Improved p53 with enhanced liquid-liquid phase separation ability and activity

Abstract

This invention discloses a modified p53 protein enhanced by liquid-liquid phase separation, namely LLPSEp53, which inhibits tumor cell proliferation. First, the mechanism by which liquid-liquid phase separation of p53 enhances the function of wild-type p53 tumor suppressor factor is disclosed, and it is found that LLPSEp53 can significantly enhance the function of its downstream target genes (such as...) in cells. CDKN1A , MDM2 , PUMA , NOXA , BAF , DDB2 and RRM2B The transcriptional level of LLPSEp53 was measured; its recombinant protein showed significant killing effects on various human tumor cell lines; furthermore, knockdown of the DEF6 gene further promoted the anti-tumor activity of LLPSEp53, indicating that LLPSEp53 can be used in combination with DEF6 inhibitors to enhance the anti-tumor effect. Simultaneously, the combination of LLPSEp53 protein with the FGFR inhibitor TAS-120 and the Wnt signaling pathway inhibitor IWR-1 showed significantly enhanced tumor-killing effects. This invention demonstrates that liquid-liquid phase separation can enhance p53 transcriptional activity and inhibit tumor cell proliferation, and that its combination with drugs can improve its anti-tumor effect. These findings suggest that LLPSEp53 has strong clinical translational potential, and its synergistic use with drugs provides a new approach for its application in clinical cancer treatment.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a modified p53 with enhanced transcriptional activity and tumor suppression ability, and its application in killing tumor cells. Background Technology

[0002] p53, as an important tumor suppressor, is one of the key molecules in inhibiting tumor development and progression. Under normal circumstances, p53 protein is negatively regulated by MDM2 / MDMX, maintaining a low expression level. However, when cells are subjected to DNA damage, oncogens, or stress, it can inhibit tumor development through multiple pathways. p53 can arrest cell cycle progression through the p21 pathway, thereby promoting DNA damage repair. When damage is severe and cannot be repaired, p53 will activate different target genes to induce apoptosis and cellular senescence, thereby maintaining genomic stability and preventing cancer. Mutations in p53 occur in more than 50% of human cancers, leading to abnormal function. In other cancers, p53 function is suppressed due to overexpression of MDM2 and MDM4 or abnormalities in downstream p53 pathways.

[0003] Gene therapy centered on p53 has become a hot topic in cancer research. Currently, the only clinically approved p53 gene therapy is Gendicine, used to treat squamous cell carcinoma of the head and neck. Gendicine delivers the wild-type p53 gene into cancer cells via a recombinant defective adenovirus, activating tumor suppressor function. Clinical trials have shown that its combination with radiotherapy has significant efficacy and fewer side effects. Other gene therapies, such as ONYX-015, are still in clinical trials, and while SCH-58500 has shown good potential for cancer treatment, neither has yet received widespread approval. In addition, the combination of p53 gene therapy with immune checkpoint inhibitors (PD-1 / PD-L1 antibodies) for the treatment of solid tumors has also entered phase II clinical trials, demonstrating good therapeutic potential.

[0004] In recent years, mRNA-level therapy has also made progress. p53 mRNA nanoparticles can significantly inhibit the growth of non-small cell lung cancer, restoring tumor suppressor function through p53 mRNA delivery. Furthermore, strategies to inhibit the expression of mutant p53 by delivering small interfering RNA (siRNA) targeting it are also under investigation, aiming to reduce the gain-of-function of mutant p53. However, the main challenge currently facing p53 gene therapy is that after wild-type p53 gene is transferred into cells, its function is inhibited by oncogenic factors or mutant p53 in the tumor, preventing it from effectively exerting its therapeutic effect and limiting therapeutic efficacy. Therefore, there is an urgent need to develop novel p53 variants with stronger tumor suppressor effects to improve the effectiveness of gene therapy.

[0005] Therefore, we designed a modified p53 with stronger liquid-liquid phase separation capability and activity, namely LLPSEp53. Compared with wild-type p53, LLPSEp53 has stronger phase separation capability and can significantly improve the tumor-killing ability of p53 at the same protein concentration. Therefore, LLPSEp53 has a higher tumor-killing efficiency and can greatly reduce the cost of protein therapy. In addition, the combination of LLPSEp53 (FUS-LC-p53) with small molecule inhibitors TAS-120 and IWR-1 has a better tumor-killing effect and has good clinical translation potential. Summary of the Invention

[0006] The purpose of this invention is to provide an improved p53 with enhanced transcriptional activity and tumor-suppressive effects, and its uses.

[0007] The modified p53, which has stronger transcriptional activity and tumor-suppressive effects, adds the disordered domain sequence FUS-LC of the FUS protein to the wild-type p53 sequence, enhancing the liquid-liquid phase separation ability of wild-type p53 and exhibiting stronger transcriptional activation activity and tumor-killing effects.

[0008] The phase separation enhancement sequence FUS-LC can be added to the amino or carboxyl terminus of wild-type p53.

[0009] The modified p53 has transcriptional activation activity, wherein the phase separation enhancement sequence is shown in SEQ ID NO.1.

[0010] The modified p53 described herein possesses transcriptional activation activity, including in human and non-human species.

[0011] The improved p53 described above can activate CDKN1A Target gene transcription, improve CDKN1A, MDM2, PUMA, NOXA, BAF, DDB2 as well as RRM2B The transcriptional level of one or more downstream target genes.

[0012] The modified p53 is used in the preparation of tumor therapeutic drugs, and the applicable tumor types include non-small cell lung cancer, breast cancer, neuroblastoma, osteosarcoma, cervical cancer, and human brain tumors; the drugs include those that exert their active effects at both the nucleic acid and protein levels.

[0013] The modified p53 recombinant protein expression system includes E. coli expression host, animal cells, viral expression lines, and yeast protein expression system; prokaryotic expression vectors include pET-24a and pET-28a(+); eukaryotic expression vectors include: 1) pEGFP, pEYFP, pmcherry, pRFP, pECFP, pLenti, pLX, pCMV6, pCMV3, pcDNA3, and pcDNA6B animal cell expression vectors; 2) insect cell expression vectors include pAc5.1-EGFP, etc.; 3) viral expression systems include pAdeasy and pAdMAX, etc.; 4) yeast expression vectors include pPIC3 and pPIC9.

[0014] The modified p53 protein forms include the full-length form and the functional mutant form.

[0015] The modified p53-mediated tumor cell apoptosis target molecules include DEF6, which is used to treat tumors with high DEF6 expression levels.

[0016] The tumor treatment drug is a combination of modified p53 with the FGFR inhibitor TAS-120 and the Wnt signaling pathway inhibitor IWR-1, or a compound drug prepared to enhance its ability to kill tumor cells at lower protein concentrations.

[0017] The forms of the drugs include injections, tablets, capsules, oral liquid dosage forms, granules, and ointments.

[0018] The technical effects of this invention are as follows: (1) The innovative modified p53 of this application, namely LLPSEp53 (FUS-LC-p53), has a stronger liquid-liquid phase separation effect in both intracellular and extracellular environments.

[0019] (2) This application clarifies that the modified p53 with stronger liquid-liquid phase separation capability promotes the p53 target gene. CDKN1A as well as PUMA The transcriptional level of genes.

[0020] (3) This application demonstrates that LLPSEp53 (FUS-LC-p53) has a significant killing effect on a variety of tumor cells, indicating that it has great potential for clinical application in tumor treatment. It innovatively enhances the ability of p53 to inhibit tumor cell proliferation through phase separation.

[0021] (4) This application is the first to propose that the combination of LLPSEp53 (FUS-LC-p53) and DEF6 protein molecule inhibitor can improve the tumor killing effect and has good potential for clinical treatment of tumors.

[0022] (5) This application demonstrates that the combined use of low concentration LLPSEp53 (FUS-LC-p53) protein with drugs can enhance their tumor killing effect, providing a new theoretical basis for their application in clinical cancer treatment. Attached Figure Description

[0023] Figure 1 These are microscopic images comparing the in vitro phase separation capabilities of WT-p53 and C-terminal EGFP-tagged recombinant p53 (p53-EGFP).

[0024] Figure 2 The effect of transfecting the human non-small cell lung cancer cell line H1299 with WT-p53 and p53 (YFP-p53) plasmids with an N-terminal EYFP tag on the following is: CDKN1A Results of transcriptional activation detection.

[0025] Figure 3 This is a confocal image of WT-p53 and LLPSEp53 (FUS-LC-p53) in the human kidney epithelial cell line HEK293T, which is the subject of this invention.

[0026] Figure 4 These are confocal images of WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC), and p53-UTX in the human non-small cell lung cancer cell line H1299, as per the present invention.

[0027] Figure 5 These are confocal images of naked mole-rat p53 and modified naked mole-rat p53: WT-p53(mr), p53(mr)-FUS-LC and p53(mr)-UTX in the human non-small cell lung cancer cell line H1299, as per the present invention.

[0028] Figure 6 This is a graph showing the qRT-PCR results of the regulation of downstream target gene mRNA of p53 by WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids in the human kidney epithelial cell line HEK293T.

[0029] Figure 7 This is a graph showing the qRT-PCR results of the regulation of downstream target gene mRNA levels of p53 by WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids in the human non-small cell lung cancer cell line H1299.

[0030] Figure 8After transfecting the human non-small cell lung cancer cell line H1299 with WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC), and p53-UTX plasmids, the effects on... CDKN1A The results of the transcriptional activation detection are shown in the figure.

[0031] Figure 9 After transfecting the human non-small cell lung cancer cell line H1299 with WT-p53(mr), p53(mr)-FUS-LC, and p53(mr)-UTX plasmids, the effects on... CDKN1A The results of the transcriptional activation detection are shown in the figure.

[0032] Figure 10 This is a graph showing the cell viability results after transfecting human osteosarcoma cell line U2OS cells with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0033] Figure 11 This is a graph showing the cell viability results after transfecting human cervical cancer cells HeLa with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids, as detected by the CCK8 assay.

[0034] Figure 12 This is a diagram showing the cell viability results after transfecting the human kidney epithelial cell line HEK293T with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids, as detected by the CCK8 assay.

[0035] Figure 13 These are in vitro phase separation microscopy images of recombinant WT-p53 and LLPSEp53 (FUS-LC-p53) proteins.

[0036] Figure 14 The image shows the cell viability results of the CCK8 assay after the recombinant proteins WT-p53 and LLPSEp53 (FUS-LC-p53) were delivered into the human osteosarcoma cell line U2OS.

[0037] Figure 15 The image shows the cell viability results of the CCK8 assay after the recombinant proteins WT-p53 and LLPSEp53 (FUS-LC-p53) were delivered into the neuroblastoma cell line SH-SY5Y.

[0038] Figure 16 The image shows the results of cell viability detection by CCK8 assay after the recombinant proteins WT-p53 and LLPSEp53 (FUS-LC-p53) were delivered into the breast cancer cell line SKBR3.

[0039] Figure 17The image shows the cell viability results of the CCK8 assay after the recombinant proteins WT-p53 and LLPSEp53 (FUS-LC-p53) were delivered into the human brain tumor cell line SF126.

[0040] Figure 18 In the human non-small cell lung cancer cell line H1299, the control group (Vector) and... DEF6 Subsequently, WT-p53 and LLPSEp53 (FUS-LC-p53) were overexpressed respectively, and the cell viability was detected by ATP assay after 72 h.

[0041] Figure 19 The image shows the cell viability results obtained by CCK8 assay after delivering WT-p53 and LLPSEp53 (FUS-LC-p53) to the human osteosarcoma cell line U2OS, followed by the addition of DMSO (control), TAS-120, and IWR-1. Detailed Implementation

[0042] The design, method, and technical effects of the present invention will be illustrated below with reference to specific embodiments. The present invention includes, but is not limited to, the representative embodiments disclosed below, and can be described in various other ways. This specification is intended to help those skilled in the art to comprehensively understand the implementation details of the present invention.

[0043] Example 1: Comparison of in vitro liquid-liquid phase separation capabilities of WT-p53 and EGFP-p53 recombinant proteins Since tagged proteins can affect protein structure, to investigate whether adding a tag affects the liquid-liquid phase separation of WT-p53, we added EGFP as a tag to the C-terminus of p53 and then compared the in vitro liquid-liquid phase separation capabilities of WT-p53 without a fluorescent tag and the p53-EGFP recombinant protein. The experimental results showed that, under the same conditions, compared with WT-p53 without a fluorescent tag, p53-EGFP did not form a distinct droplet structure when WT-p53 had already undergone liquid-liquid phase separation. This indicates that the EGFP tag has a significant inhibitory effect on the liquid-liquid phase separation of p53 protein. Figure 1 ).

[0044] Implementation steps:

[0045] The two target genes were cloned into the pET-24a(+) prokaryotic expression vector, transformed into the C41 expression strain, and cultured overnight in a constant temperature incubator at 37 ℃.

[0046] Select single clones and incubate at 37 ℃ and 220 rpm until OD600 = 0.6; Add 200-500 μM IPTG and 100 µM ZnCl2, and incubate overnight at 25 ℃ and 220 rpm. Centrifuge at 4500 rpm and 4 ℃ for 30 min; Add cell lysis buffer, autoclave, and centrifuge at 17,000 rpm and 4 °C for 30 min; The supernatant was then purified using HisTrap HP media. The eluent was purified using HiTrap Heparin HP media. Finally, gel filtration was performed for further purification. A phase separation system was prepared, and the phase separation capabilities of the two systems were compared by taking pictures with an inverted fluorescence microscope.

[0047] The results showed that, under the same conditions, WT-p53 had formed a distinct droplet structure, while p53-EGFP had not formed a distinct droplet structure, indicating that adding the tag protein EGFP to one end of the p53 sequence can inhibit the liquid-liquid phase separation of p53 protein.

[0048] Example 2: Comparison of transcriptional activation activities of YFP-p53, WT-p53, and LLPSEp53 (FUS-LC-p53) To investigate whether adding different tags to the C-terminus alters the transcriptional activation activity of p53, we added a YFP tag to the C-terminus of wild-type p53 to construct the pCMV3-YFP-p53 eukaryotic expression vector. pCMV3-YFP-p53, pCMV3-p53, and pCMV3-LLPSEp53 (FUS-LC-p53) were then transfected into cells, and the effects of these three vectors on transcriptional activation were examined. CDKN1A Effects on transcriptional activation capacity. Experimental results showed that, compared with WT-p53, YFP-p53 had a greater effect on... CDKN1A The transcriptional activation capacity of LLPSEp53 (FUS-LC-p53) was not significantly affected. CDKN1A The transcriptional activation ability is superior to that of YFP-p53 and WT-p53 ( Figure 2 ).

[0049] Implementation steps:

[0050] Seed an appropriate amount of cells into a 96-well cell culture plate. When the cell density reaches 60-70%, the above-mentioned plasmid is added to... CDKN1A The luciferin reporter gene plasmid was co-transformed and incubated for another 24 hours. Chemiluminescence detection was performed using the Promega Dual Fluorescent Reporter System assay kit and the M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0051] The results showed that, compared with WT-p53, YFP-p53 was more effective at... CDKN1A The weak transcriptional activation activity indicates that adding the YFP tag inhibits the transcriptional activation activity of wild-type p53, while LLPSEp53 (FUS-LC-p53) significantly enhances the transcriptional activation activity of wild-type p53. CDKN1A Its transcriptional activation capacity.

[0052] Example 3: Comparison of cellular levels of WT-p53 and LLPSEp53 (FUS-LC-p53) liquid-liquid phase separation transformation ability in human kidney epithelial cell line HEK293T cells.

[0053] To verify that the phase separation ability of the LLPSEp53 (FUS-LC-p53) designed in this invention is superior to that of WT-p53, the droplet size formed by the two in cells was detected by eukaryotic cell transfection and immunofluorescence technology, and the phase separation ability of the two was preliminarily evaluated.

[0054] Implementation steps:

[0055] One day before transfection, seed 6-8 × 10^5 cells in a 35 mm confocal dish and add 2 ml of complete culture medium; Once the cell confluence reaches 60-70%, transfect 2-2.5 μg of plasmid into each well and continue culturing at 37 ℃ in a 5% CO2 incubator for 24 h. Discard 1 ml of complete culture medium, add 1 ml of 4% paraformaldehyde, and fix at room temperature for 10 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 0.2% Triton X-100 and allow to pass through at room temperature for 15 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 1 ml of 5% BSA and block at room temperature for 1 h; Add diluted p53 primary antibody (dilution ratio 1:1000), place on a horizontal shaker, and incubate overnight at 4 ℃; Recover the primary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Add diluted immunofluorescence secondary antibody (dilution ratio 1:1000) and incubate at room temperature in the dark for 1 h; Discard the secondary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Confocal microscopy was used for photographic inspection, and the imaging parameters were consistent for different samples.

[0056] Experimental results showed that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) exhibited stronger liquid-liquid phase separation in HEK293T cells, forming more and larger droplet structures. Figure 3 ).

[0057] Example 4: Comparison of liquid-liquid phase separation of WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC), and p53-UTX in the non-small cell lung cancer cell line H1299.

[0058] To verify that the phase separation ability of the modified p53 (LLPSEp53) designed in this invention is superior to that of WT-p53, and to investigate whether there is a difference between adding the FUS-LC sequence to the N-terminus or C-terminus of the p53 protein, as well as the difference between adding different disordered structural sequences, we constructed eukaryotic expression vectors pCMV6-p53, pCMV6-FUS-LC-p53, pCMV6-p53-FUS-LC, and p53-UTX. After transfection into the human non-small cell lung cancer cell line H1299, the number and size of droplets formed by the four vectors in the cells were detected by immunofluorescence technology.

[0059] Implementation steps:

[0060] One day before transfection, 6-8×10^5 H1299 cells were seeded in a 35 mm confocal dish and 2 ml of complete culture medium was added. Once the cell density reaches 60-70%, transfect each dish with 2-2.5 μg of plasmid and continue culturing at 37 ℃ in a 5% CO2 incubator for 24 h. Discard 1 ml of complete culture medium, add 1 ml of 4% paraformaldehyde, and fix at room temperature for 10 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 0.2% Triton X-100 and allow to pass through at room temperature for 15 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 1 ml of 5% BSA and block at room temperature for 1 h; Add diluted p53(DO-1) primary antibody (dilution ratio 1:1000), place on a horizontal shaker, and incubate overnight at 4 ℃; Recover the primary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Add diluted immunofluorescence secondary antibody (dilution ratio 1:1000) and incubate at room temperature in the dark for 1 h; Discard the secondary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Confocal microscopy was used for photographic inspection, and the imaging parameters were consistent for different samples.

[0061] Experimental results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) formed the most numerous and largest droplet structures at H1299, followed by LLPSEp53 (p53-FUS-LC). This indicates that LLPSEp53 (FUS-LC-p53) has the strongest phase separation ability compared to WT-p53. Furthermore, adding the phase separation enhancing sequence to different ends affects the phase transition ability. p53-UTX did not form obvious droplet structures, indicating that different disordered domains have different effects on the phase separation of the p53 protein. In summary, the FUS-LC-added N-terminus LLPSEp53 (FUS-LC-p53) of this application is the most preferred modified p53 with enhanced liquid-liquid phase separation ability. Figure 4 ).

[0062] Example 5: Comparison of p53(mr), p53(mr)-FUS-LC, and p53(mr)-UTX liquid-liquid phase separation in the non-small cell lung cancer cell line H1299

[0063] To verify that the preferred phase separation enhancement sequence of this invention also has interspecies universality for p53, the phase separation effect of the FUS-LC sequence on naked mole rat p53 protein was investigated. We constructed eukaryotic expression vectors pCMV6-WT-p53(mr), pCMV6-p53(mr)-FUS-LC, and pCMV6-p53(mr)-FUS-LC. After transfection into the human non-small cell lung cancer cell line H1299, the number and size of droplets formed by the three vectors in the cells were detected using immunofluorescence technology.

[0064] Implementation steps:

[0065] One day before transfection, 6-8×10^5 H1299 cells were seeded in a 35 mm confocal dish and 2 ml of complete culture medium was added. Once the cell density reaches 60-70%, transfect each dish with 2-2.5 μg of plasmid and continue culturing at 37 ℃ in a 5% CO2 incubator for 24 h. Discard 1 ml of complete culture medium, add 1 ml of 4% paraformaldehyde, and fix at room temperature for 10 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 0.2% Triton X-100 and allow to pass through at room temperature for 15 min; Discard all supernatant, add 1 ml PBS and wash 3 times, 5 min each time; Add 1 ml of 5% BSA and block at room temperature for 1 h; Add diluted p53 (DO-1) primary antibody (dilution ratio 1:1000), place on a horizontal shaker, and incubate overnight at 4°C. Recover the primary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Add diluted immunofluorescence secondary antibody (dilution ratio 1:1000) and incubate at room temperature in the dark for 1 h; Discard the secondary antibody, add 1 ml of PBS and wash 3 times, 5 min each time; Confocal microscopy was used for photographic inspection, and the imaging parameters were consistent for different samples.

[0066] Experimental results show that, compared with WT-p53(mr), p53(mr)-FUS-LC formed the most and largest droplets, while p53(mr)-UTX did not form obvious droplet structures. This indicates that the optimal disordered domain FUS-LC has a certain degree of universality in promoting liquid-liquid phase separation of p53 from different species. Figure 5 ) Example 6: The modified p53 of the present invention has a stronger ability to transcribe its downstream target genes.

[0067] After demonstrating that LLPSEp53 (FUS-LC-p53) exhibits superior phase separation ability compared to WT-p53, we constructed pEGFP-N1-p53 and pEGFP-N1-LLPSEp53 (FUS-LC-p53) eukaryotic expression vectors. In HEK293T cells, we used qRT-PCR to detect the transcriptional regulatory capacity of WT-p53 and LLPSEp53 (FUS-LC-p53) on their downstream target genes. The results showed that, compared to WT-p53, LLPSEp53 (FUS-LC-p53) significantly improved the phase separation ability of its target genes. CDKN1A , MDM2 as well as PUMA The transcriptional level of [something] was significantly increased. Figure 6 This indicates that phase separation enhances the transcriptional activity of p53.

[0068] Implementation steps:

[0069] Cells were seeded in 12-well cell culture plates. After the cell density reached 70-80%, 1 μg of plasmid was transfected and cultured for another 24 h. Total RNA was extracted from cells using the Trizol method. The extracted total RNA was reverse transcribed into cDNA, and a qRT-PCR system was prepared according to a standardized procedure. Detection was performed using a real-time quantitative PCR instrument; Data processing and analysis were performed using Graphpad5 software.

[0070] Experimental results show that LLPSEp53 (FUS-LC-p53) has stronger transcriptional activity compared with WT-p53.

[0071] Example 7: The modified p53 of the present invention has a stronger ability to transcribe its downstream target genes.

[0072] In HEK293T cells, phase separation was demonstrated to enhance p53 transcriptional activity using qRT-PCR. We constructed eukaryotic expression vectors pCMV6-p53 and pCMV6-LLPSEp53 (FUS-LC-p53) and further validated them in H1299 cells. The results showed that LLPSEp53 (FUS-LC-p53) significantly enhanced p53 transcriptional activity compared to WT-p53. CDKN1A , MDM2 as well as PUMA transcriptional levels (etc.) Figure 7 ).

[0073] Implementation steps:

[0074] Cells were seeded in 12-well cell culture plates. After the cell confluence reached 70-80%, 1 μg of plasmid was transfected and cultured for another 24 hours. Total RNA was extracted from cells using the Trizol method. The extracted RNA was reverse transcribed to synthesize cDNA, and a qRT-PCR system was prepared according to a standardized procedure. Detection was performed using a real-time quantitative PCR instrument; Data processing and analysis were performed using Graphpad5 software.

[0075] Experimental results show that LLPSEp53 (FUS-LC-p53) has stronger transcriptional activation activity compared with WT-p53.

[0076] Example 8: The modified p53 of the present invention has a stronger ability to transcribe and activate its downstream target genes.

[0077] To further verify whether phase separation can affect the transcriptional activation activity of p53, eukaryotic expression vectors pcDNA3.1-p53, pcDNA3.1-LLPSEp53 (FUS-LC-p53), pcDNA3.1-LLPSEp53 (FUS-LC-p53), and pcDNA3.1-p53-UTX were constructed. A dual-luciferase reporter assay in H1299 cells demonstrated that enhanced phase separation promotes p53 transcriptional activation. CDKN1A Transcriptional activation ( Figure 8 ).

[0078] Implementation steps:

[0079] Seed an appropriate amount of cells into a 96-well cell culture plate. When the cell density reaches 60-70%, the above-mentioned plasmid is added to... CDKN1A The luciferin reporter gene plasmid was co-transformed and incubated for another 24 hours. Chemiluminescence detection was performed using the Promega Dual Fluorescent Reporter System assay kit and the M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0080] Experimental results showed that LLPSEp53 (FUS-LC-p53) had the strongest transcriptional activation ability compared with WT-p53, followed by LLPSEp53 (p53-FUS-LC) and p53-UTX, which were consistent with the size of the phase-separated structures it formed in the cell.

[0081] Example 9: The modified p53 of the present invention also exhibits a stronger ability to transcribe and activate downstream target genes in the naked mole rat p53 sequence p53(mr).

[0082] To further verify whether phase separation can affect the transcriptional activation activity of p53(mr), eukaryotic expression vectors pcDNA3.1-p53(mr), pcDNA3.1-p53(mr)-FUS-LC, and pcDNA3.1-p53(mr)-UTX were constructed. A dual-luciferase reporter assay in H1299 cells demonstrated that this phase separation enhancement sequence can promote p53 pairing between different species. CDKN1A Transcriptional activation ( Figure 9 ).

[0083] Implementation steps:

[0084] Seed an appropriate amount of cells into a 96-well cell culture plate. When the cell density reaches 60-70%, the above-mentioned plasmid is added to... CDKN1A The luciferin reporter gene plasmid was co-transformed and incubated for another 24 hours. Chemiluminescence detection was performed using the Promega Dual Fluorescent Reporter System assay kit and the M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0085] Experimental results showed that p53(mr)-FUS-LC had the strongest transcriptional activation ability compared with WT-p53(mr), while the transcriptional activation activity of p53(mr)-UTX did not change significantly, indicating that phase separation can enhance the p53 transcriptional activation ability of different species.

[0086] Example 10: The modified p53 gene of the present invention has a stronger ability to kill the osteosarcoma cell line U2OS.

[0087] To further investigate the tumor-killing effect of LLPSEp53 (FUS-LC-p53), we constructed eukaryotic expression vectors pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) and tested their cell viability in U2OS cells. The results showed that the modified p53 more effectively inhibited the tumor killing of U2OS tumor cells than wild-type p53. Figure 10 The proliferation of ).

[0088] Implementation steps:

[0089] Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium to each well, and incubate for 12-24 h. Transfect 100 ng of plasmid into cells, with 3 replicates per group, and incubate for 72 h. Remove the cells and equilibrate them to room temperature for 30 minutes. Also equilibrate the reaction report solution to room temperature. Discard 50 μl of complete culture medium, add 50 μl of reaction reporter solution, and lyse in a horizontal shaker at room temperature for 15 min. Cell viability was detected using the ATP method and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0090] The results showed that LLPSEp53 (FUS-LC-p53) had a more significant killing effect on U2OS tumor cells compared with WT-p53.

[0091] Example 11: The modified p53 gene of the present invention has a stronger ability to kill human cervical cancer cell line HeLa cells.

[0092] To further investigate the tumor-killing effect of LLPSEp53 (FUS-LC-p53), we constructed eukaryotic expression vectors pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) and also tested cell viability in HeLa cells. The experimental results showed that p53 phase segregation inhibited the tumor killing effect of HeLa tumor cells. Figure 11 The proliferation of ).

[0093] Implementation steps:

[0094] Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. Prepare a 50 μl protein delivery system with a protein concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); The above system was sterilized by passing it through a 0.22 μm filter membrane; Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 h. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; Cell viability was detected using the CCK8 assay and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0095] The results showed that, compared with WT-p53, the LLPSEp53 (FUS-LC-p53) gene significantly promoted apoptosis in HeLa cells.

[0096] Example 12: The modified p53 gene of the present invention is not toxic to the normal human kidney epithelial cell line HEK293T.

[0097] To further investigate the tumor-killing effect of LLPSEp53 (FUS-LC-p53), we constructed eukaryotic expression vectors pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) and also tested cell viability in HEK293T cells. The experimental results showed that p53 phase separation did not affect the proliferation of HEK293T cells. Figure 12 ).

[0098] Implementation steps:

[0099] Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. Prepare a 50 μl protein delivery system with a protein concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); The above system was sterilized by passing it through a 0.22 μm filter membrane; Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 h. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; Cell viability was detected using the CCK8 assay and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0100] The results showed that, compared with WT-p53, the LLPSEp53 (FUS-LC-p53) gene did not inhibit the proliferation of non-cancer HEK293T cells.

[0101] Example 13 Comparison of in vitro phase separation ability between the modified p53 recombinant protein of the present invention and wild-type WT-p53 recombinant protein

[0102] After clarifying the phase-separation ability and function of LLPSEp53 (FUS-LC-p53) at its expression level in eukaryotic cells, prokaryotic expression and purification of WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins, as well as in vitro phase-separation experiments, revealed that compared to WT-p53, LLPSEp53 (FUS-LC-p53) could form a greater number of phase-separated structures even at very low protein concentrations. Figure 13 ).

[0103] Implementation steps:

[0104] The two target genes were cloned into the pET-28a(+) prokaryotic expression vector, transformed into the BL21 expression strain, and cultured overnight at 37 ℃.

[0105] Select single clones and incubate at 37 ℃ and 220 rpm until OD600 = 0.6; Add 1 mM IPTG and 100 µM ZnCl2, and incubate overnight at 22 ℃ and 220 rpm. Centrifuge at 4500 rpm and 4 ℃ for 30 min; Add cell lysis buffer, autoclave, and centrifuge at 17,000 rpm and 4 °C for 30 min; The supernatant was then purified using HisTrap HP media. The eluent was purified using HiTrap Heparin HP media. Finally, gel filtration was performed for further purification. A phase separation system was prepared, and the phase separation capabilities of the two systems were compared by taking pictures under a fluorescence inverted microscope.

[0106] The results showed that LLPSEp53 (FUS-LC-p53) formed more and larger droplets than WT-p53, indicating that LLPSEp53 (FUS-LC-p53) has a stronger liquid-liquid phase separation capability than wild-type p53.

[0107] Example 14: The recombinant LLPSEp53 (FUS-LC-p53) protein enhanced the killing effect of p53 on the human osteosarcoma cell line U2OS.

[0108] To clarify whether the recombinant LLPSEp53 (FUS-LC-p53) protein also has a tumor-killing effect, we performed protein-level validation on U2OS cells and found that the recombinant LLPSEp53 (FUS-LC-p53) protein also had a significant killing effect on U2OS tumor cells. Figure 14 ).

[0109] Implementation steps:

[0110] 1. Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. 2. Prepare a 50 μl protein delivery system according to a protein concentration of 6.5-10 μM, as follows: 6-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); 3. Sterilize the above system by passing it through a 0.22 μm filter membrane; 4. Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 hours. 5. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; 6. Cell viability was detected using the CCK8 assay and an M5 microplate reader; 7. Use Graphpad5 software for data processing and analysis.

[0111] The results showed that, in U2OS tumor cells, the recombinant LLPSEp53 (FUS-LC-p53) protein promoted apoptosis of U2OS tumor cells compared with WT-p53.

[0112] Example 15: The modified p53 protein of the present invention has a stronger ability to kill the human neuroblastoma cell line SH-SY5Y.

[0113] We further validated the protein level on SH-SY5Y cells and found that the recombinant LLPSEp53 (FUS-LC-p53) protein also had a significant killing effect on SH-SY5Y tumor cells. Figure 15 ).

[0114] Implementation steps:

[0115] Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. Prepare a 50 μl protein delivery system with a protein concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); The above system was sterilized by passing it through a 0.22 μM filter membrane; Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 h. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; Cell viability was detected using the CCK8 assay and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0116] The results showed that, compared with WT-p53, the recombinant LLPSEp53 (FUS-LC-p53) protein significantly promoted apoptosis in SH-SY5Y tumor cells.

[0117] Example 16: The recombinant LLPSEp53 (FUS-LC-p53) protein enhanced the killing effect of p53 on the human breast cancer cell line SKBR3. We further validated the protein level on SKBR3 cells and found that the recombinant LLPSEp53 protein also had a significant killing effect on SKBR3 tumor cells. Figure 16 ).

[0118] Implementation steps:

[0119] Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. Prepare a 50 μl protein delivery system with a protein concentration of 6.5-10 μM as follows: 6-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); The above system was sterilized by passing it through a 0.22 μm filter membrane; Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 h. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; Cell viability was detected using the CCK8 assay and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0120] The results showed that, compared with WT-p53, the recombinant LLPSEp53 (FUS-LC-p53) protein significantly promoted apoptosis in SKBR3 tumor cells.

[0121] Example 17: The recombinant LLPSEp53 (FUS-LC-p53) protein enhanced the killing effect of p53 on the human brain tumor cell line SF126. We further validated the protein level on SF126 cells and found that the recombinant LLPSEp53 (FUS-LC-p53) protein also had a significant killing effect on SF126 tumor cells. Figure 17 ).

[0122] Implementation steps:

[0123] 1. Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. 2. Prepare a 50 μl protein delivery system according to a protein concentration of 6.5-10 μM, as follows: 6.5-10 μM protein + 5× transduction buffer + complete culture medium (P / S-free); 3. Sterilize the above system by passing it through a 0.22 μm filter membrane; 4. Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 hours. 5. Discard the protein delivery system, add complete culture medium, and continue culturing for 24 h; 6. Cell viability was detected using the CCK8 assay and an M5 microplate reader; 7. Use Graphpad5 software for data processing and analysis.

[0124] The results showed that, compared with WT-p53, the recombinant LLPSEp53 (FUS-LC-p53) protein significantly promoted apoptosis in SF126 tumor cells.

[0125] Example 18: LLPSEp53 (FUS-LC-p53) exerts its tumor-killing function by regulating DEF6. To further investigate the mechanism by which LLPSEp53 (FUS-LC-p53) promotes tumor cell apoptosis, we screened tumor cells using RNA-seq and found that overexpression of LLPSEp53 (FUS-LC-p53) induced apoptosis compared to wild-type p53. DEF6 Transcription levels of [something] are reduced, knockdown DEF6 Subsequently, it was found that LLPSEp53 (FUS-LC-p53) had enhanced tumor-inhibiting ability, indicating that the combination of LLPSEp53 with drugs or molecules that can inhibit DEF6 activity can achieve better tumor-killing effects. Figure 18 ).

[0126] Implementation steps:

[0127] Seed 5-6×10^5 cells into a 12-well cell culture plate, add 1 ml of complete culture medium and continue to culture for 12-24 h; Transfect 1 μg each of shVector and shDEF6 plasmids into cells and incubate for 48 h. The cells from the two groups were digested and counted, and seeded into 96-well plates at a density of 5000 cells per well, and cultured for another 24 h. Transfect each well with 150 ng of plasmid and incubate for 72 h. Cell viability was detected using the ATP assay and an M5 microplate reader. Data processing and analysis were performed using Graphpad5 software.

[0128] The results showed that without knocking down DEF6 Under genetic conditions, LLPSEp53 (FUS-LC-p53) showed almost no inhibitory effect on the viability of the non-small cell lung cancer cell line H1299 at the genetic level compared to wild-type p53; when knocked down... DEF6 Subsequently, LLPSEp53 (FUS-LC-p53) significantly inhibited H1299 cell viability at the gene level, indicating that by inhibiting... DEF6This pathway can further enhance the tumor-killing function of LLPSEp53 (FUS-LC-p53). This discovery broadens the range of tumors that LLPSEp53 (FUS-LC-p53) kills, increasing its potential for clinical translation.

[0129] Example 19: The combined use of LLPSEp53 (FUS-LC-p53) protein with TAS-120 and IWR-1 enhanced its tumor-killing effect.

[0130] To further enhance the tumor-killing effect of LLPSEp53 (FUS-LC-p53), we selected FGF / FGFR signaling pathway inhibitors and Wnt signaling pathway inhibitor IWR-1 to combine with LLPSEp53 (FUS-LC-p53) protein and tested its killing ability against the human osteosarcoma cell line U2OS. The results showed that, compared with WT-p53, the tumor-killing ability of LLPSEp53 (FUS-LC-p53) protein was improved after being combined with TAS-120 and IWR-1. Figure 19 ).

[0131] Implementation steps:

[0132] 1. Seed 5000 cells / well in a 96-well cell culture plate, add 100 μl of complete culture medium (P / S-free), and incubate for 12-24 h. 2. Prepare a 50 μl protein delivery system according to a protein concentration of 3 μM, as follows: 0.5-2 μM protein + 5×transduction buffer + complete culture medium (P / S-free); 3. Sterilize the above system by passing it through a 0.22 μm filter membrane; 4. Discard the complete culture medium in the well plate, add the protein delivery system described above, and incubate for another 24 hours. 5. Discard the protein delivery system, add complete culture medium containing 10 μM TAS-120 and 10 μM IWR-1 respectively, and add an equal volume of DMSO as a control, and continue to culture for 24 h. 6. Cell viability was detected using the CCK8 assay and an M5 microplate reader; 7. Use Graphpad5 software for data processing and analysis.

[0133] The results showed that in U2OS cells, the combination of LLPSEp53 with TAS-120 and IWR-1 enhanced the tumor cell killing effect of recombinant LLPSEp53 compared with WT-p53, providing a certain theoretical basis for the application of LLPSEp53 (FUS-LC-p53) and its combination with other drugs in the clinical treatment of tumors.

[0134] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

[0135] The DNA sequence added to the modified p53 to promote phase separation: SEQ ID NO.1 ATGGCCTCAAACGATTATACCCAACAAGCAACCCAAAGCTATGGGGCCTACCCCACCCAGCCCGGGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAGCAGAGTTACAGTGGTTATAGCCAGTCCACGGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTTATGGCCAGAGCCAGAACACAGGCTATGGAACTCAGTCAACTCCCCAGGGATATGGCTCGACTGGCGGCTATGGCAGTAGCCAGAGCTCCCAATCGTCTTACGGGCAGCAGTCCTCCTACCCTGGCTATGGCCAGCAGCCAGCTCCCAGCAGCACCTCGGGAAGTTACGGTAGCAGTTCTCAGAGCAGCAGCTATGGGCAGCCCCAGAGTGGGAGCTACAGCCAGCAGCCTAGCTATGGTGGACAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCCTCAGGGCTATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGGTAACTATGGCCAAGATCAATCCTCCATGAGTAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGA Amino acid sequence that promotes phase separation added to modified p53: SEQ ID NO. 2 MASNDYTQQATQSYGAYPTQPGQGYSQQSSQPYGQQSYSGYSQSTDTSGYGQSSYSSYGQSQNTGYGTQSTPQGYGSTGGYGSSQSSQSSYGQQSSYPGYGQQPAPSSTSGSYGSSSQSSSYGQPQSGSYSQQPSYGGQQQSYGQQQSYNPPQGYGQQNQYNSSSGGGGGGGGGGNYGQDQSSMSSGGGSGGGYGNQDQSGGGGSGGYGQQDRG

Claims

1. A modified p53 with stronger transcriptional activity, characterized by... The N-terminus or C-terminus fusion of the p53 sequence promotes p53 phase separation; the phase separation enhancement sequence is the disordered domain of the FUS protein, i.e., FUS-LC, and the gene sequence is shown in SEQ ID NO.

1.

2. The use of a modified p53 with enhanced transcriptional activity according to claim 1 in the preparation of a tumor therapeutic drug, characterized in that, The applicable tumor types are breast cancer, neuroblastoma, osteosarcoma, cervical cancer and human brain tumors. The modified p53 is a sequence that promotes the separation of the p53 phase by fusing the amino terminus of the p53 sequence.

3. The use according to claim 2, characterized in that, The drug contains a modified p53 protein or a nucleic acid encoding it.

4. The use according to claim 2, characterized in that, The modified p53 recombinant protein expression system includes E. coli expression host, animal cells, viral expression system, and yeast protein expression system; prokaryotic expression vectors include pET24a and pET28a(+); eukaryotic expression vectors include: 1) pEGFP, pEYFP, pmCherry, pRFP, pECFP, pLenti, pLX, pCMV6, pCMV3, pcDNA3, and pcDNA6B animal cell expression vectors; 2) insect cell expression vectors include pAc5.1-EGFP; 3) viral expression systems include pAdeasy and pAdMAX; 4) yeast expression vectors include pPIC3 and pPIC9.

5. The use according to claim 2, characterized in that, The drug is available in the form of injection, tablet, capsule, oral liquid, granule, or ointment.

Images