Transcription factor osrav9 mutant and method for improving rice grain traits

Abstract

The application discloses a method for improving rice grain type, and relates to application of a transcription factor gene OsRAV9 in promoting grain length, grain thickness, 1000-grain weight or final yield by a genetic engineering method. The transgenic rice grain length, grain thickness and 1000-grain weight are significantly improved, and the ear length and the grain number per plant are significantly increased. The method can be used for genetic improvement of rice grain traits, and is expected to cultivate high-yield rice varieties.

Description

Technical Field

[0001] This invention relates to the OsRAV9 mutant transcription factor and methods for improving rice grain traits, belonging to the field of biogenetic engineering. Background of the Invention

[0002] High and stable yields of rice (Oryza sativa L.) are crucial for ensuring my country's food security, and further breakthroughs in rice yield remain one of the current breeding goals. The development and maturation of rice grains is an ordered and selective gene expression process. Transcription factors play a key role in this process.

[0003] Transcription factor RAV (Related to ABI3 / VP1) is widely distributed in the plant kingdom. Its core structural feature is the presence of an AP2 domain and a B3 domain. The AP2 domain is usually located at the N-terminus of the protein and is responsible for binding CAACA-motif; the B3 domain is located downstream of the AP2 domain and is responsible for recognizing CACCTG-motif. The C-terminus of the protein often contains a region rich in proline or acidic amino acids, which may inhibit the expression of target genes by recruiting co-repressors. The two different DNA-binding domains endow the RAV protein with more functions (Zheng et al., 2023, Molecular Plant Breeding, 1-10; Luis et al., 2014, Annals of Botany, 114(7):1459-70).

[0004] RAV transcription factors play a crucial role in plant organ development, reproductive development, and senescence. In terms of organ development, Arabidopsis thaliana AtNGA1-4 regulates lateral organ size by controlling cell proliferation; overexpression leads to narrow leaves and floral organs, while the quadruple mutant produces large organs. A similar mechanism is observed in soybean GmRAV, which inhibits root and stem growth and regulates short-day-mediated flowering (Lee et al., 2015, Plant Molecular Biology, 89(4):529-538; Lu et al., 2014, Public Library of Science One, 9(2):e89145). In terms of reproductive development, Arabidopsis thaliana RAV1 negatively regulates embryonic development by directly inhibiting the key seed development genes MINI3 and IKU2. Overexpression of RAV1 leads to delayed development of rosette leaves and lateral roots, while low expression induces an early flowering phenotype, confirming the function of RAV1 as a negative growth regulator (Shin et al., 2018, Molecules and Cells, 41(12):1072-1080). Meanwhile, members of this family, AtTEM1 / 2, delay flowering by inhibiting the expression of the florigen gene FT and gibberellin synthesis. Downregulation of FT expression leads to abnormal elongation of the hypocotyl due to gibberellin accumulation (Matías et al., 2014, Annals of Botany, 114(7):1459-1470). Furthermore, rice OsRAV9 / OsTEM1, acting upstream of the flowering promoters OsMADS14 and Hd3a, inhibits photoperiodic flowering, while its homologs OsRAV11 / 12 act downstream of OsMADS1 and OsMADS13, participating in the regulation of carpel differentiation and seed size (Michela et al., 2020, Plant Physiology, 183(4): 1663-1680). Regarding senescence regulation, Arabidopsis AtRAV1 accelerates chlorophyll degradation by positively regulating leaf senescence, while soybean GmRAV, significantly induced by darkness and ABA, promotes yellowing of transgenic tobacco leaves, positively regulating leaf senescence (Woo et al., 2010, Journal of Experimental Botany, 61(14): 3947-3957; Zhao et al., 2008, Planta, 227(6): 1389-1399.). However, there are currently no reports on the role of OsRAV9 in regulating rice grain shape.

[0005] CRISPR-Cas9 technology involves designing an sgRNA to mediate the specific recognition and targeted cleavage of a target site by the Cas9 nuclease, and then introducing mutations using intracellular error-prone repair mechanisms. This technology is simple to operate, highly efficient in mutation, has a short cycle time, and is inexpensive. It can obtain germplasm resources without marker genes, which is of great significance for germplasm innovation and gene function research. Currently, this technology has been successfully applied to improve specific gene expression, metabolic regulation, stress response, yield, and quality traits in crops, providing new ideas for crop variety improvement.

[0006] Meanwhile, Gateway technology is based on the well-studied site-specific recombination system of λ-phile bacteria, mainly consisting of BP and LR reactions. Gateway technology avoids many limitations of traditional restriction enzyme digestion and ligation steps, such as the possibility that certain restriction enzymes may cut into the gene of interest, truncating the inserted fragment and rendering the gene unusable for downstream expression, as well as the low efficiency of recovering recombinants from large cloned fragments and the time-consuming colony screening process. With its unique site-specific recombination principle, Gateway technology demonstrates high efficiency and flexibility in gene manipulation, providing strong technical support for the construction of overexpression vectors.

[0007] Therefore, there is a need for a new breeding method that combines CRISPR-Cas9 gene editing technology and Gateway technology to obtain rice materials or varieties with improved grain traits. Summary of the Invention

[0008] The first principle of this invention is the first successful creation of a loss-of-function mutant (osrav9) by editing the rice OsRAV9 gene using CRISPR-Cas9 gene editing technology. Gene sequencing and protein sequence mutation analysis confirmed a frameshift mutation in the OsRAV9 protein of the mutant, indicating that gene editing led to the loss of protein function of this gene in rice. Furthermore, this mutation severely affected rice grain formation and traits such as panicle length and number of grains per plant in overexpressing lines.

[0009] The second principle of this invention is that, for the first time, the OsRAV9 gene in rice plants is overexpressed using Gateway technology to obtain rice materials or varieties with improved grain traits, providing a new approach to improving rice quality and increasing rice yield.

[0010] The first objective of this invention is to provide a method for obtaining rice OsRAV9 gene mutants using CRISPR-Cas9 gene editing technology, comprising the following steps:

[0011] (1) Design a sgRNA based on a DNA sequence specific to the coding region of the OsRAV9 nucleotide sequence shown in SEQ ID NO:1, then clone it using specific primers and construct a gene editing vector, wherein the sgRNA has a PAM sequence as shown in SEQ ID NO:4;

[0012] (2) Obtaining rice OsRAV9 gene mutants through Agrobacterium-mediated genetic transformation;

[0013] (3) Analyze rice mutants, identify and screen homozygous mutants with frameshift mutations in the OsRAV9 protein, wherein the mutant is osrav9, which has a base deletion at position 144 of the coding region.

[0014] In one embodiment, step (1) involves linking the amplification product to the gene editing engineering vector pHUN4c12 using primers LP and RP as shown in sequence SEQ ID NO:6-7, to obtain the gene editing vector PHUN4c12-PAM of OsRAV9.

[0015] In another embodiment, in step (2), rice embryo callus is infected with Agrobacterium containing the gene editing vector pHUN4c12-PAM, and rice OsRAV9 gene mutants are obtained by screening with antibiotics.

[0016] In another embodiment, in step (3), the genome of the mutant is amplified by PCR using primers OsRAV9-F and OsRAV9-R as shown in sequence SEQ ID NO:8-9, and the amplification product is compared with the DNA sequence of wild-type OsRAV9 to identify and screen homozygous mutants with frameshift mutations in the OsRAV9 protein.

[0017] In any of the above embodiments, the gene sequence of the mutant osrav9 is the sequence shown in SEQ ID NO 5.

[0018] The second objective of this invention is, based on the above objective, to obtain a method for obtaining rice materials or varieties with improved grain traits by overexpressing the OsRAV9 gene in rice plants using Gateway technology.

[0019] The steps include:

[0020] (I) Extraction of total RNA from rice;

[0021] (II) Reverse transcription of total RNA from step (I) yields cDNA;

[0022] (III) Using the cDNA from step (II) as a template, design PCR primers to amplify the OsRAV9 gene sequence. Then, ligate the amplification product into a vector and introduce it into competent cells. Extract the plasmid pGWB512-OsRAV9 from the obtained positive clones and transform the plasmid into Agrobacterium.

[0023] (IV) Transgenic rice lines OE1, OE3, OE4, OE7, and OE10 with OsRAV9 gene overexpression were obtained through Agrobacterium-mediated genetic transformation.

[0024] In one implementation, the rice variety in step (I) is Zhonghua 11.

[0025] In another embodiment, the PCR primers in step (III) are primers as shown in SEQ ID NO:10-11 (SEQ ID NO:10, OsRAV9-512-F: ATGCTCATCCGGAATTCATGGGGGGTGGTC AGCTT; SEQ ID NO:11, OsRAV9-512-R: CAGTCACTATGGTCGACTAACAGCAGGGCACC TA), and the target fragment of the amplified product is 1098bp.

[0026] In another embodiment, compared to wild-type rice, the transgenic rice lines OE7 and OE10 exhibit increased grain length, grain thickness, and thousand-grain weight by 5.8% and 5.6%, 5.7% and 5.7%, and 7.1% and 7.3%, respectively. Furthermore, the panicle length and number of grains per plant are significantly increased, by 14.2% and 13.8%, 12.1%, and 11.7%, respectively.

[0027] In any of the above embodiments, steps (1)-(3) of the method for obtaining the rice OsRAV9 gene mutant are also included.

[0028] Technical effect

[0029] 1. This invention is the first to demonstrate, through gene editing technology, that mutations in the rice OsRAV9 gene will lead to the loss of protein function of this gene in rice, and proves that this mutation seriously affects rice grain formation and traits such as panicle length and number of grains per plant in overexpressing lines.

[0030] 2. Based on this, this invention, for the first time, constructed an overexpression vector using Gateway technology, creating and obtaining OsRAV9 (LOC4325479) overexpression transgenic material. DNA and RNA level identification revealed five positive lines. Simultaneously, loss-of-function mutants were created and obtained using CRISPR-Cas9 gene editing technology. DNA sequencing analysis revealed a T deletion at position 144 of the coding region in the mutant, leading to a frameshift in protein translation and resulting in the deletion of both the AP2 and B3 domains.

[0031] 3. Through agronomic trait surveys, this invention found that, compared to the wild type, the mutant osrav9 exhibited decreased grain thickness, grain width, and thousand-grain weight by 4.9%, 5.7%, and 4.9%, respectively, while the OsRAV9-OE7 and OE10 showed increased grain length, grain thickness, and thousand-grain weight by 5.8% and 5.6%, 5.7% and 5.7%, and 7.1% and 7.3%, respectively (see [link to relevant documentation]). Figure 6-7 Furthermore, the spike length and number of grains per plant in OsRAV9 overexpression lines were significantly increased, by 14.2% and 13.8%, and 12.1% and 11.7%, respectively (see [link to original text]). Figure 6-7 The above results indicate that the OsRAV9 gene plays an important regulatory role in rice grain formation.

[0032] 4. Based on the above research and findings, this invention has significant theoretical value for elucidating the mechanisms regulating seed development, and it can also improve rice grain shape through transgenic methods, which is of great significance in production practice. For example, overexpression of the rice transcription factor OsRAV9 has important application value in improving rice grain traits, thousand-grain weight, or final rice yield. Attached Figure Description

[0033] Figure 1 Analysis of OsRAV9 tissue expression characteristics. A: Relative expression level of OsRAV9 in various tissues and organs during the seedling stage; B: Relative expression level of OsRAV9 in various tissues and organs during the flowering stage; Error bar: Standard deviation; T-test was performed using a two-tailed test; **Extremely significant difference (P<0.01)**

[0034] Figure 2 Schematic diagram of the gene editing vector pHUN4c12.

[0035] Figure 3 Identification of osrav9 mutant plants. A: Sequence alignment; B: Premature termination of protein translation.

[0036] Figure 4 Schematic diagram of OsRAV9 overexpression vector pGWB512.

[0037] Figure 5Identification of OsRAV9 overexpressing transgenic plants. A: OsRAV9 gene amplification results; B: DNA level identification of overexpressing transgenic plants; C: RNA level identification of overexpressing transgenic lines; Error bar: standard deviation; T-test using two-tailed test; **Extremely significant difference (P<0.01).

[0038] Figure 6 A: Grain length; B: Grain width; C: Grain thickness; D: Ear length; E: Number of grains per plant.

[0039] Figure 7 Agronomic trait data of osrav9 mutant and OsRAV9 overexpression transgenic materials. Error bar: standard deviation; T-test used two-tailed test; *significant difference (P<0.05); **extremely significant difference (P<0.01). Detailed Implementation

[0040] The present invention will be further illustrated by examples, but it is not limited to any one of these examples or similar instances.

[0041] Example 1. Construction of OsRAV9 gene editing vector

[0042] Created via Agrobacterium infection. A sgRNA (i.e., PAM sequence, SEQ ID NO:4: CCGGTGG TGGCGGTGGCGGCGGCGGCTCAACAGCTACCGGTGGTGAAGGGAGTTGACTCGGCGGATGAGGTGG TGACGTCGAG) was designed using a DNA sequence specific to its nucleotide sequence (as shown in SEQ ID NO:1). Two oligo DNA primers (SEQ ID NO:6, LP: GTGGTCAG CTTCTCCTCGAC, SEQ ID NO:7, RP: AGCAGGTCGTCGCGGTACAAG) were then synthesized. After annealing the synthesized primers, they were ligated into the pHUN4c12 vector digested with BsaI to obtain the OsRAV9 gene editing vector PHUN4c12-PAM (e.g., ...). Figure 2As shown, the pHUN4c12 vector, developed by the research team of Zhejiang University, is a gene editing vector based on the CRISPR / Cas9 system. It is commonly used for gene function research and genetic improvement in plants such as rice (Xu et al., 2014, Rice (NY), 7(1):5). The PHUN4c12-PAM vector was transformed into rice Zhonghua 11 through transgenic technology. The sgRNA-mediated Cas9 nuclease was used to specifically recognize and target the target site, and the mutation was introduced by the intracellular error-prone repair mechanism, finally obtaining gene-edited rice material with OsRAV9 gene mutation.

[0043] Example 2. Creation of OsRAV9 gene-edited rice materials

[0044] The method for creating OsRAV9 gene-edited rice using Agrobacterium-mediated infection is as follows:

[0045] 1) Induction and subculture of rice embryo callus: Rice seeds of variety Zhonghua 11 were dehulled, soaked in 75% ethanol for 1 min, then soaked in sodium hypochlorite solution for 30 min, rinsed with sterile water, and repeatedly soaked in sodium hypochlorite for 15 min, then rinsed with sterile water. The sterilized rice seeds were air-dried on sterile filter paper and planted in induction medium. Incubation was carried out in the dark at 28℃ for 2 weeks. Callus tissue was isolated and transferred to induction medium, subcultured 3 times at 28℃. Light yellow, loosely textured callus particles were selected and incubated in the dark at 28℃ for 3 days.

[0046] 2) Activation and propagation of strains: Agrobacterium containing the gene editing vector pHUN4c12-PAM was streaked on YEB solid medium for 2 days at 28℃.

[0047] 3) Co-culture of Agrobacterium and callus: Take an appropriate amount of bacterial cells and suspend them in 100 μM AS+AA liquid medium. When the OD value of the bacterial solution reaches 0.3, immerse the callus in the bacterial solution and gently shake for 20 minutes. Discard the bacterial solution, remove the callus, filter out the excess bacterial solution, and transfer it to NB solid medium for dark incubation at 22℃ for 3 days.

[0048] 4) Screening for resistant callus: Select co-cultured callus tissue, rinse with sterile water, filter dry, and spread on screening medium. Incubate in the dark at 28°C for 2 weeks, and then subculture once.

[0049] 5) Predifferentiation and differentiation: Select vigorous, milky-white callus tissue and transfer it to predifferentiation medium. Culture in the dark at 28°C for 1 week, then culture in the light at 28°C for 2 weeks. Subculture once more, and after 4 weeks, it will differentiate into seedlings.

[0050] 6) Rooting and seedling strengthening: Transfer the seedlings with better growth to the rooting medium and transplant them after 2 weeks of cultivation.

[0051] 7) Transplant normally growing transgenic seedlings to a greenhouse for cultivation until seed harvest.

[0052] 8) Seedlings of the obtained transgenic positive plants were used to obtain T1 and higher generation seeds through multiple generations.

[0053] Example 3. DNA sequence mutation analysis of OsRAV9 in gene-edited materials

[0054] 1. Extraction of DNA from OsRAV9 gene-edited rice materials using the CTAB method

[0055] 1. Preparation of CTAB solution: Weigh 16.7g of CTAB and 68.4g of NaCl and dissolve them in ddH2O. Then add 83.5mL of 1M Tris-HCl (pH 8.0) and 33.4mL of 0.5M EDTA, and bring the volume to 1L. Autoclave at 121℃ for 15min and store at room temperature for later use.

[0056] 2. Take 0.1g of fresh rice leaves and put them into a 2mL EP tube containing steel balls. After freezing in liquid nitrogen for 20min, crush them into powder using a Geno / Grinder mill.

[0057] 3. Add 800 μL of CTAB extraction solution to each centrifuge tube, shake well, and place in a 65°C water bath for 45 min, gently mixing 1-2 times every 10 min.

[0058] 4. After the sample has been cooled to room temperature, remove it from the water bath and add 400 μL of chloroform / isoamyl alcohol (v / v = 24:1) extraction buffer to each centrifuge tube. Gently invert to mix and let it stand at room temperature for 30 min for extraction.

[0059] 5. Centrifuge at 12000 rpm at room temperature for 10 min, aspirate the supernatant and transfer it to a new 1.5 mL EP tube, add 700 μL of pre-cooled isopropanol, gently invert and mix, and precipitate at -20 °C for at least 20 min.

[0060] 6. After DNA precipitation, centrifuge at 12000 rpm at 4℃ for 10 min, discard the supernatant, and wash with 700 μL of 75% ethanol;

[0061] 7. Centrifuge at 12000 rpm for 5 min at 4℃, discard the supernatant, and dry in a clean bench;

[0062] 8. Add 100 μL of sterile RNase water to dissolve the precipitate, and place it in a 37℃ oven for digestion for 1-2 hours;

[0063] 9. DNA quality was determined by agarose gel electrophoresis and stored at -20℃ for later use.

[0064] 2. PCR amplification and sequence analysis of gene-edited rice genomic DNA

[0065] Synthesize OsRAV9 primers (SEQ ID NO:8, OsRAV9-F:ATGGGGGTGGTCAGCTTCTC);

[0066] SEQ ID NO:9, OsRAV9-R:GTAGGTGTGCTTCCGGAGCA), using DNA from different gene-edited strains as templates for PCR amplification, the PCR product (1098 bp in size) was sequenced. After sequencing, the DNA sequence was compared with that of OsRAV9 in the NCBI Genome Database. Analysis revealed that all gene-edited OsRAV9 strains exhibited a deletion at position 144 in their coding region. Figure 3 A) This resulted in a frameshift mutation in the gene, thus successfully obtaining gene-edited rice material with the mutated gene. The gene sequence of the mutant osrav9 is shown in SEQ ID NO 5.

[0067] The sequencing primers used for the vector pHUN4C12 are as follows:

[0068] pHUN4C12-F:AAATGCTGGAAGCCGGGAACAC

[0069] pHUN4C12-R: CCCTTCACCGTCAGATGCTACTAC.

[0070] Example 4. Protein sequence mutation analysis of OsRAV9 in gene-edited materials

[0071] Based on the comparison analysis of the corresponding protein sequence according to the mutated DNA sequence, it was found that osrav9 is caused by a deletion of the base T at position 144 of the OsRAV9 gene DNA sequence. Figure 3 A, as shown in SEQ ID NO:5 (* indicates the missing base T), results in a frameshift mutation at amino acid 49 in the OsRAV9 protein, and premature translation termination at amino acid 54 due to the frameshift, leading to the complete loss of the AP2 and B3 domains. Figure 3 B) indicates that gene editing resulted in the loss of protein function of this gene in rice. ZH11 represents the DNA sequence of the wild-type material OsRAV9 in the NCBI database, and osrav9 represents the DNA sequence of this gene in the gene-edited mutant.

[0072] Example 5. Creation of OsRAV9 gene overexpression materials

[0073] 1) Construction of the overexpression vector pGWB512-OsRAV9

[0074] Using the total cDNA of rice ZH11 obtained above as a template, PCR primers were designed. The primer sequences are as follows:

[0075] OsRAV9-CDS-F: 5'-ATGCTCATCCGGAATTCATGGGGGTGGTCAGCTT-3' (SEQ ID NO.10)

[0076] OsRAV9-CDS-R: 5'-CAGTCACTATGGTCGACTAACAGCAGGGCACCTA-3'; (SEQ ID NO. 11)

[0077] The PCR procedure was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 59℃ annealing, 72℃ annealing and extension for 1 min, 35 cycles, followed by 72℃ annealing and extension for 5 min. The amplified PCR product was detected by 1% agarose gel electrophoresis, and its size was 1129 bp. Figure 5 -A); The plant overexpression vector pGWB512 plasmid was digested with EcoRI and SalI, the previously cloned target fragment was purified, and ligated into the intermediate vector QVB3. The fragment was then recombined with pGWB512 using the LR reaction and transformed into *E. coli* DH5α competent cells. After growing on LB solid medium containing 100 μg m / L spectinomycin for 12 h, positive colonies were picked. The plasmid was extracted, and after EcoRI and SalI digestion to verify the fragment size, the bacterial culture was sequenced. The bacterial culture containing the correctly sequenced clone was added to an equal volume of 30% glycerol and stored at -70℃. The positive clone plasmid was extracted and named pGWB512-OsRAV9( Figure 4 ).

[0078] 2) Obtaining transgenic plants

[0079] The pGWB512-OsRAV9 plasmid obtained above was transferred into Agrobacterium and used to infect rice callus tissue. After culturing for 2.5 days, T0 generation transgenic plants were obtained through the culture, differentiation, rooting, and hardening of resistant callus tissue. To avoid changes in plant traits caused by cytoplasmic chimerism due to non-genomic insertions, we propagated all transgenic materials multiple times to obtain stably inherited materials.

[0080] Callus induction: Peeled rice ZH11 seeds (14 seeds per tray) were placed in an Erlenmeyer flask and soaked in 70% ethanol for 1 minute (enough to submerge the seeds). The 70% ethanol was then discarded, and the seeds were soaked in 30% sodium hypochlorite for 30 minutes. The flasks were then rinsed 5-6 times with sterile water until clear. The seeds were transferred to sterile filter paper with tweezers to absorb excess moisture. Finally, the seeds were placed on the induction medium and cultured in a 30℃ light incubator for 20-30 days.

[0081] Subculture: Select small, yellow, tough, detached callus tissue (about the size of a millet grain) and transfer it to subculture medium using sterile forceps for 7-14 days of growth.

[0082] Preparation of Agrobacterium: Pick 20 μL of Agrobacterium EHA105 stock solution transformed with pGWB512-OsRAV9 plasmid and inoculate it into 5 mL of YEP liquid medium containing 50 mg / L streptomycin and 50 mg / L spectinomycin. Incubate overnight at 28°C with shaking. Take 500 μL of activated bacterial solution and inoculate it into 5 mL of fresh YEP medium containing the same antibiotics. Continue to culture until the absorbance (OD600) of the bacterial solution at 600 nm is 0.8-1.0.

[0083] Infection and co-culture of callus: Pick rice callus from the subculture medium and place it in a centrifuge tube, ensuring the amount of callus covers the conical part of the 50mL centrifuge tube (select pale yellow, round, and resilient callus). Take 1mL of the cultured bacterial suspension into a 1.5mL centrifuge tube, centrifuge at 5000rpm for 1min at 4℃, and discard the supernatant. Prepare a suspension of the collected bacteria using 30mL of inoculum containing 200μmol / L acetylsylgenone (As). Pour this suspension into the picked callus and infect for 5min. Discard the liquid, remove the callus, and place it on a sterile culture dish lined with absorbent paper to drain for 30-40min. Place the callus on a co-culture medium (with a 9cm layer of sterile filter paper on top) and incubate in the dark at 25℃ for 60 hours.

[0084] Bacterial washing and antibiotic screening culture: The callus tissue was removed from the co-culture medium and rinsed 5 times with sterile water, shaking continuously for 5 minutes each time. Then it was soaked in sterile water containing 500 mg / L carbenicillin (CAR) for 40–60 minutes. Finally, it was placed on sterile filter paper to drain for 2 hours. First round of screening: The dried callus tissue was transferred to a selective medium containing 250 mg / L carbenicillin (CAR) and 50 mg / L hygromycin (Hyg) for the first selection, and cultured at 30°C under light for 14 days. Second round of screening: Initial callus tissue with resistant callus tissue was transferred to a selective medium containing 250 mg / L carbenicillin (CAR) and 80 mg / L hygromycin (Hyg), cultured at 30°C under light for 10 days, and then transferred to a tissue culture room for 4 days.

[0085] Induction and rooting of resistant callus: Select bright yellow resistant callus and transfer it into a differentiation pot containing differentiation medium. Place it in a constant temperature culture room and wait for it to differentiate into seedlings (about 30 days, culture conditions in the tissue culture room are 24-30℃, 14h light / 8h dark). When the seedlings grow to about 5cm, place them in a rooting medium to strengthen them.

[0086] Hardening and transplanting of transgenic seedlings: Select test tubes with well-differentiated roots and stems (open the cap in time when the seedlings grow to the top of the test tube), open the sealing film, add an appropriate amount of sterile water (to prevent bacterial growth on the culture medium), harden the seedlings for about 3-7 days, then wash off the agar and transplant them to a greenhouse for hydroponic or soil culture for growth and testing.

[0087] Hygromycin was used to rapidly detect T0 generation plants from transgenic seedlings: Fresh green leaves, approximately 1 cm long, were cut and collected from the seedlings to be tested (with cut ends). These leaves were placed flat on a medium containing hygromycin (80 mg / L) and incubated at 30°C for 16 h / 8 h (light / dark) for 48 h. Plants whose leaves remained bright green after this incubation were considered positive, while negative seedlings showed patchy necrosis of the leaves. Ten positive T0 lines were obtained through hygromycin screening.

[0088] Molecular identification of OsRAV9 overexpression lines: T1 transgenic seedlings were obtained after germination of T0 generation seeds. The OsRAV9-0E transgenic materials were identified at both the DNA and RNA levels. DNA level identification results showed that the primers in Table 2-2 amplified specific bands, and sequencing confirmed their correctness. Figure 5 -B), OE1, OE3, OE4, OE7, and OE10 were all positive plants. RNA level identification results showed that, compared with the wild type, the expression level of OsRAV9 in the overexpression transgenic lines was significantly increased, with the most significant increase in expression levels in lines OE7 and OE10. Figure 5 C).

[0089] The primers used for DNA-level identification of overexpression-positive lines are as follows:

[0090] pGWB-F:ACAAGTTTGTACAAAAAAGCAGGCT

[0091] pGWB-R:ACCACTTTGTACAAGAAAGCTGGGT

[0092] Example 6. Expression characteristics of OsRAV9 in rice

[0093] 1) Extraction of total RNA

[0094] After germination, rice ZH11 seeds were cultured to the two-leaf-one-heart stage. Uniformly sized rice plants were selected, and leaves were quickly placed in liquid nitrogen for cryopreservation. Approximately 0.1g of sample was weighed, ground thoroughly with liquid nitrogen, and added to a 1.5mL centrifuge tube. 1mL of Trizol reagent and 0.2mL of chloroform were added, followed by centrifugation. The supernatant was collected, and 0.5mL of isopropanol was added. After centrifugation, the supernatant was discarded. The precipitate was washed with 70% ethanol. RNA was dissolved in DEPC water (1% by volume), and RNA quality was detected by 1% agarose gel electrophoresis. The concentration and purity of total RNA were determined using a spectrophotometer. Rice samples from other growth stages were collected as needed and quickly placed in liquid nitrogen for preservation, with the remaining steps consistent with the above.

[0095] 2) Total cDNA synthesis

[0096] Dissolve 2 μg of RNA sample in 10 μL of DEPC water, then add 4 μL of 4×g DNA wiper Mix and Oligo dT. 23 Add 1 μL of VN (50 μM) and 1 μL of Random hexamers (50 ng / μL), mix well, and react at 42 °C for 2 min. Then add 2 μL of 10×RT Mix to the resulting mixture. II. Mix 2 μL of Enzyme Mix, incubate at 25°C for 5 min, 50°C for 15 min, and 85°C for 2 min, then store at 4°C (HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper)).

[0097] 3) Quantitative PCR

[0098] After reverse transcription to synthesize the first strand of total cDNA, it was used as a template for PCR amplification. Reaction procedure: The cDNA amplification reaction of various rice tissues was carried out in a 96-well PCR plate. The reaction system was 20 μl: 10 μL SYBR Mix (2x), 1 μL each of forward and reverse primers, 1 μL cDNA template, and 8 μL sterile water, for a total volume of 20 μL. The mixture was thoroughly mixed and then dispensed into the PCR plate. The reaction conditions were as follows: 95℃ for 5 s, 94℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles, followed by a 72℃ extension for 5 min. The housekeeping gene OsActin was used as an internal control. The results were calculated using double ΔΔCt values.

[0099] The internal control primers required for quantitative fluorescence analysis are as follows:

[0100] OsActin-F:GGCATTGCTGACAGGATGAG;

[0101] OsActin-R: GCTTAGCATTCTTGGGTCCG.

[0102] The primers used for detecting OsRAV9 gene expression are as follows:

[0103] OsRAV9-qPCR-F: ACGAGAGGCCAACCACAAG;

[0104] OsRAV9-qPCR-R:TACGCTGATGAACCACGCAT.

[0105] Example 7. Analysis of productive traits of overexpression-positive plants

[0106] 1) Grain trait measurement

[0107] To investigate whether the OsRAV9 mutation affects rice growth and development, wild-type, osrav9, and...

[0108] Some agronomic traits of OsRAV9 overexpression materials were investigated. Plump kernels from each material were randomly selected, and the length (straight-line distance between the two vertices of the kernel), width (straight-line distance at the widest point of the kernel), and thickness (straight-line distance at the thickest point of the kernel) of each kernel were measured using a digital vernier caliper with an accuracy of 0.01 mm. Twenty kernels were measured for each material each time, and the total length, width, and thickness of the 20 kernels were calculated, with the average value of each kernel being taken. This measurement was repeated 10 times, and the average of the 10 sets of average values ​​was used as the representative values ​​for the kernel length, width, and thickness of that material.

[0109] The thousand-grain weight was measured using an electronic balance with an accuracy of 0.001g. 1000 plump grains were randomly selected from each material and weighed. The measurements were repeated 10 times, and the average value was taken as the thousand-grain weight.

[0110] 2) Measurement of agronomic traits

[0111] Ten plants of each material were randomly selected (ensuring consistent growing conditions), and mature panicles were harvested from the field. The panicle length (the straight-line distance from the panicle neck node to the top of the panicle, excluding awns) was measured using a ruler with an accuracy of 0.1 cm. The yield per plant was calculated as follows: the total number of plump grains (excluding empty and shriveled grains) on all effective panicles of a single plant was counted, and then multiplied by the average weight of a single grain of that material (converted from the thousand-grain weight, i.e., thousand-grain weight / 1000) to obtain the total weight of grains per plant (unit: g).

[0112] All measurement data were judged as significantly different with P < 0.05 (marked as "*") and highly significantly different with P < 0.01 (marked as "**").

[0113] The analysis results showed that, compared with the wild type, the osrav9 mutant had decreased grain thickness, grain width, and thousand-grain weight by 4.9%, 5.7%, and 4.9%, respectively, while the OsRAV9-OE7 and OE10 mutants had increased grain length, grain thickness, and thousand-grain weight by 5.8% and 5.6%, 5.7% and 5.7%, and 7.1% and 7.3%, respectively (see [link to analysis]). Figure 6-7 Furthermore, the spike length and number of grains per plant in OsRAV9 overexpression lines were significantly increased, by 14.2% and 13.8%, and 12.1% and 11.7%, respectively (see [link to original text]). Figure 6-7 ).

[0114] This invention provides the first discovery that the OsRAV9 gene regulates rice grain traits and thousand-grain weight. Overexpression of this gene in rice significantly promotes grain length and thickness. Since increased grain length and thickness are generally the basis for increased thousand-grain weight (larger grain volume usually means heavier grains), the combined effect of increased grain length and thickness, increased thousand-grain weight, and increased number of grains per plant can significantly increase yield per plant, and thus has the potential to substantially increase the total rice yield per unit area. The synergistic improvement of these traits is a core goal continuously pursued by rice breeders and producers, and it has irreplaceable strategic significance for ensuring global and regional food security, promoting sustainable agricultural development, and improving farmers' well-being. Furthermore, a deeper understanding of the molecular mechanisms by which the OsRAV9 gene regulates grain size helps to reveal the mysteries of the gene expression regulatory network during rice grain formation, and is also an important manifestation of the strategy of "storing grain in the land and storing grain in technology."

Claims

1. A method for overexpressing [a specific ingredient] in rice plants using Gateway technology. OsRAV9 A method for obtaining rice materials or varieties with enhanced grain traits through gene acquisition, characterized in that, The steps of the method include: (I) Extraction of total RNA from rice; (II) Reverse transcription of total RNA from step (I) yields cDNA; (III) Using the cDNA from step (II) as a template, design PCR primers and amplify the cDNA. OsRAV9 The gene sequence was obtained, and the amplified product was then ligated into a vector and introduced into competent cells. The obtained positive clones were used to extract the plasmid pGWB512-OsRAV9, which was then transformed into Agrobacterium. (IV) Obtained through Agrobacterium-mediated genetic transformation OsRAV9 Transgenic rice lines with overexpressed genes; The PCR primers in step (III) are as shown in SEQ ID NO:10-11, and the target fragment of the amplification product is 1098bp. The primer shown in SEQ ID NO:10 is: ATGCTCATCCGGAATTCATGGGGGGTGGTCAGCTT; The primer shown in SEQ ID NO:11 is: CAGTCACTATGGTCGACTAACAGCAGGGCACCTA; The grain characteristics are grain length, grain thickness, and thousand-grain weight.

2. The method according to claim 1, wherein the rice variety in step (I) is Zhonghua 11.

Images