A SNP molecular marker related to body length trait of sheep and application thereof

Abstract

The application belongs to the field of SNP detection, and specifically provides a SNP molecular marker related to a body length trait of sheep, application of the SNP molecular marker, and a kit for detecting the SNP molecular marker. The kit is used to detect polymorphism of the SNP molecular genetic marker, i.e. the 92690768th locus of chromosome 4, to screen and determine the body length trait of sheep, and to select and breed or assist in breeding sheep individuals with the body length trait, so as to ensure that high-quality body length trait Tibetan sheep germplasm resources are collected, and the application has a very excellent application prospect.

Description

Technical Field

[0001] This invention belongs to the field of SNP technology, specifically relating to an SNP molecular marker related to sheep body length traits and its application. Background Technology

[0002] Tibetan sheep are one of China's oldest sheep breeds, with a long history and wide distribution. Renowned for their adaptability to high altitudes, tolerance to roughage, and strong disease resistance, Tibetan sheep are a major source of production and livelihood for plateau herders. Body length is a key factor influencing the economic benefits and production efficiency of Tibetan sheep, and is also a crucial indicator for evaluating Tibetan sheep germplasm resources, holding significant economic value in genetic breeding systems. Numerous studies have shown that body length determines meat production performance (such as dressing percentage, net meat percentage, and muscle quality) and reproductive efficiency (such as lambing rate and breeding cycle), making it central to optimizing germplasm resources and improving breeding efficiency. It is primarily influenced by genetic factors, such as different variations in candidate genes.

[0003] The GRM8 gene (UniProt: A0A3Q1LJN2) encodes a glutamate receptor, metabolite 8. Studies have found a significant association between it and human body shape (height, weight, and waist circumference) (Nakabuye M, Kamiza AB, Soremekun O, Machipisa T, Cohen E, Pirie F, et al. Genetic loci implicated in meta-analysis of body shape in Africans. Nutr Metab Cardiovasc Dis. 2022; 32(6):1511-1518.). However, there are currently no reports of the sheep GRM8 gene being associated with body length traits, nor are there any reports of the 92690768 locus of the GRM8 gene on chromosome 4 (NC_056057.1) being associated with body length. Summary of the Invention

[0004] The purpose of this invention is to provide a new SNP of the GRM8 gene and to use it for breeding sheep with a body length trait, thereby obtaining sheep with long body length.

[0005] This invention provides a reagent for detecting SNP molecular genetic markers associated with sheep body length traits, and its use in the breeding or assisted breeding of sheep breeds or strains associated with sheep body length traits.

[0006] Furthermore, selective breeding or assisted selective breeding of sheep with short / long body lengths;

[0007] The SNP molecular genetic marker associated with the sheep body length trait is located at position 92690768 on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0, with polymorphisms of G or A.

[0008] Furthermore, the dominant allele for the sheep body length trait at position 92690768 is the G allele; the dominant genotype is the GG genotype; sheep with the GG genotype have a longer body length.

[0009] This invention also provides a method for breeding or assisting in the breeding of sheep breeds or strains related to sheep body length traits, comprising the following steps:

[0010] Total genomic DNA was extracted from the sheep samples to be tested. The deoxynucleotide at position 92690768 of chromosome 4 in the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0 was detected. If the deoxynucleotide at position 92690768 was G or A, the genotype of the sheep was determined to be GG, GA or AA.

[0011] Sheep with the GG and GA genotypes are longer than sheep with the AA genotype, with the GG genotype sheep exhibiting the best body length trait.

[0012] Furthermore, the steps also include:

[0013] Select GG or GA type sheep individuals for the next breeding step; GG type sheep individuals are preferred for the next breeding step.

[0014] The sheep is a Tibetan sheep, preferably a Qinghai Tibetan sheep.

[0015] The present invention also provides a kit for detecting SNP molecular genetic markers associated with sheep body length traits, comprising a reagent for detecting the deoxynucleotide at position 92690768 of chromosome 4 in sheep reference genome version GCF_016772045.1_ARS-UI_Ramb_v2.0;

[0016] Furthermore, the reagents are sequencing reagents, PCR detection reagents, reagents for restriction fragment length polymorphism methods, or reagents for single-strand conformation polymorphism analysis.

[0017] Furthermore, the reagent is a competitive allele-specific PCR detection reagent, preferably including the amplification primers shown in SEQ ID NO. 1-2 and the extension primers shown in SEQ ID NO. 3.

[0018] The present invention also provides the use of the aforementioned kit in the selection or assisted selection of sheep breeds or strains related to sheep body length traits.

[0019] Finally, this invention provides a method for selecting sheep body length traits using the aforementioned kit, which includes the following steps:

[0020] 1) Extract total genomic DNA from the sheep samples to be tested;

[0021] 2) Perform PCR amplification on the total DNA obtained in step 1) using the aforementioned kit, and extend the amplified fragments;

[0022] 3) Sequencing the extended PCR product from step 2) and determining the sheep's genotype as GG, GA, or AA based on the deoxynucleotide at position 92690768 on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0.

[0023] Sheep with the GG and GA genotypes are longer than sheep with the AA genotype, with the GG genotype sheep exhibiting the best body length trait.

[0024] Furthermore, the steps also include:

[0025] Individuals with the GG or GA type at locus 92690768 on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0 version were selected for the next breeding step, with the GG type individuals being preferred for the next breeding step.

[0026] The sheep is a Tibetan sheep, preferably a Tibetan sheep from the Tibetan Plateau.

[0027] The "body length trait" described in this invention is the straight-line distance from the shoulder to the posterior end of the ischial tuberosity, and is a major indicator used to measure the growth and development of sheep.

[0028] The "selection and breeding of sheep body length traits" mentioned in this invention refers to obtaining sheep breeds with long body lengths by selecting and cultivating specific body length traits during the breeding process.

[0029] This invention is the first to discover that the polymorphism at locus 92690768 on chromosome 4 of the GRM8 gene in the sheep reference genome is strongly correlated with the body length of sheep (especially Tibetan sheep). This locus can serve as a molecular genetic marker for the body length trait in sheep. By detecting this SNP locus, superior sheep with long body length can be screened for breeding or assisted breeding of sheep with body length advantages. This can effectively establish a long-bodied Tibetan sheep population, construct a superior sheep body length breeding system, provide valuable genetic resources for the improvement of long-bodied sheep breeds, shorten the breeding process of high-quality long-bodied sheep breeds, and improve the accuracy of long-bodied sheep selection.

[0030] The key to this invention lies in the discovery that the polymorphism at locus 92690768 on chromosome 4 of the GRM8 gene in the sheep reference genome is strongly correlated with sheep (especially Tibetan sheep) body length. Body length can be determined by detecting this locus, and subsequently used for breeding or assisted breeding of sheep with longer body lengths. Any method and reagent capable of detecting locus 92690768 on chromosome 4 of the sheep reference genome can be used for screening and determining sheep with longer body lengths, showing great promise for future applications.

[0031] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0032] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0033] Figure 1 This is a flowchart illustrating the technical process of the present invention.

[0034] Figure 2 Sequencing peak diagram;

[0035] Figure 3 Genotype map;

[0036] Figure 4 Manhattan plot of Tibetan sheep body length traits;

[0037] Figure 5 This is a ROC curve. Detailed Implementation

[0038] To provide a clearer understanding of the present invention, it is now further described with reference to the following embodiments and accompanying drawings. These embodiments are for illustrative purposes only and do not limit the invention in any way.

[0039] Experimental methods not specified in the examples are conventional methods and conditions well known in the field, or are performed according to the manufacturer's recommendations; all chemical reagents used in the examples are commercially available, and primers used are synthesized by a third party.

[0040] Example 1: A kit for detecting SNP molecular genetic markers associated with sheep body length traits according to the present invention.

[0041] The components of the SNaPshot of this invention include:

[0042] Using a partial fragment of the GRM8 gene at position 92690768 on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0 as a template, primers were designed online using the primer design tool Primer3 plus.

[0043] (1) Reaction primers:

[0044] A: Amplification primers:

[0045] F(SEQ ID NO.1):TCAGCCAAGTACTATGAATCCAGCA

[0046] R(SEQ ID NO.2):GTCAATTTGAAGCAATGAGCTGTATC

[0047] B. Extension primer (SEQ ID NO.3):

[0048] TTTTTTTTTTTTTTTTAAGTAGAGATGAGATTTGCCTACTGC

[0049] (2) Other reagents used in the SNaPshot reaction: Taq buffer, 10×GCEnhancer, dNTP, MgCl2, HotStarTaq, SNaPshot Multiplex Kit (ABI), and water.

[0050] Example 2: Method for detecting SNP molecular genetic markers associated with sheep body length trait

[0051] (1) Extract total genomic DNA from the sheep samples to be tested;

[0052] (2) Using the SNaPshot of Example 1, the deoxynucleotide at position 92690768 on chromosome 4 of the sheep reference genome was detected. If the deoxynucleotide at position 92690768 was G or A, the genotype of the sheep was determined to be GG, GA or AA.

[0053] Example 3: Using SNP molecular genetic markers related to sheep body length traits to select sheep with long body length, thereby obtaining sheep with long body lengths.

[0054] (1) Extract total genomic DNA from the sheep samples to be tested;

[0055] (2) The genotype at locus 92690768 on chromosome 4 of the sheep reference genome was detected using SNaPshot in Example 1. Sheep with the GG genotype were selected for the next step of breeding, namely, the well-proportioned and long-legged sheep.

[0056] Example 4: Using SNP molecular genetic markers related to sheep body length, sheep with longer body length were selected for breeding, thereby obtaining sheep with longer body lengths.

[0057] (1) Extract total genomic DNA from the sheep samples to be tested;

[0058] (2) The genotype at locus 92690768 on chromosome 4 of the sheep reference genome was detected using SNaPshot in Example 1. GA genotype sheep were selected for the next step of breeding, resulting in well-proportioned and long-legged sheep.

[0059] The following experimental examples further illustrate the beneficial effects of the present invention:

[0060] Experimental Example 1: Verification of SNP molecular genetic markers related to sheep body length trait in this invention

[0061] The polymorphism at position 92,690,768 of chromosome 4 in sheep samples was detected using SNaPshot sequencing, revealing that this locus possesses one of the molecular markers that can be used as a selective marker for body length traits in sheep. The invention is further described in detail below with reference to accompanying figures and experimental data (see flowchart). Figure 1 The process includes the following steps:

[0062] S1. Sample source: Tibetan sheep from Qinghai

[0063] S2. Sample collection and phenotypic recording: Ear tip tissue was collected from Qinghai Tibetan sheep and stored in 75% alcohol at -20℃ for later use. At the same time, the body length phenotypic data of Qinghai Tibetan sheep were recorded in detail.

[0064] S3. Nucleic acid extraction and detection: Genomic DNA was extracted from the ear tip tissue of the experimental sheep using a nucleic acid extraction and purification reagent—a genomic DNA extraction kit (RC1001).

[0065] S4. Genotyping Primer Design: Using a partial fragment of the GRM8 gene at position 92690768 (i.e., SNP rs410486866) on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ram b_v2.0 as a template, primers were designed using the Primer3 software.

[0066] A: Amplification primers:

[0067] F(SEQ ID NO.1):TCAGCCAAGTACTATGAATCCAGCA

[0068] R(SEQ ID NO.2):GTCAATTTGAAGCAATGAGCTGTATC

[0069] B: Extension primer (SEQ ID NO.3):

[0070] TTTTTTTTTTTTTTTTAAGTAGAGATGAGATTTGCCTACTGC

[0071] S5. Typing: 1 μl of DNA sample is subjected to 1% agarose gel electrophoresis to detect sample quality and preliminarily estimate concentration. Subsequently, the sample is diluted to the working concentration range (10-30 ng / μl) according to the estimated concentration for subsequent multiplex PCR reactions.

[0072] S6. PCR Reaction: Following Table 1, thoroughly vortex and centrifuge the prepared PCR reaction premix, then aliquot 9 μl into each well of a 96-well plate. Next, add 1 μl of DNA sample to each well, cover with the sealing film, gently vortex to mix, and centrifuge at 3000 rpm for 0.5 minutes. Immediately afterward, place the 96-well plate on the PCR instrument, remove the sealing film, cover with the 96-well rubber cap, and ensure the PCR instrument's heat spreader is properly closed. Perform the PCR reaction according to the reaction system in Table 2.

[0073] Table 1. Preparation of PCR reaction premix

[0074]

[0075] Table 2 PCR reaction system

[0076]

[0077] S7. PCR product purification: Add 5U SAP enzyme and 2U Exonuclease I enzyme to 20μl of PCR product, incubate at 37℃ for 1 hour, and then inactivate at 75℃ for 15 minutes.

[0078] S8, SNaPshot single-base extension reaction: First, prepare the extension reaction premix according to Table 3. Then, thoroughly shake and centrifuge the prepared mixture, aliquoting it into 96-well plates, adding 8 μL to each well. Next, add 2 μL of the purified PCR product to each well, seal the plate, gently shake to mix the contents evenly, and then centrifuge at 3000 rpm for 0.5 minutes. After centrifugation, immediately transfer the 96-well plate to the PCR instrument, remove the sealing film, cover the 96-well rubber gasket, close the PCR instrument's heat spreader, and perform the extension reaction according to the reaction system in Table 5.

[0079] Table 3. Preparation of premixed solution for extended reaction

[0080]

[0081] Table 5 Extended Reactions

[0082] 1 step 96℃ for 1 minute 1 2 steps 96℃ 10sec 52℃ 5sec 60℃ 30sec 28 3 steps 4℃ 1

[0083] S9. Purification of extension product: Add 1U SAP enzyme to 10μl of extension product, incubate at 37℃ for 1 hour, and then inactivate at 75℃ for 15 minutes.

[0084] S10. Sequencing of extension products: Take 0.5 μl of each purified extension product, add 0.5 μl of Liz120 SIZESTANDARD and 9 μl of Hi-Di, mix well, denature at 95℃ for 5 minutes, and then analyze on an ABI 3730XL sequencer.

[0085] S11. Data Analysis: The raw data collected by the sequencer was analyzed using GeneMapper 4.1 software (Applied Biosystems, USA).

[0086] According to the sequencing peak diagram ( Figure 2 The genotype at position 92,690,768 on chromosome 4 was determined by analysis of the genotyping results. The genotyping results are as follows: Figure 3 As shown.

[0087] Association analysis between S12 and GRM8 genotypes and body length trait

[0088] Linear regression was used to analyze the association between phenotype and genotype. The analytical model was additive: y = Gβ. G+e, where y is the phenotypic vector, G is the genotype / dose matrix of the current variant, and e is the least squares error term.

[0089] Analysis of significant differences between S13 and GRM8 genotypes and body length phenotypes

[0090] The experiment measured the body length phenotypic data of 296 Tibetan sheep from the plateau. The experimental results are expressed as mean ± standard error of mean. The significance analysis was performed by t-test using PASW Statistics 18 software. P<0.05 was considered significant and P<0.01 was considered highly significant.

[0091] SNapshot genotyping results showed that among 296 individuals, there were 135 GA and GG genotypes and 161 AA genotypes. The GA and GG genotypes were characterized by longer body length, ranging from 66.62±0.35 cm, with the GG genotype generally being longer than the GA genotype. The AA genotype was characterized by shorter body length, ranging from 62.84±0.27 cm. Figure 4 ).

[0092] Table 6. Association analysis of the 92,690,768 loci of GRM8 with body length.

[0093]

[0094] Note: **P<0.01; mean ± standard error of the mean.

[0095] The association between the genotype at position 92,690,768 of the GRM8 gene on chromosome 4 and body length is shown in Table 6. Table 6 shows that individuals carrying the G allele (GA and GG genotypes) had significantly better body length traits than those carrying the AA genotype (P < 0.01). The data in Table 6 were analyzed using ROC curves. Figure 5 As shown in the figure, locus 92,690,768 has strong recognition performance for body length variation (area under ROC curve: 0.750; 95% confidence interval: 0.695-0.804; sensitivity: 78%; specificity: 59%).

[0096] The results show that the single nucleotide polymorphism (SNP) marker of the sheep GRM8 gene is located at position 92690768 on chromosome 4 of the sheep reference genome (GCF_016772045.1_ARS-UI_Ramb_v2.0), indicating a G>A mutation. This confirms that position 92690768 on chromosome 4 (Chr4:92690768) of the sheep reference genome can serve as an important molecular marker for body length. Notably, homozygous GG individuals exhibit the optimal body length phenotype. This finding provides important evidence for molecular breeding of Tibetan sheep body length. Therefore, the following strategies can be used to establish a high-quality breeding population: 1) Use genotyping technology to screen individuals carrying the G allele at the Chr4:92690768 locus; 2) Prioritize homozygous GG individuals as core breeding materials; 3) Construct a marker-assisted selection system based on this locus. This study not only identified the key genetic markers for the body length trait in Tibetan sheep, but also laid a theoretical foundation for establishing a molecular breeding technology system for the body length trait in sheep, and has important practical value for improving the genetic progress of the body length trait in Tibetan sheep populations.

[0097] In summary, this invention provides a SNP molecular genetic marker associated with sheep body length trait, and a kit for detecting this SNP molecular genetic marker. By using the kit of this invention to detect polymorphism of the SNP molecular genetic marker, namely locus 92,690,768 on chromosome 4, the sheep body length trait can be determined. Individuals for breeding or assisted breeding of long-legged sheep with body length trait can be identified based on this trait, ensuring the collection of high-quality Tibetan sheep breed germplasm resources with excellent body length trait, and demonstrating very promising application prospects.

Claims

1. A method for breeding or assisting in the breeding of sheep breeds or strains related to the body length trait, characterized in that: Includes the following steps: Total genomic DNA was extracted from the sheep samples to be tested. The deoxynucleotide at position 92690768 of chromosome 4 in the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0 was detected. If the deoxynucleotide at position 92690768 was G or A, the genotype of the sheep was determined to be GG, GA, or AA. Individuals with the GG or GA genotype were then selected for further breeding. The sheep in question are Tibetan sheep from the Tibetan Plateau.

2. The method according to claim 1, characterized in that: Take individual GG-type sheep for the next step of breeding.

3. A method for selecting sheep body length traits using a kit, characterized in that: Includes the following steps: 1) Extract total genomic DNA from the sheep samples to be tested; 2) Use the kit to perform PCR amplification on the total DNA obtained in step 1), and extend the amplified fragments; 3) Sequencing the extended PCR product from step 2) and determining the sheep's genotype (GG, GA, or AA) based on the deoxynucleotide sequence at position 92690768 on chromosome 4 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0; selecting individuals with the GG or GA genotype for further breeding. The sheep in question are Tibetan sheep from the Tibetan Plateau. The kit includes reagents for detecting the deoxynucleotide at position 92690768 of chromosome 4 in sheep reference genome version GCF_016772045.1_ARS-UI_Ramb_v2.

0.

4. The method according to claim 3, characterized in that: The reagent is a competitive allele-specific PCR detection reagent, which includes the amplification primers shown in SEQ ID NO. 1~2 and the extension primers shown in SEQ ID NO.

3.

5. The method according to claim 3, characterized in that: Individuals of the Mian GG type were selected for the next step of breeding.

Images