Application of SNP genetic marker associated with egg laying feed intake in chicken genetic breeding

Abstract

The application provides application of a SNP genetic marker related to feed intake during the egg laying period in a LARGE gene in chicken genetic breeding, and belongs to the field of animal genetic breeding and biotechnology.The SNP genetic marker related to the feed intake during the egg laying period in the LARGE gene comprises FI_chr1_1 and / or FI_chr1_2; the FI_chr1_1 is numbered as rs312566702, corresponds to the sequence information of the 52729473th position of the 1st chromosome of a chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belongs to the 1st intron sequence of the LARGE gene, and the base here is G or A; the FI_chr1_2 is numbered as rs316368983, corresponds to the sequence information of the 52625267th position of the 1st chromosome of a chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belongs to the upstream sequence of the LARGE gene, and the base here is T or C.The SNP genetic marker related to the feed intake during the egg laying period in the LARGE gene is helpful for breeding chicken varieties with high feed utilization efficiency, and the purpose of improving the chicken raising income is achieved by reducing the feed intake.

Description

Technical Field

[0001] This invention belongs to the fields of animal genetics and breeding and biotechnology, and specifically relates to the application of SNP genetic markers in the LARGE gene that are related to feed intake during the egg-laying period in chicken genetics and breeding. Background Technology

[0002] Feed intake during the laying period is crucial to the profitability of egg-laying hen farming, animal welfare, and the sustainable development of chicken production. In recent years, competition between humans and livestock for food has raised concerns about food security, reflecting a new direction in egg-laying hen genetic breeding research: "how to reduce feed intake while maintaining existing egg production performance." From a genetic breeding perspective, reducing feed intake while improving production performance is a sustainable breeding path because genetic progress is both permanent and cumulative. Based on microsatellite sequence polymorphism and linkage analysis, several QTLs (quantitative trait loci) linked to feed intake have been published. However, due to the uneven distribution and limited number of microsatellite markers on the genome, the confidence intervals of QTLs for feed intake traits obtained through linkage analysis are often large, making them difficult to use in breeding practice. With advancements in sequencing technology, genome-wide association studies (GWAS) have opened up new perspectives for elucidating the genetic structure of feed intake during the laying period in chickens. Feed intake in chickens is a quantitative trait regulated by multiple genes with minor effects. Conventional breeding methods are unlikely to make effective progress in genetics. Only by clarifying the genetic structure of feed intake during the laying period and improving the accuracy of breeding through genomic selection can we obtain new chicken breeds or breeding lines that utilize feed efficiently and meet the needs of the egg-laying hen industry. Summary of the Invention

[0003] To address the problem of excessively high feed costs in chicken production, this invention provides the application of SNP genetic markers related to feed intake during the laying period in the LARGE gene in chicken genetic breeding. These SNP genetic markers related to feed intake during the laying period in the LARGE gene help to select chicken breeds that utilize feed efficiently, thereby increasing chicken farming profits by reducing feed intake.

[0004] This invention is achieved through the following technical solution: This invention provides the application of SNP genetic markers related to feed intake during the laying period in the LARGE gene in chicken genetic breeding, wherein the SNP genetic markers related to feed intake during the laying period in the LARGE gene include FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 sequence number is rs312566702, which corresponds to the sequence information of chromosome 1, position 52729473, of the bGalGal1.mat.broiler.GRCg7b version of the chicken reference genome published in NCBI. It belongs to the first intron sequence of the LARGE gene, and the base here is G or A. The FI_chr1_2 sequence number is rs316368983, which corresponds to the sequence information of chromosome 1, position 52625267, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of the LARGE gene, and the bases here are T or C.

[0005] Based on the same inventive concept, the present invention provides an early selection method for feed intake traits during the laying period of chickens, the early selection method comprising early selection of feed intake traits during the laying period of chickens based on the genotypes of SNP genetic markers FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 sequence number is rs312566702, which corresponds to the sequence information of chromosome 1, position 52729473, of the bGalGal1.mat.broiler.GRCg7b version of the chicken reference genome published in NCBI. It belongs to the first intron sequence of the LARGE gene, and the base here is G or A. The FI_chr1_2 sequence number is rs316368983, which corresponds to the sequence information of chromosome 1, position 52625267, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of the LARGE gene, and the bases here are T or C.

[0006] Furthermore, the early selection method specifically includes: Detect the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested; Early selection of feed intake traits during the laying period of the test chickens based on the genotypes of FI_chr1_1 and / or FI_chr1_2; Among them, the AA genotype individuals of FI_chr1_1 have a greater feed intake during the egg-laying period than the GA genotype individuals, and the GA genotype individuals have a greater feed intake during the egg-laying period than the GG genotype individuals. The TT genotype individuals of FI_chr1_2 consumed more feed during the egg-laying period than the TC genotype individuals, and the TC genotype individuals consumed more feed during the egg-laying period than the CC genotype individuals.

[0007] Furthermore, the detection of the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested specifically includes: Detecting the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested, wherein the method for detecting the genotype of FI_chr1_1 in the genome of the chicken to be tested includes: Using P1_FI1f and P1_FI1r as primers, PCR amplification was performed on the chicken genomic DNA to be tested. The PCR amplification products were sequenced to obtain the genotype at position 52729473 on chromosome 1 of the chicken to be tested; Methods for detecting the genotype of FI_chr1_2 in the genome of the chicken to be tested include: Using P1_FI2f and P1_FI2r as primers, PCR amplification was performed on the chicken genomic DNA to be tested; The PCR amplification products were sequenced to obtain the genotype at position 52625267 on chromosome 1 of the chicken to be tested; The nucleotide sequence of P1_FI1f is shown in SEQ ID NO.1, the nucleotide sequence of P1_FI1r is shown in SEQ ID NO.2, the nucleotide sequence of P1_FI2f is shown in SEQ ID NO.3, and the nucleotide sequence of P1_FI2r is shown in SEQ ID NO.4.

[0008] Preferably, the breed of chicken to be tested includes Dongxiang green-shelled chicken and / or White Leghorn chicken.

[0009] Based on the same inventive concept, this invention provides the application of primers for detecting SNP genetic markers related to feed intake during the laying period in chicken genetic breeding. The primers for detecting SNP genetic markers related to feed intake during the laying period in the LARGE gene include primers for detecting FI_chr1_1 and / or primers for detecting FI_chr1_2. The primers for detecting FI_chr1_1 include P1_FI1f and P1_FI1r, and the primers for detecting FI_chr1_2 include P1_FI2f and P1_FI2r; The nucleotide sequence of P1_FI1f is shown in SEQ ID NO.1, the nucleotide sequence of P1_FI1r is shown in SEQ ID NO.2, the nucleotide sequence of P1_FI2f is shown in SEQ ID NO.3, and the nucleotide sequence of P1_FI2r is shown in SEQ ID NO.4.

[0010] Based on the same inventive concept, the present invention provides a kit for detecting SNP genetic markers related to feed intake during the egg-laying period in the LARGE gene, the kit comprising primers for detecting FI_chr1_1 and / or primers for detecting FI_chr1_2; The primers for detecting FI_chr1_1 include P1_FI1f and P1_FI1r, and the primers for detecting FI_chr1_2 include P1_FI2f and P1_FI2r; The nucleotide sequence of P1_FI1f is shown in SEQ ID NO.1, the nucleotide sequence of P1_FI1r is shown in SEQ ID NO.2, the nucleotide sequence of P1_FI2f is shown in SEQ ID NO.3, and the nucleotide sequence of P1_FI2r is shown in SEQ ID NO.4.

[0011] Based on the same inventive concept, this invention also provides a kit for detecting SNP genetic markers in the LARGE gene that are related to feed intake during the egg-laying period, and its application in chicken genetic breeding.

[0012] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention relates to the application of SNP genetic markers related to feed intake during the laying period in the LARGE gene in chicken genetic breeding. The SNP genetic markers related to feed intake during the laying period in the LARGE gene are FI_chr1_1 and FI_chr1_2. Favorable genotype populations of FI_chr1_1 and FI_chr1_2 have lower average feed intake during the laying period, which helps to genetically reduce feed intake during the laying period. Applying these SNP genetic markers to chicken genetic breeding is beneficial for obtaining chicken breeds with higher feed utilization efficiency. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 Manhattan plot of GWAS analysis of bi-weekly feed intake during the egg-laying period of the resource population in Embodiment 2 of the present invention; Figure 2 This is a GWAS analysis QQ plot of feed intake during the egg-laying period of the resource population in Embodiment 2 of the present invention. Figure 3 This invention provides an association analysis between the FI_chr1_1 genetic marker genotype and feed intake. Figure 4 This invention provides an association analysis between the FI_chr1_2 genetic marker genotype and feed intake. Detailed Implementation

[0015] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0016] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0017] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0018] The overall concept of this invention is as follows: Feed intake is a quantitative trait regulated by multiple genes with minor effects, influenced by numerous factors including genetic, environmental, nutritional, and behavioral factors. Clarifying the distribution of genes controlling feed intake across the genome and the effect sizes of relevant loci will be beneficial for breeding low-feed-in-laying chickens. Based on microsatellite sequence polymorphism and linkage analysis, various research teams both domestically and internationally have reported several QTLs linked to feed intake. However, due to the uneven distribution and limited number of microsatellite markers on the genome, the confidence intervals for QTLs of laying trait obtained through linkage analysis are often large, making them difficult to apply in breeding practice.

[0019] With the reduction in sequencing costs and the development of computing technology, genome-wide association studies (GWAS) have become a powerful tool for elucidating the genetic structure of quantitative traits in livestock and poultry. Using GWAS to study the association between base variations and phenotypic values ​​can identify genetic markers affecting economic traits, and is particularly suitable for traits that are difficult to measure, late-life traits, sex-limited traits, and slaughter traits. If genome-wide association studies can screen for genetic markers of feed intake during egg production in chickens, it will facilitate rapid acquisition of genetic progress through marker-assisted breeding or genome-wide selection.

[0020] Based on this, this invention integrates a bitrait animal model with GWAS analysis, fully leveraging the advantages of a mixed linear model to screen for genetic markers FI_chr1_1 and FI_chr1_2 associated with feed intake. In this invention's SNP screening method, the bitrait animal model can mutually correct each other, improving the accuracy of the screening results; GWAS analysis offers advantages in high throughput, high density, and high efficiency; and the mixed linear model has advantages in resolving population stratification. Individuals with the favorable genotypes of FI_chr1_1 and FI_chr1_2 have lower feed intake, which helps to genetically reduce feed intake during the egg-laying period.

[0021] The following will provide a detailed explanation of the application of SNP genetic markers related to feed intake during the egg-laying period in the LARGE gene of this application in chicken genetic breeding, in conjunction with examples and experimental data.

[0022] Example 1 Resource population construction and data processing of feed intake during the egg-laying period Feed intake data during the laying period were collected from the laying hen population of Jiangsu Provincial Institute of Poultry Science. For details on population construction, please refer to the literature already published by our research team (Guo Jun et al. Analysis of genetic parameters of egg yolk quality using random regression model [J]. Journal of Nanjing Agricultural University, 2016, 39(1): 145-149.). In short, Dongxiang green-shelled chickens and white Leghorn chickens were used as parents, and F1 and F2 generations were obtained through reciprocal crosses. The experimental chickens were housed individually in traditional A-type cages, cooled by fans and evaporative cooling pads, and fed and cleaned mechanically. Feed was supplied by COFCO, and the feed composition for laying hens included 16.5% crude protein and 11,511 kJ / kg metabolizable energy. During the laying period, chickens had free access to feed and were provided with water via nipple drinkers. Routine immunization was performed according to the immunization program established by Jiangsu Provincial Institute of Poultry Science. Feed intake data were collected from F2 generation experimental chickens at 57 to 60 weeks of age. During the trial, feed consumption was measured weekly and body weight was measured every four weeks.

[0023] After initial screening of pedigree records and production data to remove obvious errors and duplicates, outliers were removed, and the data was organized into a tabular format. Following data cleaning, the feed intake dataset for the resource population contained 7142 records from 1786 chickens. Then, WOMBAT software was used to analyze the covariance components of feed intake and genetic parameters.

[0024] Example 2 GWAS analysis of feed intake during egg production Approximately 2 ml of blood was collected from the wing vein of experimental chickens using a disposable syringe, placed in an EDTA anticoagulant tube, and stored at -70 ℃. Genomic DNA was extracted from the blood sample, and detected by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry. After passing the tests, the DNA sample was diluted to 50±5 ng / μl for gene chip typing.

[0025] Genotyping was performed using the Affymetrix® Axiom® 600K Chicken Genotyping Array from Affymetrix. Data quality control was performed according to the array's instruction manual, including: pre-genotyping quality control using APT software; PLINK quality control to remove SNPs with a detection rate below 0.97 and those deviating from Hardy-Weinberg equilibrium; SNP screening using metrics.R, SNP_filter.R, and SNP, CR, and FLD information analysis; and genotyping using BEAGLE. After quality control, 435,867 SNPs and 1,512 samples remained for subsequent analysis.

[0026] Prior to genome-wide association analysis, multidimensional principal component analysis was performed to eliminate false positives. The first five principal components were added as covariate parameters to the genetic model, and the coop effect and body weight at 60 weeks of age were included as model fixation effects. Gemma software was used to analyze bi-weekly feed intake during the laying period using a two-trait model, and the p-values ​​for the significance tests of each SNP marker were obtained. The matrix expression of the linear model is as follows:

[0027] Where y represents the phenotypic value vector of the sample feed intake; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker; u is the random effects vector; and ε is the residual.

[0028] The independence test estimate for each SNP was calculated using the "simpleM" method in R scripts, yielding 59,308 independent markers. After Bonferroni correction, the genomic significance threshold was determined to be 8.43 × 10⁻⁶. -7 The suggested threshold for genome sequencing is 1.69 × 10⁻⁶. -5 GWAS analysis revealed the genetic markers FI_chr1_1 and FI_chr1_2 associated with feed intake during the egg-laying period (Table 1). Figure 1 It is known that significant genomic markers exist on chicken chromosome 1. Furthermore, significant genomic markers were also detected on chromosomes 24 and 27. (Appendix) Figure 2 The QQ graph was analyzed using GWAS, further validating the GWAS analysis results.

[0029] Table 1. SNP genetic markers associated with feed intake during egg production in chickens

[0030] Wherein: the physical location of the marker chromosome is referenced to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b).

[0031] Example 3 Detection and validation of genetic markers Candidate gene association analysis was performed on the Dongxiang Green-shelled Egg Chicken-Leihun Chicken resource population using the aforementioned SNP genetic markers. The specific steps are as follows: 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. Primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0032] Table 2. Amplification primers used to detect genetic markers of feed intake during egg production in chickens.

[0033] 2) Genomic DNA extraction: Genomic DNA was extracted from 1512 blood samples using the CTAB method. After passing the tests by UV spectrophotometer and agarose electrophoresis, PCR amplification was performed.

[0034] 3) PCR amplification process: ① Reaction system: The 10μl system includes 50ng of DNA template for identification, 10ng each of forward and reverse primers, 5μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0035] ②Reaction procedure: First, denature at 94℃ for 30s, anneal at 53.2℃ for 30s, extend at 72℃ for 30s, for a total of 5 cycles; then, denature at 94℃ for 30s, anneal at 53.2℃ for 30s, extend at 72℃ for 30s, for a total of 30 cycles; extend at 72℃ for 5min, and store at 4℃.

[0036] 4) The amplified product was sent to a sequencing company for sequence polymorphism detection. The nucleotide sequence of the amplified fragment is as follows: FI_chr1_1 ATCCAAGTCTATCAGTGTCTCTTGGTATATAATATTGTATTCCTTTGTTACGTTAGTACTGCAGAACCTGTTCTGATCTGTCACTAAGATGGGTATGAAACC[A / G]CAGTATGCAAAACTGAAGTATCAGCAATCTGCCCATTTACTTTGTATCCTCTTTTCCTGCTTCCTTCCATGAAACAGTGGTTGTTTACTTCTCGGCATATTAACATTTGTCAAGTGGTGCTAAATATTTTGCTTTCATTTAGAACTGAGTTTCATTCAAGATATTCTTGTTGTGGCCTATAGTTGGTGTGTGAATACTGGAGTTAATGCCCTGATTTTAAGAATCTTTGATTTCTTTTTAATTTTCTTCTTACTGGCAAGGTACAAAATTACAGATGTGTGATGTTTTGCTGTAGTTCCACAGCTCAGGAGTAGCTTTGTGGTGCAGACAAGAATTTGTACTC TAGAG ATGGCTTCACCGA FI_chr1_2 TCTTCTTGCTCTTGCTGACAATTCTGTCTTCCAATGAACTCTAATACTAGTAAGCTGTGCTTTCTTTAATGAGGTCTTTGAATCAAAGACAGGGAATGCTCATAAGAAATGCTTTTCACTCAGTATTTGGGTGACCTTCTGGGAATGTAAGATTGAGCTCTAGTGCTGCAGTATGTG CTCCAGGTCTCTCAGTAGTTATCACAGTGTCATGAAATCTGGTGCTTCACTTCTTTCTATGGGTTCCCGGAGCCTTGTGACTATTTGGGAATTGCAATTTGCACTAAAAGAAACCAATTCAGTTAACATCAGAACTAATAATGACTGTTTTTCTACTTAT TTACATTCTACATATGCCCTCTTTCCTCCTACACCTATTCAGCTTCTCCTCTGCATATCCCAACTCTTTCCCATGGTCCCTAGCTTCAGAGCTGTAATTGTGTGCTCTATAACATCTGTGGTTAGTTCAGCCCATGCTGAGAGCTCATGTGCTTATCTG GAAGCTATTCCTTCAGTGGCAATATTAATTCAAGGCTTTC[C / T]TTTTTACTCTGCTGCCAATTTTTGTGAAACTTGTCAGACCTTTGTAACTCTTCTGCCCTTTTGCTGACTCCAGTAGGATCAGCCAACTTGTTCAAGAAGGTCAGACAGGAAAAG GGATTGATGGACACAGGTT In the above sequences, [ ] indicates mutation sites, parentheses indicate allele variations, and the underlined parts at the beginning and end of the sequence indicate primer sequences.

[0037] 5) Association analysis: The genotypes of the subjects were obtained using the plink software, and a one-way ANOVA was performed on them and their bi-weekly feed intake during the laying period of 57-58 weeks.

[0038] The results of the association analysis between the genetic marker FI_chr1_1 and feed intake are as follows: Figure 3 As shown, the average feed intake during the egg-laying period was 1446.63±108.84 (AA genotype), 1440.10±105.64 (GA genotype), and 1424.17±112.99 (GG genotype).

[0039] The results of the association analysis between the genetic marker FI_chr1_2 and feed intake are as follows: Figure 4As shown, the average feed intake during the egg-laying period was 1448.03±107.87 (TT genotype), 1440.43±105.68 (TC genotype), and 1422.49±113.25 (CC genotype).

[0040] In summary, GG is the favorable genotype of genetic marker FI_chr1_1, and CC is the favorable genotype of genetic marker FI_chr1_2.

[0041] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0042] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0043] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a reagent for detecting SNP genetic markers related to feed intake during the egg-laying period in the LARGE gene in chicken genetic breeding, characterized by: The SNP genetic markers in the LARGE gene that are related to feed intake during the egg-laying period include FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 sequence number is rs312566702, which corresponds to the sequence information of chromosome 1, position 52729473, of the bGalGal1.mat.broiler.GRCg7b version of the chicken reference genome published in NCBI. It belongs to the first intron sequence of the LARGE gene, and the base here is G or A. The FI_chr1_2 is numbered rs316368983, which corresponds to the sequence information of chromosome 1, position 52625267, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of the LARGE gene, and the base here is T or C. The chicken genetic breeding mentioned above refers to the genetic breeding of chickens regarding the trait of feed intake during the egg-laying period; The AA genotype individuals of FI_chr1_1 had a higher feed intake during the egg-laying period than the GA genotype individuals, and the GA genotype individuals had a higher feed intake during the egg-laying period than the GG genotype individuals. The TT genotype individuals of FI_chr1_2 had a higher feed intake during the egg-laying period than the TC genotype individuals, and the TC genotype individuals had a higher feed intake during the egg-laying period than the CC genotype individuals. The breed of chickens mentioned are Dongxiang Green-shelled Egg Chickens and / or White Leghorn Chickens.

2. The application according to claim 1, characterized in that, The detection reagent includes primers for detecting FI_chr1_1 and / or primers for detecting FI_chr1_2; The primers for detecting FI_chr1_1 include P1_FI1f and P1_FI1r, and the primers for detecting FI_chr1_2 include P1_FI2f and P1_FI2r; The nucleotide sequence of P1_FI1f is shown in SEQ ID NO.1, the nucleotide sequence of P1_FI1r is shown in SEQ ID NO.2, the nucleotide sequence of P1_FI2f is shown in SEQ ID NO.3, and the nucleotide sequence of P1_FI2r is shown in SEQ ID NO.

4.

3. A method for early selection of feed intake traits during the egg-laying period of chickens, characterized in that, The early selection method includes early selection of feed intake traits during the laying period of chickens based on the genotypes of SNP genetic markers FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 sequence number is rs312566702, which corresponds to the sequence information of chromosome 1, position 52729473, of the bGalGal1.mat.broiler.GRCg7b version of the chicken reference genome published in NCBI. It belongs to the first intron sequence of the LARGE gene, and the base here is G or A. The FI_chr1_2 is numbered rs316368983, which corresponds to the sequence information of chromosome 1, position 52625267, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of the LARGE gene, and the base here is T or C. Among them, the AA genotype individuals of FI_chr1_1 have a greater feed intake during the egg-laying period than the GA genotype individuals, and the GA genotype individuals have a greater feed intake during the egg-laying period than the GG genotype individuals. The TT genotype individuals of FI_chr1_2 had a higher feed intake during the egg-laying period than the TC genotype individuals, and the TC genotype individuals had a higher feed intake during the egg-laying period than the CC genotype individuals. The breed of chickens mentioned are Dongxiang Green-shelled Egg Chickens and / or White Leghorn Chickens.

4. The method for early selection of feed intake traits during the egg-laying period of chickens according to claim 3, characterized in that, The early selection method specifically includes: Detect the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested; Early selection of feed intake traits during the laying period of the test chickens is carried out based on the genotypes of FI_chr1_1 and / or FI_chr1_2.

5. The method for early selection of feed intake traits during the egg-laying period of chickens according to claim 4, characterized in that, The detection of the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested specifically includes: Detecting the genotypes of FI_chr1_1 and / or FI_chr1_2 in the genome of the chicken to be tested, wherein the method for detecting the genotype of FI_chr1_1 in the genome of the chicken to be tested includes: Using P1_FI1f and P1_FI1r as primers, PCR amplification was performed on the chicken genomic DNA to be tested. The PCR amplification products were sequenced to obtain the genotype at position 52729473 on chromosome 1 of the chicken to be tested; Methods for detecting the genotype of FI_chr1_2 in the genome of the chicken to be tested include: Using P1_FI2f and P1_FI2r as primers, PCR amplification was performed on the chicken genomic DNA to be tested; The PCR amplification products were sequenced to obtain the genotype at position 52625267 on chromosome 1 of the chicken to be tested; The nucleotide sequence of P1_FI1f is shown in SEQ ID NO.1, the nucleotide sequence of P1_FI1r is shown in SEQ ID NO.2, the nucleotide sequence of P1_FI2f is shown in SEQ ID NO.3, and the nucleotide sequence of P1_FI2r is shown in SEQ ID NO.4.

Images