A carp herpesvirus type 3 ORF138 gene-inactivated strain, its preparation method and application
By constructing a carp herpesvirus type 3 ORF138 gene inactivated strain and knocking out the ORF138 gene using homologous recombination technology, a recombinant genetic engineering vaccine was prepared. This solved the problems of unclear attenuation mechanism and low immune protection rate of existing vaccines, and achieved efficient, safe and large-scale immune protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
- Filing Date
- 2025-06-13
- Publication Date
- 2026-07-31
AI Technical Summary
Existing carp herpesvirus type 3 vaccines have problems such as unclear attenuation mechanism, uncertain residual toxicity, low immune protection rate, high cost, and unsuitability for large-scale vaccination. In addition, there is a lack of research on using the ORF138 gene deletion strain as a gene deletion attenuated live vaccine.
A carp herpesvirus type 3 ORF138 gene inactivated strain was constructed. The ORF138 gene was knocked out using homologous recombination technology. Combined with screening marker genes, a recombinant genetically engineered vaccine, including a fluorescent protein gene and an antibiotic resistance gene, was prepared for the preparation of a carp herpesvirus type 3 vaccine.
It significantly reduced fish morbidity and mortality, improved immunization efficacy, demonstrated good immunogenicity and immune protection rate, was suitable for large-scale inoculation, and reduced the risk of virulence reversion.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of disease prevention and control in aquaculture, specifically relating to a carp herpesvirus type 3 ORF138 gene inactivated strain, its preparation method, and its application. Background Technology
[0002] Cyprinid herpesvirus 3 (CyHV-3), also known as Koiherpesvirus (KHV), is the pathogen that causes Koi herpesvirus disease (KHVD) in carp, koi, and their variants. CyHV-3 is highly contagious, has a rapid onset, and an extremely high mortality rate. Therefore, KHVD is listed as a reportable disease by the World Organisation for Animal Health (WOAH) and is included in the disease surveillance list of the National Aquatic Animal Monitoring Quarterly Report (NACA QAAD).
[0003] According to the database of the Food and Agriculture Organization of the United Nations (FAO), carp is the world's third largest freshwater farmed fish and an important part of the food supply in many Asian countries.
[0004] Although attenuated CyHV-3 vaccines and modified live vaccines have shown significant protective effects in fish studies, the attenuation mechanisms of existing attenuated vaccines are unclear, residual toxicity is uncertain, and there is a risk of virulence reversion. Inactivated vaccines prepared using inactivated carp herpesvirus type 3 as the antigen have low immunoprotection rates. While DNA vaccines and subunit vaccines have advantages such as high immunoprotection rates and high stability, they are generally only suitable for individual injection immunization and not for large-scale vaccination, and their high preparation costs greatly limit their practical application in aquaculture. Recombinant attenuated live vaccines, which selectively delete viral genes to reduce viral virulence without inducing disease, can induce an immune response in the host without the risk of virulence reversion, making them the best way to protect carp or koi from CyHV-3 infection.
[0005] Because viral membrane proteins interact directly with host proteins, such as binding to host cell receptors or fusing with host proteins during viral infection and assembly, elucidating the function of viral membrane proteins is crucial for vaccine research. While some literature suggests that the CyHV-3 ORF138 protein encodes a glycosylated type 1 essential membrane protein, no studies have reported using the KHVORF138 gene-deleted strain as a gene-deleted attenuated live vaccine. Summary of the Invention
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides a carp herpesvirus type 3 ORF138 gene-inactivated strain, wherein the carp herpesvirus type 3 ORF138 gene-inactivated strain is an attenuated virus strain obtained by deleting the ORF138 gene from carp herpesvirus type 3.
[0008] In some embodiments of the present invention, the term "inactivation" includes, but is not limited to: the ORF138 gene being completely or partially knocked out, the ORF138 gene not being expressed, or the ORF138 gene being mutated so that the expressed protein does not have normal function.
[0009] In some embodiments of the present invention, the sequence of the ORF138 gene is shown in SEQ ID NO: 5.
[0010] In some embodiments of the present invention, the carp herpesvirus type 3 ORF138 gene inactivated strain may carry a selection marker.
[0011] In some embodiments of the present invention, the screening marker includes at least one of a reporter gene and a selection marker gene.
[0012] In some embodiments of the present invention, the reporter gene includes at least one of a fluorescent protein gene, a luciferase gene, and a β-galactosidase.
[0013] In some embodiments of the present invention, the selection marker gene includes an antibiotic resistance gene.
[0014] In some embodiments of the present invention, the antibiotic resistance gene includes at least one of penicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene, and puromycin resistance gene.
[0015] In some embodiments of the present invention, the inactivated strain of cyprinid herpesvirus type 3 ORF138 was deposited on May 28, 2025, at the China Center for Type Culture Collection (Wuhan University, Wuhan, China), named cyprinid herpesvirus type 3 gene deletion strain KHV-T△ORF138 Cyprinid herpesvirus 3, with accession number CCTCC NO: V202540.
[0016] A second aspect of the present invention provides a method for constructing a carp herpesvirus type 3 ORF138 gene-inactivated strain according to the first aspect of the present invention, comprising the following steps:
[0017] Carp herpesvirus type 3 was isolated and identified, and the ORF138 gene was inactivated.
[0018] In some embodiments of the present invention, the inactivation method includes at least one of point mutation, homologous recombination, CRISPR / Cas9 system, transcription activation-like effector nuclease technology, and zinc finger nuclease technology.
[0019] In some embodiments of the present invention, the inactivation method is homologous recombination.
[0020] In some embodiments of the present invention, the homologous recombination method includes the following steps:
[0021] Upstream and downstream primers were designed targeting the ORF138 gene and its left and right arms to amplify the ORF138 gene.
[0022] The ORF138 gene and its left and right arms were ligated into a homologous recombination vector.
[0023] Based on the design of homologous recombination vectors, upstream and downstream primers for the deletion of the ORF138 gene fragment were used to amplify the homologous recombination vector that deletes the ORF138 gene.
[0024] Homologous recombination was performed by co-transfecting a homologous recombination vector lacking the ORF138 gene with genomic DNA of carp herpesvirus type 3.
[0025] In some embodiments of the present invention, the homologous recombination vector may have a selection marker, which includes at least one of a reporter gene and a selection marker gene.
[0026] In some embodiments of the present invention, the reporter gene includes at least one of a fluorescent protein gene, a luciferase gene, and a β-galactosidase.
[0027] In some embodiments of the present invention, the fluorescent protein gene includes at least one of green fluorescent protein, red fluorescent protein, and yellow fluorescent protein.
[0028] In some embodiments of the present invention, the selection marker gene includes an antibiotic resistance gene.
[0029] In some embodiments of the present invention, the antibiotic resistance gene includes at least one of penicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene, and puromycin resistance gene.
[0030] A third aspect of the present invention provides a carp herpesvirus type 3 vaccine, wherein the carp herpesvirus type 3 vaccine comprises the carp herpesvirus type 3 ORF138 gene inactivated strain described in the first aspect of the present invention.
[0031] In some embodiments of the present invention, the carp herpesvirus type 3 vaccine includes pharmaceutically acceptable excipients.
[0032] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of the following: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculators, filter aids, release inhibitors, and carriers.
[0033] The pharmaceutically acceptable excipients mentioned above are generally recognized for use in this purpose and as inactive ingredients in the pharmaceutical preparation. Compilations of pharmaceutically acceptable excipients can be found in reference books such as the *Handbook of Pharmaceutical Excipients* (2nd edition, edited by A. Wade and P.J. Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical 6Gess, London, 1994) and the *Pharmacopoeia of the People's Republic of China - List of Pharmaceutical Excipients*.
[0034] In some embodiments of the present invention, the dosage form of the carp herpesvirus type 3 vaccine includes one of the following: injectable vaccine, oral vaccine, and immersion vaccine.
[0035] A fourth aspect of the present invention provides the use of the carp herpesvirus type 3 ORF138 gene inactivated strain described in the first aspect of the present invention, and / or the carp herpesvirus type 3 vaccine described in the third aspect of the present invention in the preparation of products.
[0036] In some embodiments of the present invention, the product includes reagents and / or drugs for diagnosing, preventing, and treating carp herpesvirus.
[0037] In some embodiments of the present invention, the carp herpesvirus is carp herpesvirus type 3.
[0038] The beneficial effects of this invention are:
[0039] This invention constructs a carp herpesvirus type 3 ORF138 gene deletion strain, and after purification, an immunogenic recombinant engineered vaccine is obtained.
[0040] The recombinant genetically engineered vaccine constructed in this invention knocks out the ORF138 gene, resulting in weaker virulence and significantly reducing the incidence and mortality of immunized fish, thus achieving a better immunization effect.
[0041] The recombinant genetically engineered vaccine provided by this invention is a live attenuated vaccine with good immunogenicity, which can induce a better immune response in fish and achieve an immunizing effect. Furthermore, the recombinant genetically engineered vaccine can induce immunized fish to produce specific antibodies effectively and for a long period. Secondly, compared with other types of vaccines, the recombinant genetically engineered vaccine has the advantage of a high immunization rate, achieving better immunization effects in practical applications.
[0042] The recombinant genetic engineering vaccine preparation method provided by this invention is simple: Based on the wild-type koi herpesvirus strain, using the GFP (green fluorescent protein) gene as a selection marker, a recombinant transfer vector containing the ORF138 gene recombinant arm is constructed using genetic engineering technology. The recombinant transfer vector and the wild-type virus are then homologously recombinated in a common carp brain cell line (CCB) using transfection technology. The ORF138 gene in the wild-type virus is knocked out, first obtaining a KHV-T△ORF138 GFP virus suspension. The KHV-T△ORF138 GFP virus strain is directly picked from CCB cells after inoculation. After approximately four generations, purified KHV-T△ORF138 GFP virus is obtained. The DNA of the purified KHV-T△ORF138 GFP virus strain is extracted and transfected to obtain purified KHV-T△ORF138 without the GFP label. Finally, the ORF138-deleted virus strain is expanded using cell culture technology to produce the recombinant genetic engineering vaccine. Attached Figure Description
[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:
[0044] Figure 1 Results of CCB cell infection with the KHV-TΔO138GFP virus strain CTL221.
[0045] Figure 2 Results of CCB cell infection with KHV-TΔO138 virus strain CTF231 virus strain.
[0046] Figure 3 To determine the purity of KHV-TΔO138 and KHV-TΔO138GFP viral strains by PCR, the lanes from left to right are: Lane 1: Marker, Lane 2: Negative control, Lane 3: KHV-TΔO138, Lane 4: KHV-TΔO138GFP.
[0047] Figure 4 The results of live koi challenge experiments in different experimental groups.
[0048] Figure 5 The results of the protection rate experiment after immune re-challenge. Detailed Implementation
[0049] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0050] Example 1: Construction of ORF138 gene deletion plasmid for koi herpesvirus
[0051] 1. Amplification of the ORF138 gene and left and right arm fragments of carp herpesvirus type 3.
[0052] Design upstream and downstream primers for amplifying the ORF138 gene and its left and right arms using Geneious Primer:
[0053] KTO138R-HFF:
[0054] 5'-CGACTCTAGAGGATCCCCAGATGTTCTTGACCTCC-3' (SEQ ID NO: 1);
[0055] KTO138R-HFR:
[0056] 5'-GAATTCGAGCTCGGTACCCAGTGAACGAGCTGATGATG-3' (SEQ ID NO: 2);
[0057] Table 1. ORF138 PCR amplification system
[0058] water 12.5μL 2X Xtreme Buffer 25μL 2mM dNTPs 10μL 100 μmol / L KTO138R-HFF 0.25μL 100 μmol / L KTO138R-HFF 0.25μL DNA template 1μL KOD Xtreme Hot Start DNA Polymerase 1μL
[0059] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 54℃ for 30 s, extension temperature 68℃ for 4 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 66℃ for 30 s, extension temperature 68℃ for 4 min, 30 cycles; and a final extension at 68℃ for 5 min.
[0060] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h. After mixing, electrophoresis was performed to identify the PCR product, which was approximately 4289 bp. After confirming the correct size by comparison with the marker, the product was excised and purified. The purified PCR product was then added to 9 μL of 1× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h to verify the size and purity of the purified PCR product. The correct KTO138R-HFF / HFR PCR purified product was then stored at -20 °C.
[0061] 2. Constructing the pUC-KTO138R plasmid using thermal fusion technology.
[0062] The pUC19 vector was digested into a linear fragment using SmaI, and the purified KTO138R-HFF / HFR PCR product was ligated into the pUC19 vector using a mixture of heat fusion enzymes to construct the pUC-KTO138R plasmid.
[0063] Table 2 5× Pre-assembled Mixture
[0064]
[0065]
[0066] Table 3 2× Heat Fusion Enzyme Mixture
[0067]
[0068] Table 4 Thermal Fusion System
[0069] pUC19 digestion product 0.5μL KTO138R-HFF / HFR PCR purification product 1μL water 8.5μL 2× heat fusion enzyme mixture 10μL
[0070] 3. Amplify the DNA fragment deleting gene 138.
[0071] Designing upstream and downstream primers using Geneious Primer:
[0072] KTDO138G-HFF:
[0073] 5'-TGTATCTTAAGGGGGATCGACGCCGATGTTCAATTAC-3' (SEQ ID NO: 3);
[0074] KTDO138G-HFR:
[0075] 5'-GTCGACCTCGACGGGATCGTTGATGGTTGGTTGGTTG-3' (SEQ ID NO: 4); amplify the gene fragment in pUC-KTO138R plasmid that lacks ORF138.
[0076] Table 5. ORF138 PCR Amplification System
[0077]
[0078]
[0079] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 55℃ for 30 s, extension temperature 68℃ for 6 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 65℃ for 30 s, extension temperature 68℃ for 6 min, 30 cycles; and a final extension at 68℃ for 6 min.
[0080] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h. After mixing, electrophoresis was performed to identify the PCR product, which was approximately 5913 bp. After confirming the correct size by comparison with the marker, the product was excised and purified. The purified PCR product was then added to 9 μL of 1× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h to verify the size and purity of the purified PCR product. The correct KTDO138G-HFF / HFR PCR purified product was stored at -20 °C.
[0081] The sequence of the ORF138 gene is as follows:
[0082] ATGAACATCCTGATACTATTACCACTATTGACCTTGTGCGTCTTGTGTGAGGCGAGG
[0083] CGACACAAGTGCTTGAGTCCCGACCACATCAAGAACATCACGTTCTACATAAACCATGC
[0084] CAGGATGGAAAACTATACATGGCCGGCGTCGGTCTGCTCCTGCGACATTGACGATGAAG
[0085] ACTGTCGATGCAACCTACCGAGCCGGTACGATTTTCCGTGGATACCCGTCACATGGATAT
[0086] TTCACGGCGTATGCACAGAACAGAATAACACTAGGGACTACGGCTGGTTCTTTGAGATG
[0087] CAGGCGCTAGCCGCTGAGATACAACCGAGGATAACAGTAGGTGTCGACTGGTCGTGCG
[0088] ACTACCACATGCCCACCACGGTCGAACACGTCGACTTGATAGCCGATTACTTTATCAAAA
[0089] AGTATAGCGACTCCCTTCACCACTCTGAATGCTGGGGCATAACCTACGGGAGCATAGTGT
[0090] GCAACGTGCTGTCGCGGAGGACCGGACCTCACTACGACCCCACCATATTCCGTCTGGTT
[0091] GCTTTGGACGCCGTCGATTACGATGGACTACACCGACGGCTCGCCCCCAATTACTGGTAC
[0092] AAGGACTCTATGGACGCGTACTACACGGTCGCGTTCAACACAGGACCCGTCAGCGACA
[0093] CCATCAAGGAGATGGACCTCGTGGTCATGGCGGATTCGCCGCACAATAATGTCAGCGCC
[0094] AAGGACATTTGGTTGAGGATGCTCGACAGCTCACAACCCGTCATGTGCTTGAACTACAC
[0095] AGGAGGAATATTCACCAAACGTCACGCGCTGAAATGGTTCAACTACAACGTAGACATGT
[0096] TGCACGGGTACGGGTACACCAACGTGTCCAACAACGGCACGCCGGTAGACTGTGTGTA
[0097] CCATATACCCGTTCCAACCACCATCAGACCGACGACCACGCCGCGACGGACGCCCAAGC
[0098] CAACCAGGCCGTTCGACCTCGACACGGAGTTTATGCAGAACTGGATAGGAGGCTTCGTC
[0099] ATCCTCATGTCGTTCGTCTTCTTTCTGTTTGTCGTGGTGCTGCTGTGCCCCGAACGCAAG
[0100] ACGCCGATGTTCAATTACACCCACAACACCAGGCCGGTCCCCTACATCTACAGGCGACA
[0101] GGTCGCCGCCGAGGCCGCAGCAGCAGCGCCGGCAGCGCCGGACCCACCTCAGGTCTGA
[0102] (SEQ ID NO: 5).
[0103] 4. Construct a GFP-label-free ORF138 deletion plasmid
[0104] The ends of the KTDO138G-HFF / HFR PCR purified product were padded with the ORF138 gene deleted by self-ligation of the PCR product using T4 ligase.
[0105] Table 6. End-completion system for KTDO138G-HFF / HFR PCR purification products
[0106]
[0107] Table 7: Connection System
[0108]
[0109] The ligation reaction conditions were: 37℃ for 15 min, 20℃ for 1 h, and ligation overnight at 15℃. The cells were transformed into competent E. coli cells, plated, and grown overnight at 37℃. Positive clones were selected and sequenced.
[0110] 5. Construct a GFP-labeled ORF138 deletion plasmid
[0111] The linear pBl-GFP vector was obtained by digestion with BamHI. The KTDO138G-HFF / HFR PCR purified product was ligated into the pBl-GFP vector using a hot fusion enzyme mixture to obtain pUC-KTΔO138GFP.
[0112] Table 8: Thermal Fusion System
[0113]
[0114]
[0115] The heat fusion program was as follows: incubation at 50°C for 1 hour, followed by a decrease to 20°C at a rate of 0.1°C per second, incubation at 20°C for 30 minutes, and storage at 10°C. The cells were then transformed into competent E. coli cells, plated, and grown overnight at 37°C. Positive clones were selected and sequenced.
[0116] Example 2 Construction of fluorescent recombinant virus
[0117] 1. Intracellular homologous recombination yields fluorescently deleted strains.
[0118] pUC-KTΔO138GFP plasmid was co-transfected with genomic DNA of carp herpesvirus type 3 into common carp brain cells (CCB) using Promega's FuGENE assay. TM HD Transfection Reagent transfection reagent, transfection system as follows:
[0119] Add 1 μg pUC-KTΔO138GFP plasmid and 2 μg KHV-T DNA to 100 μl of OptiMEM medium, vortex and briefly centrifuge, slowly add 8 μl of transfection reagent, centrifuge briefly and incubate at room temperature for 20 minutes, then add the transfection reagent mixture to CCB cells, changing the medium within 24 hours. Four days after transfection, pick fluorescent lesion plaques under a microscope and store them in culture medium at -80℃.
[0120] 2. Purification of fluorescent recombinant virus
[0121] The selected fluorescent lesion plaques were serially diluted 10-fold in 24-well plates to a final concentration of 10. -6 Using an inverted fluorescence microscope, multiple monoclonal plaques were picked at low concentrations and stored in culture medium at -80°C. After freezing and thawing, the selected fluorescent plaques were serially diluted 10-fold in 24-well plates. The process of selecting monoclonal plaques was repeated multiple times until no visually detectable CPE was found in the green fluorescent plaques under an inverted fluorescence microscope, thus obtaining the purified KHV-TΔO138GFP virus strain CTL221.
[0122] KHV-TΔO138GFP virus strain CTL221 virus strain infected CCB cells under an inverted fluorescence microscope, as shown in the following figure. Figure 1 As shown.
[0123] Example 3 Construction of non-fluorescent recombinant virus
[0124] 1. Intracellular homologous recombination yields non-fluorescent deletion strains.
[0125] The pUC-KTΔO138 plasmid was co-transfected with the genomic DNA of the KHV-TΔO138GFP (CTL221) viral strain into common carp brain cells (CCB) using Promega's FuGENE assay. TM HD Transfection Reagent transfection reagent, transfection system as follows:
[0126] Add 1 μg of pUC-KTΔO138 plasmid and 2 μg of genomic DNA from the KHV-TΔO138GFP (CTL221) viral strain to 100 μl of OptiMEM medium, vortex and briefly centrifuge, slowly add 8 μl of transfection reagent, centrifuge briefly and incubate at room temperature for 20 minutes, then add the transfection mixture to CCB cells, changing the medium within 24 hours. Four days after transfection, pick non-fluorescent plaques under a microscope and store them in medium at -80°C.
[0127] 2. Purification of non-fluorescent recombinant deletion virus
[0128] The selected non-fluorescent lesion plaques were serially diluted 10-fold in 24-well plates to a final concentration of 10. -6 Using an inverted fluorescence microscope, multiple monoclonal plaques were picked at low concentrations and stored in culture medium at -80°C. Non-fluorescent plaques were then freeze-thawed and serially diluted 10-fold in 24-well plates. Monoclonal plaques were picked and the process was repeated multiple times until no green fluorescence was detected in the non-fluorescent plaques under an inverted fluorescence microscope, thus obtaining the purified KHV-TΔO138 virus strain CTF231.
[0129] KHV-TΔO138 virus strain CTF231 virus strain infected CCB cells under an inverted microscope, as shown in the following figure. Figure 2 As shown.
[0130] 3. PCR and sequencing were used to identify the purity of KHV-TΔO138 virus strain CTF231 and KHV-TΔO138GFP virus strain CTL221.
[0131] Genomic DNA was extracted from KHV-TΔO138 virus strain CTF231 and KHV-TΔO138GFP virus strain CTL221, and PCR amplification was performed using primers for KTO138R-HFF (SEQ ID NO:1) and KTO138R-HFR (SEQ ID NO:2).
[0132] Table 9. ORF138 PCR Amplification System
[0133] water 12.5μL 2X Xtreme Buffer 25μL 2mM dNTPs 10μL 100 μmol / L KTO138R-HFF 0.25μL 100 μmol / L KTO138R-HFF 0.25μL DNA template 1μL KOD Xtreme Hot Start DNA Polymerase 1μL
[0134] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 54℃ for 30 s, extension temperature 68℃ for 4 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 66℃ for 30 s, extension temperature 68℃ for 4 min, 30 cycles; and a final extension at 68℃ for 5 min.
[0135] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer, and electrophoresis was performed at 90V for 1 h. After mixing, electrophoresis was performed to identify the products. The PCR product size of KHV-TΔO138 virus strain CTF231 was 3264 bp, and the PCR product size of KHV-TΔO138 GFP virus strain CTL221 was 4875 bp. Figure 3 As shown, the size was verified to be correct by comparison with the marker and by sequencing, indicating that both KHV-TΔO138(CTF231) and KHV-TΔO138GFP(CTL221) viral strains are purified gene deletion strains.
[0136] The ORF138 deletion strain KHV-TΔO138 (CTF231) without fluorescent label was deposited at the China Center for Type Culture Collection (Wuhan University, Wuhan, China) on May 28, 2025, with the name Cyprinid herpesvirus 3 gene deletion strain KHV-T△ORF138 and accession number CCTCC NO: V202540.
[0137] Example 4: Koi carp live challenge experiment and protection rate experiment after immunization and re-challenge.
[0138] Koi carp with an average body length of 10cm ± 2cm were selected as experimental fish. Live challenge experiments were conducted on koi carp using the KHV-TΔO138 gene-deleted recombinant virus strain CTF231. Three groups were set up: a KHV-TΔO138 gene-deleted recombinant virus experimental group, a wild-type virus group, and an M199 culture medium control group. Each group contained 60 fish, and each group was intraperitoneally injected with 200μL of the KHV-TΔO138 gene-deleted recombinant virus strain CTF231. -5.35 KHV-TΔO138 gene deletion recombinant viral fluid, 120 μL TCID50 10 -5.57 Wild-type virus solution and 200 μL M199 medium were used. After 28 days of culture, the survival rate was recorded daily, and the results are as follows: Figure 3 As shown, the survival rate of the KHV-TΔO138 gene-deleted recombinant virus experimental group after 28 days of culture was 41.67%, while the survival rate of the wild-type strain after 28 days of culture was 6.67%, indicating that the KHV-TΔO138 gene-deleted recombinant virus had significantly lower virulence compared to the wild-type virus.
[0139] Koi surviving from the above recombinant virus experimental group were challenged with a high concentration of the wild-type virus strain, and a control group of 60 koi was set up. The koi were cultured for 28 days, and the protection rate was recorded daily. The results are as follows: Figure 4As shown, the protection rate of the KHV-TΔO138 gene-deleted recombinant virus experimental group was 100%, while all koi in the control group, which had not been immunized with the attenuated vaccine, died 28 days after being challenged with the wild-type strain. This indicates that immunizing koi with the KHV-TΔO138 gene-deleted recombinant virus strain a131 can produce a highly effective immune protection effect.
[0140] In conclusion, the KHV-TΔO138 gene-deleted recombinant virus strain can serve as a candidate strain for an attenuated vaccine to control and prevent carp herpesvirus type 3.
[0141] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A carp herpesvirus type 3 ORF138 gene-inactivated strain, characterized in that: The carp herpesvirus type 3 ORF138 gene-inactivated strain was deposited on May 28, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, and is named carp herpesvirus type 3 gene deletion strain KHV-T△ORF138. Cyprinidherpesvirus 3. The accession number is CCTCC NO: V202540.
2. A carp herpesvirus type 3 vaccine, characterized in that: The carp herpesvirus type 3 vaccine comprises the carp herpesvirus type 3 ORF138 gene inactivated strain as described in claim 1.
3. The carp herpesvirus type 3 vaccine according to claim 2, characterized in that: The carp herpesvirus type 3 vaccine includes pharmaceutically acceptable excipients.
4. The carp herpesvirus type 3 vaccine according to claim 2, characterized in that: The dosage form of the carp herpesvirus type 3 vaccine includes one of the following: injectable vaccine, oral vaccine, or immersion vaccine.
5. The use of the carp herpesvirus type 3 ORF138 gene inactivated strain according to claim 1 and the carp herpesvirus type 3 vaccine according to any one of claims 2 to 4 in the preparation of the product; The product is a reagent and / or drug for the prevention of carp herpesvirus.