Figure 8 ).from Figure 8 It can be seen that the transfer GUSThe leaves of the gene-positive plants are distinctly blue, while the leaves of the wild-type control Fielder cannot be stained blue.
[0083] change pWMB110-Ruby The leaves, stems, and spikelets of gene-positive plants show a distinct red color. Figure 9 ).
[0084] (vi) Identification of T1 generation transgenic plants
[0085] In the T1 generation, double haploid transgenic plants were analyzed using phenotypic evaluation, histochemical staining, and PCR. No abnormalities were observed. Ruby or GUS gene segregation ( Figure 10 This indicates that the obtained transgenic plant is homozygous. Example 2
[0086] (I) Haploid Induction and Identification
[0087] During the wheat flowering stage, markers carrying purple embryos ( ZmC1 and ZmR The wheat haploid inducible line (HIPE) with a genetic predisposition is used as the male parent and crossed with a wheat variety (such as Fielder) to obtain the hybrid F1 generation. After hybridization, haploids (white) and diploids (purple) can be distinguished by the color of the embryo part of the grain.
[0088] (II) Genetic transformation of haploid embryos
[0089] Young F1 hybrid seeds, 15-18 days post-hybridization, were sterilized with 75% alcohol for 1 min, followed by sterilization with 15% sodium hypochlorite for 8 min, and washed three times with sterile water. The embryos were then removed in a laminar flow hood, and haploid (white) embryos were selected based on the color of the embryo portion. Figure 1 ), will contain Figure 2 medium-sized vector plasmids ( pWMB110-SpCas9-TaWaxy Agrobacterium (a vector) infects and transforms wheat haploid embryos.
[0090] The specific steps are as follows:
[0091] 1) Before infection, the above-mentioned... pWMB110-SpCas9-TaWaxy Agrobacterium vector added to Kana 50 mg / L -1 In YEP liquid medium, it was cultured overnight with shaking at 200 rpm and 28°C in the dark.
[0092] 2) Collect Agrobacterium cells by centrifugation at 3,500 rpm for 10 min at room temperature, discard the supernatant, and resuspend at 1 mL of cells / mL MS resuspending solution [(1 / 10 MS basal medium (Beijing Ximeijie Technology Co., Ltd., catalog number: M519, glucose 10 g / L)].-1 [ ], resuspend the bacterial precipitate to obtain pWMB110-SpCas9-TaWaxy Agrobacterium GV3101 resuspension.
[0093] 3) Select F1 generation embryos 15-18 days after cross-fertilization, and utilize... pWMB110-SpCas9-TaWaxy Infect the bacteria with Agrobacterium GV3101 resuspension, then spread them evenly on AS basic co-medium (1 / 2 MS basic medium, 10 g / L glucose). -1 8 g / L agar -1 Cultured at 25℃ for 3 days.
[0094] 4) After co-culture, the immature embryos were transferred to recovery medium WLS-RES (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 Cb (carbenicillin) 400 mg / L -1 Cef (cephalosporin) 100 mg / L -1 Cultivate in the dark for 5 days.
[0095] 5) After recovery culture, the immature embryos were transferred to the first selection medium WLS-P5 (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 PPT (glufosinate) 15 mg / L -1 Cb 400 mg L -1 Cef 100 mg L -1 Cultivate in the dark for 14 days.
[0096] 6) Then transfer the callus to the first screening medium WLS-P10 (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 PPT 10 mg L -1 Cb 400 mg L -1 Cultivate in darkness for 21 days.
[0097] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basal medium, PPT 5 mg / L). -1 ), and cultured under light for 2 weeks.
[0098] 8) Isolate the wheat shoots and place them on MSF-P5 rooting medium (MS medium, PPT 5 mg / L). -1 IBA 0.5mg / L -1 ), cultured for 21 days.
[0099] Once the seedlings have developed roots, transplant them into the soil and obtain... pWMB110-SpCas9-TaWaxy Transgenic plants (from) pWMB110-SpCas9-TaWaxy (Originated from Agrobacterium GV3101 infection resuspension).
[0100] (III) Regeneration and Identification of Transgenic Plants
[0101] Callus tissue was induced and plantlets regenerated on a culture medium containing a screening agent. The ploidy of the transformed callus tissue and regenerated plantlets was identified. The ploidy of the callus tissue was analyzed by flow cytometry using Jindi Future Biotechnology (Beijing) Co., Ltd. Figure 3 The chromosome number of transgenic plants before doubling was identified using the droplet method. Figure 4 The specific operation steps are as follows:
[0102] (1) When the transgenic seedlings grow to about 10 cm tall, select candidate seedlings from the culture tank, cut off 1 cm long root tips, and place them in a 0.5 mL centrifuge tube that has been moistened with a spray bottle and has a small hole drilled at the top. Place the tube on ice. After taking the root tips, put the transgenic seedlings back into the original culture tank; then put the centrifuge tube containing the root tip sample into a nitrous oxide canister, introduce gas for about 3 minutes, close the gas inlet valve, and after 2 hours of treatment, remove the centrifuge tube from the nitrous oxide canister and place it on ice.
[0103] (2) Fix the root tip with 90% acetic acid for 5 min, then rinse with water 3 times; put it in 70% ethanol and store it in a -20℃ refrigerator for later use.
[0104] (3) Use tweezers to remove the root tip, place it on filter paper to absorb the moisture, cut off the milky white part of the root tip on a glass slide, put it into the prepared enzymatic hydrolysis solution, and incubate at 37°C for 50 minutes.
[0105] (4) After enzymatic hydrolysis of the root tip, wash twice with a small amount of 70% alcohol, add 60 μL of alcohol, crush the root tip with a dissecting needle and dissolve it in the alcohol in the tube. Centrifuge at 6000 rpm for 2 min, discard the supernatant, and invert at room temperature for a few minutes;
[0106] (7) Add 30 μL of 100% acetic acid to the centrifuge tube and gently vortex it on a vortex mixer to mix it thoroughly.
[0107] (8) Prepare a cardboard box in advance, moisten it with water, put a glass slide in the box, and use a pipette to draw 7 μL of the suspension in step 6 and drop it onto the glass slide;
[0108] (9) Chromosome samples were stained with 4',6-diamidinyl-2-phenylindole (DAPI) and then observed under a BX61 fluorescence microscope (Olympus, Tokyo, Japan). Figure 4 ).
[0109] After verification, before doubling, Figure 3 , 4 In this study, haploids have a peak at FLC=50 and 21 chromosomes, while diploids have a peak at FLC=100 and 42 chromosomes.
[0110] (iv) Doubling treatment of haploid transgenic seedlings
[0111] Before transplanting the transgenic plants, 10 mM colchicine was added to the surface of the culture medium to double the chromosomes. After 32 h of chromosome doubling treatment, the seedlings were removed from the culture medium, rinsed with running water for 3 min, and then transplanted into flower pots for cultivation in a culture room.
[0112] (V) Identification of T0 generation transgenic plants
[0113] (1) Extraction of genomic DNA from wheat T0 generation gene-edited plants
[0114] The extraction procedure for genomic DNA from wheat T0 generation transgenic plants was performed according to the instructions in the plant DNA extraction kit (CW0531M NuClean Plant Genomic DNA Kit) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd.
[0115] (2) Detection of T0 generation gene-edited vector transgenic plants
[0116] use Cas9 (Depend on Cas9-F and Cas9-R Gene-specific primers were used to detect the obtained T0 generation transgenic plants and screen for transgenic positive plants. Primers were synthesized by Shanghai Sangong Company; 2×Es TaqMasterMix (Dye) (CW0690L) used for PCR was purchased from CWBIO Reagent Company. Primer sequences are as follows:
[0117] Cas9-F :ACCTGAACGCGGTGGTCGGCA (SEQ ID NO: 7);
[0118] Cas9-R :GTCGCCCCCGAGCTGAGACAGG (SEQ ID NO: 8).
[0119] Cas9Gene: 95 ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30 s, (2) annealing: 55ºC / 20 s, (3) extension: 72ºC / 1 min, for a total of 35 cycles; finally extend at 72ºC for 5 min.
[0120] PCR products were analyzed using a 1% agarose gel electrophoresis gel, and the results are as follows: Figure 11 As shown. From Figure 11 It can be seen that lanes 3, 4, 5, 7, 8, and 10 are turns. Cas9 Gene-positive plants.
[0121] Then use TaWaxy-7A and TaWaxy-7D Specific primers for the above-mentioned conversion Cas9 Gene-positive plants were subjected to PCR / RC detection to identify the plant editing type. Primers were synthesized by Sangong Pharmaceutical Co., Ltd. (Shanghai); the 2×Es TaqMasterMix (Dye) (CW0690L) used for PCR was purchased from CWBIO Reagent Co., Ltd. The primer sequences are as follows:
[0122] TaWaxy-7A-F :GCAAAGCAGGAAACCGCACCGATT (SEQ ID NO: 9);
[0123] TaWaxy-7A-R : AGTTGTTCTTGATCTTACCGTAGG (SEQ ID NO: 10);
[0124] TaWaxy-7D-F :GTGCCTCTCCATGGTGGTGCCGG (SEQ ID NO: 11);
[0125] TaWaxy-7D-R :TGGTGATCATCCAGCTCTCTC (SEQ ID NO: 12).
[0126] TaWaxy-7A Gene: 95ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30s, (2) annealing: 54ºC / 20s, (3) extension: 72ºC / 1 min, for a total of 35 cycles; finally extend at 72ºC for 5 min.
[0127] TaWaxy-7D Gene: 95ºC pre-denaturation for 5 min; then perform the following 3 reaction programs: (1) denaturation: 95ºC / 30s, (2) annealing: 64ºC / 20s, (3) extension: 72ºC / 1 min, for a total of 35 cycles; finally extend at 72ºC for 5 min.
[0128] Then use Bgl The PCR product was digested with restriction endonuclease II and incubated overnight at 37°C.
[0129] The enzyme digestion products were analyzed using a 1% agarose gel electrophoresis gel, and the results are as follows: Figure 12 As shown. From Figure 12 As can be seen from a, lanes 3, 5, 6, and 8 are turns. TaWaxy-7A homozygous edited plants; from Figure 12 As can be seen from b, lanes 3, 5, 6, and 8 are turns. TaWaxy-7B Homozygous edited plants. Sanger sequencing was then used to further analyze the PCR products of the homozygous edited plants. Figure 13 , 14 Sequencing results showed that all the obtained gene-edited plants were homozygous edited, mainly due to the deletion of 1-20 bp upstream of the PAM region at the sgRNA target site.
[0130] (3) Phenotypic identification of T0 generation gene-edited plants
[0131] because TaWaxy Genes control the synthesis of amylopectin, and amylopectin turns blue when it comes into contact with potassium iodide. Therefore, for TaWaxy Potassium iodide (I2-KI) staining was performed on the cross-section of mature seeds of the mutant to identify changes in amylopectin content. From... Figure 15 As can be seen, compared with the bluish-black color observed in the wild-type control, the mutant grains are reddish-brown, indicating that their starch properties have changed.
[0132] (vi) Identification of T1 generation gene-edited plants
[0133] In the T1 generation, double haploid gene-edited plants were analyzed using phenotypic evaluation methods such as PCR / RE. All TaWaxy The mutations were all stably inherited, confirming that the T0 generation transgenic plants were all homozygous and genetically stable. Figure 16 ).
[0134] These results indicate that haploid wheat embryos are highly suited to Agrobacterium-mediated genetic transformation, which can effectively deliver transgenes and genome editing vectors, and directly obtain transgenes and gene-edited homozygotes, significantly shortening the time required for biobreeding.
[0135] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A method for genetic transformation of wheat based on haploid immature embryos, characterized in that, Follow these steps: 1) Haploid Induction and Identification: A wheat haploid induction line carrying a visual marker gene and a haploid induction gene was used as the male parent and crossed with a wheat variety to obtain F1 generation grains. Haploids and diploids were distinguished by the color of the embryo portion of the F1 grains. The visual marker gene was a purple embryo gene marker, including... ZmC1 and ZmR Gene; the haploid-inducing gene is MTL Homologous genes PLD3 Gene or DMP Genes; the wheat haploid induction line is the HIPE haploid induction line with purple embryos; the wheat variety is Fielder; the haploid is white, and the diploid is purple; 2) Transformation of haploid embryos: Haploid embryos 15-18 days after hybridization were collected and transformed into the target gene or gene editing vector using Agrobacterium-mediated transformation; the target gene is... GUS and / or Ruby ; The gene editing vector is a targeted gene editing vector. TaWaxy The CRISPR / Cas9 system for genes; 3) Regeneration and identification of transgenic plants: Callus tissue was induced and regenerated on a culture medium containing screening agents. T0 generation transgenic positive plants were identified by PCR, histochemical staining and phenotypic observation. 4) Chromosome doubling: T0 generation haploid transgenic plants were treated with colchicine or propionamide to obtain homozygous double haploid plants, and ploidy was verified by flow cytometry and chromosome counting.
2. The wheat genetic transformation method based on haploid embryos according to claim 1, characterized in that, Step 3) The histochemical staining is GUS dyeing.
3. The wheat genetic transformation method based on haploid embryos according to claim 1, characterized in that, Step 3) The phenotypic observation is Ruby Red marker.