Antibodies to misfolded superoxide dismutase-1 (SOD1) and ubiquitin ligase fusion proteins

Abstract

Antibodies or binding fragments thereof, fusion proteins or pharmaceutical compositions directed against misfolded SOD1 epitopes, or nucleic acids or pharmaceutical compositions encoding the antibodies or binding fragments thereof, fusion proteins are described. Also provided are methods of using and producing such antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions, and methods of their use in treating disorders in human subjects in need thereof.

Description

[0001] Related Applications

[0002] This disclosure claims the benefit of and priority to U.S. Provisional Patent Application Serial No. 63 / 446,485, filed February 17, 2023, which is incorporated by reference in its entirety.

[0003] Incorporation by Reference of the Sequence Listing

[0004] The computer readable form of the sequence listing “P58515PC01_ST25” (272,118 bytes), created on February 19, 2024, is incorporated herein by reference.

[0005] Field

[0006] The present disclosure relates to antibodies to misfolded superoxide dismutase-1 (SOD1) and ubiquitin ligase fusion proteins thereof for treating conditions, diseases, and disorders mediated by misfolded SOD1, including amyotrophic lateral sclerosis, Alzheimer’s disease, and Parkinson’s disease.

[0007] BACKGROUND

[0008] Proteins can fold into complex and tightly packed structures. Folding is not only essential for biological activity, but also proteins that cannot fold correctly or remain in a folded state can lead to disease (reviewed in 48). In some cases, misfolding can lead to protein aggregation, which can further cause discrete deposits either extracellularly (e.g., plaques) or intracellularly (e.g., inclusions in the cytosol or nucleus).

[0009] Neurodegenerative diseases such as Alzheimer’s disease (AD), Parkinson’s disease / Lewy body dementia (PD / LBD), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS), and prion diseases are characterized by the neural deposition of misfolded, aggregated proteins (reviewed in 49). These diseases pose a significant challenge to our aging population and the healthcare system.

[0010] Sporadic AD, ALS, and PD / LBD are all associated with the neural accumulation of pathogenic polymers of misfolded polypeptides, which can be fibrils, protofibrils, and amorphous aggregates, including amyloid beta (Abeta) fragments of amyloid precursor protein (APP) in AD; superoxide dismutase-1 (SOD1) in ALS, AD, and PD, and alpha-synuclein in PD and LBD. In addition, familial amyloidotic polyneuropathy (FAP) is caused by the aggregation of transthyretin to form amyloid deposits. As with prion diseases, mutations in genes encoding these polypeptides are associated with autosomal dominant familial forms of ALS, AD, and PD.

[0011] Oxidative stress is implicated in ALS, PD, and AD. Reactive oxygen and nitrogen species (ROS and RNS, respectively) generated in these environments can participate in cellular damage, including abnormal oxidation of proteins or lipids. The accumulation of cytoskeletal fragments and selective neuronal death that occurs in these diseases can also be attributed to oxidative stress and accumulated insoluble proteins. SOD1 is known to have antioxidant effects, and alterations in its activity can lead to neurodegenerative disease states. SOD1 is a major target of oxidative damage in the brains of AD and PD. Total levels of SOD1 are elevated in AD and PD, and SOD1 forms protein aggregates that are associated with amyloid senile plaques and neuronal fibrillar tangles in the AD brain. It is suggested that AD, PD, and ALS can have a common pathogenic mechanism (Choi et al, 2005).

[0012] ALS is a fatal neuromuscular disease characterized by selective loss of motor neurons leading to muscle atrophy. It is the most common motor neuron disease in adults and the third most common neurodegenerative disease after Alzheimer’s disease and Parkinson’s disease. The number of ALS cases occurring worldwide each year is estimated at 1.9 per 100,000 people per year, while the number of people living with ALS at any given time is estimated at about 4.5 per 100,000. ALS usually begins with muscle twitching and weakness in the limbs, or slurred speech, and eventually the disease affects the control of muscles needed for movement, speech, eating, and breathing. The average survival from onset to death is 2-4 years, and about 10% of survival is more than 10 years. Death is usually from respiratory failure.

[0013] Familial (hereditary) ALS is generally considered to account for 10% of all ALS cases, but estimates range from 5-20%. About 20% of familial ALS is associated with mutations in the gene encoding superoxide dismutase 1 (SOD1), an intracellular free radical defense enzyme (see Table 1 and Mathis, S., et al. (2019), incorporated herein by reference). Intracellular aggregation of misfolded SOD1 that inhibits protein degradation is observed in familial ALS, and also in the more common non-familial (sporadic) ALS, suggesting that SOD1 aggregation can be the basis of all ALS.

[0014] Misfolded SOD1 is exported from cells by both a secretory mechanism and a constitutive mechanism. Extracellular misfolded SOD1 is highly toxic to motor neurons through activation of a kill pathway by local immune cells and can also contribute to disease cell-to-cell transmission throughout the nervous system through a prion-like templated misfolding process. The implication of extracellular misfolded SOD1 in ALS pathogenesis is that it offers an opportunity for antibody therapy of neurodegenerative diseases because this compartment can be neutralized by antibodies. Nonetheless, treatment of human subjects with antibodies targeting extracellular epitopes accessible on ubiquitously expressed proteins can lead to deleterious autoimmune effects as observed with Abeta in Alzheimer's disease. There remains a need in the art for compositions and methods for treating misfolded SOD1 -associated diseases such as ALS, AD, and PD.

[0015] SUMMARY

[0016] Disclosed herein are isolated antibodies or binding fragments thereof, fusion proteins, or nucleic acids targeting misfolded SOD1, and pharmaceutical compositions comprising the same, and methods of making and using the same.

[0017] Accordingly, provided in one aspect herein is an isolated antibody or binding fragment thereof, which binds to a misfolded superoxide dismutase 1 (SOD1) epitope having an amino acid sequence of SEQ ID NO: 144, the antibody or binding fragment thereof comprising:

[0018] (i) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6;

[0019] (ii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0020] (iii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0021] (iv) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0022] (v) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0023] (vi) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58;

[0024] (vii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or

[0025] (iii) a heavy chain comprising a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and a light chain comprising a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0026] In some embodiments, the antibody or binding fragment thereof comprises a heavy chain and a light chain:

[0027] (i) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0028] (ii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0029] (iii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0030] (iv) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0031] (v) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0032] (vi) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0033] (vii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86; or

[0034] (IV) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91.

[0035] In some embodiments, the percent identity is outside of the CDRs described herein, and the antibody or antigen-binding fragment thereof retains specificity for binding to mutant SOD1.

[0036] In some embodiments, the binding fragment is a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, minibody, diabody, or bispecific antibody binding fragment. In some embodiments, the binding fragment is a scFv. In some embodiments, the antibody or binding fragment thereof comprises one or more amino acids selected from the group consisting of a D-amino acid, a modified amino acid, an amino acid analog, or a combination thereof. In some embodiments, the modified amino acid comprises a modification selected from methylation, amidation, acetylation, and / or substitution with other chemical groups. In some embodiments, the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation, or prenylation.

[0037] Another aspect also provides a fusion protein comprising an antibody or binding fragment thereof described herein and an E3 ligase or active fragment thereof. In some embodiments, the E3 ligase is CHIP, UBE4A, NEDD4L, UBR5, RNF4, UBOX5, BTrCP, or Parkin, or an active fragment thereof.

[0038] Yet another aspect also provides a nucleic acid encoding an antibody or binding fragment thereof described herein or a fusion protein described herein.

[0039] Another aspect also provides a vector comprising a nucleic acid described herein.

[0040] Another aspect also provides a composition, optionally a pharmaceutical composition, comprising an antibody or binding fragment thereof described herein, a fusion protein described herein, a nucleic acid described herein, or a vector described herein, and optionally at least one carrier, such as a pharmaceutical carrier.

[0041] In another aspect, provided herein are methods for treating a medical condition, disease, or disorder mediated by misfolded forms of SOD1 in a subject in need thereof, the method comprising administering to the subject an antibody or binding fragment thereof described herein, a fusion protein described herein, a nucleic acid described herein, a vector described herein, or a pharmaceutical composition described herein. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded forms of SOD1 comprise SOD1 monomers, dimers comprising misfolded SOD1 monomers, or aggregates comprising SOD1 monomers and / or dimers or toxic trimers. In some embodiments, the SOD1 monomers comprise mutant SOD1 monomers. In some embodiments, the mutant SOD1 monomers comprise one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation.

[0042] Also provided in another aspect are fusion proteins that specifically bind to mutant SOD1 comprising a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.

[0043] In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein is formulated for viral delivery to a subject. In some embodiments, the fusion protein is expressed and delivered by an AAV vector.

[0044] Another aspect also provides a method of treating a neurodegenerative condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, the method comprising administering to the subject a fusion protein described herein. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the SOD1 comprises a mutant SOD1. In some embodiments, the mutant SOD1 comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation. In some embodiments, the mutant SOD1 comprises G93A.

[0045] These and other objects and features of the present disclosure will become more fully apparent when the following detailed description is taken in conjunction with the accompanying drawings.

[0046] BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Embodiments of the present disclosure will be described with respect to the following drawings, in which:

[0048] Figure 1A Results from epitope mapping experiments performed with hybridoma clone 3H1 are shown.

[0049] Figure 1B Results from epitope mapping experiments performed with hybridoma clone 8D1 are shown.

[0050] Figure 2 is a schematic of the location of the epitope of the anti-SOD1 antibody.

[0051] Figure 3A Design of a misfolded specific ubiquitin ligase fusion protein (mUbL) is shown.

[0052] Figure 3B is a graph showing gene expression data from human post-mortem anterior horns in controls and ALS donors.

[0053] Figure 4A is an image showing HEK293 cells transfected with mUbL and SOD1-A4V-GFP and stained with DAPI and mUbL.

[0054] Figure 4B is an immunoblot showing mUbL expression in HEK293 transfected with mUbL and a graph showing signal intensity representing protein expression levels.

[0055] Figure 4C is an immunoblot showing that mUbL does not degrade endogenous SOD1.

[0056] Figure 4D mUbL 2 is shown to interact with misfolded SOD1.

[0057] Figure 5A is a results graph showing that all mUbLs are able to reduce the amount of SOD1-A4V-GFP in HEK293, Neuro2A, and SHSY5Y cells.

[0058] Figure 5B is a results graph showing that mUbL 2 is consistently effective at reducing fluorescence in HEK293, Neuro2A, and SHSY5Y cells.

[0059] Figure 5C is a results graph showing that mUbL 2 is most effective at reducing the number of insoluble fluorescent aggregates present in transfected HEK293, Neuro2A, and SHSY5Y cells by maintaining SOD1 at a level that can diffuse out through saponin-induced pores in the cell membrane. Figure 5C mUbLs are shown to reduce the number of insoluble SOD1 G93A -EGFP aggregates in HEK293 cells.

[0060] Figure 6Ais a graph showing that mUbL can reduce misfolded SOD1 levels with a range of SOD1 mutations.

[0061] Figure 6B is a graph showing that mUbL action is blocked when proteasomes are inhibited with MG132.

[0062] Figure 6C is a graph showing that mUbL in the mUbL panel is effective at reducing SOD1 A4V -EGFP fluorescence intensity.

[0063] Figure 7A shows the design of the E3 ligase panel. The binding domain was removed and scFv from mUbL 2 was fused to the truncated ligase.

[0064] Figure 7B shows that the ligases in the mUbL panel are effective at reducing SOD1 G93A -EGFP fluorescence intensity.

[0065] Figure 8A is a graph showing that E3 ligases are able to reduce total fluorescence of SOD1-A4V and G93A in HEK293 and also SOD1-A4V in SHSY5Y cells.

[0066] Figure 8B is a graph showing that E3 ligases are effective at reducing the number of insoluble fluorescent aggregates in transfected cells after saponin treatment.

[0067] Figure 8C is a graph showing that E3 ligases are effective at reducing soluble fluorescent levels in the media after saponin treatment.

[0068] Figure 9A shows expression of mUbL in neurons in brain tissue.

[0069] Figure 9B shows that mUbL is expressed in the brain and spinal cord but not in the liver of WT / mUbL mice.

[0070] Figure 10 shows that the mUbL transgene is effective at attenuating and delaying the weight loss stage of ALS early symptoms in male but not female SOD1 G93A mice.

[0071] Figure 11 shows that the mUbL transgene is effective at delaying disease progression in SOD1 G93A mice.

[0072] Figure 12 It is shown that the mUbL transgene effectively attenuates the clinical phenotype at late stages of disease.

[0073] Figure 13 It is shown that mUbL has an impact on SOD1 G93A Survival was analyzed using the log-rank test.

[0074] Detailed description

[0075] I. Definitions

[0076] The term "comprising," including its derivatives, as used herein is intended to be an open term that specifies the presence of the stated features, elements, components, groups, integers, and / or steps, but does not exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The foregoing also applies to like terms, for example, "comprises," "comprised," "comprising," "including," "includes," "has," "have," "having," and "contains," "contains," "containing," or any of their derivatives. Finally, as used herein, the terms "substantially," "about," and "approximately" mean an acceptable close variance from the value of a numerically quantified term such that the numerical value of the numerically quantified term is not significantly changed. Such terms should be construed as including a deviation of at least ±5% of the numerical value of the numerically quantified term, provided such a deviation does not result in a change in the meaning of the word it modifies.

[0077] When a term is provided in singular form, the inventors herein also contemplate aspects of the disclosure described by the plural form of that term. As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes one or more methods, and / or steps of the type described herein, and / or equivalents thereof as would be apparent to one skilled in the art, after reading this disclosure.

[0078] The term "administer," "administering," or "administered" refers to the act of giving an agent or therapeutic treatment to a physiological system (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs).

[0079] As used herein, the term "affinity" refers to the strength of the sum total of noncovalent interactions between individual binding sites of a molecule and its binding partner. Unless indicated otherwise, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects 1:1 interactions between members of a binding pair. The affinity of a molecule X for its partner Y can be generally represented by the equilibrium dissociation constant (K D ) for the interaction. Affinity can be measured by common methods known in the art.

[0080] The term "amino acid" refers to natural amino acids, as well as unnatural or non-standard amino acids, such as amino acid analogs, synthetic amino acids, and amino acid mimetics. These amino acids can be in the L- or D- (isomeric) configuration, or can include both dextro and levorotary forms. Amino acids that have been incorporated into an antibody are referred to as "residues." In this document, amino acids can be referred to by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0081] The term "antibody" as used herein is intended to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, and humanized antibodies. Antibodies can be from recombinant sources and / or produced in transgenic animals. The term "antibody binding fragment" or "antibody fragment" as used herein is intended to include, without limitation, Fv (a molecule comprising VL and VH), single chain variable fragment (scFv; a molecule comprising VL and VH connected by a peptide linker), Fab, Fab', F(ab')2, dsFv, ds-scFv, single domain antibody (sdAB; a molecule comprising a single variable domain with 3 or fewer CDRs, e.g., V H H, V H , V L and IgNAR antigen binding variable domains (VNAR)), and multivalent presentations of these. Also included are dimers, minibodies, diabodies, and multimers thereof, bispecific antibody fragments and multispecific antibody fragments, and single domain antibodies. Antibody fragments can be fragmented using conventional techniques. For example, F(ab')2 fragments can be produced by treating antibody with pepsin. The resulting F(ab')2 fragments can be treated to reduce disulfide bonds, thereby producing Fab' fragments. Papain digestion can result in the formation of Fab fragments. Fab, Fab', and F(ab')2, scFv, dsFv, ds-scFv, sdAB, dimers, minibodies, diabodies, bispecific antibody fragments, and other fragments can also be synthesized by recombinant techniques.

[0082] In the present disclosure, the heavy chain variable region (VH) and light chain variable region (VL) sequences of a rabbit monoclonal antibody based on the anti-SOD1 peptide NEESTKTGN (SEQ ID NO: 142), which is located in an electrostatic loop that is not accessible in the properly folded SOD1 structure under normal circumstances, and which alpha-helical sequence linearizes when SOD1 is misfolded, were recombined to generate a scFv antibody that binds to misfolded SOD1. Generation of the rabbit monoclonal antibody can be performed using techniques known in the art and described herein.

[0083] scFv are fusions of the variable regions of the heavy (VH) and light (VL) chains of immunoglobulins, connected with a short linker peptide of, for example, 10 to about 25 amino acids. The linker is usually rich in glycine for flexibility, and in serine or threonine for solubility, and can connect the N-terminus of VH and the C-terminus of VL, or vice versa. scFv have been used to facilitate phage display, where it is convenient to express the antigen binding domain as a single peptide. As an alternative, scFv can be generated directly from subcloning of heavy and light chains derived from hybridomas. scFv are versatile and can be used for a variety of applications, including, for example, flow cytometry, immunohistochemistry, as antigen binding domains of chimeric antigen receptors, and therapeutic uses. In some embodiments, the antibodies or binding fragments thereof described herein contain a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain and the light chain are connected by a linker. In some embodiments, the linker is a peptide linker. In some embodiments, the linker comprises GSGSG (SEQ ID NO: 222) or GGGGSGGGGSGGGGS (SEQ ID NO: 221).

[0084] Antibodies against misfolded SOD1 can also be prepared using techniques known in the art, such as those described in Kohler and Milstein, Nature 256, 495 (1975) and Kuroiwa et al, (2002) and U.S. Patent Nos. RE 32,011, 4,902,614, 4,543,439, 4,411,993, and 9,133,272 and PCT Application Nos. 2010 / 004438 and 2014 / 031694, which are incorporated by reference herein. (See also Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), 1980; Monoclonal Antibodies: Methods and Protocols, Humana Press, Albitar (ed.), 2007; and Antibodies: A Laboratory Manual, 2 nd Edition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014, which are also incorporated by reference herein). In the context of the present disclosure, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, antibody fragments (e.g., Fab and F(ab')2), and recombinantly produced binding partners.

[0085] To produce polyclonal antibodies in a host (e.g., a rabbit or goat), the host is immunized with the immunogen or immunogen fragment, typically with an adjuvant, and as necessary conjugated to a carrier; antibodies to the immunogen are collected from the serum. In addition, polyclonal antibodies can be absorbed so as to have monospecificity. That is, serum against the relevant immunogen can be adsorbed so that no cross-reactive antibodies remain in the serum, thus rendering it monospecific. To produce monoclonal antibodies, antibody-producing cells (lymphocytes) can be harvested from the immunized animal and fused with myeloma cells by standard somatic cell fusion methods, thus immortalizing the cells and producing hybridoma cells. These techniques are well known in the art (e.g., the hybridoma technique, originally developed by Kohler and Milstein (1975), as well as other techniques such as the human B-cell hybridoma technique (Kozbor, D, and Roder, J, 1983), the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985), and screening of combinatorial antibody libraries (Huse, W et al., 1989)). Hybridoma cells can be immunochemically screened to produce antibodies that specifically react with the protein or binding fragment thereof, and the monoclonal antibodies can be isolated.

[0086] Chimeric antibodies, e.g., antibody molecules that combine variable regions from a non-human animal with human constant regions, are also contemplated within the scope of the present disclosure. Chimeric antibody molecules can include, for example, variable regions or domains from an antibody of a mouse, rat, rabbit, or other species, and human constant regions. Conventional methods can be used to prepare chimeric antibodies containing immunoglobulin variable regions that recognize a target (see, Antibodies: A Laboratory Manual, 2 nd Edition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014).

[0087] Monoclonal or chimeric antibodies that specifically react with a target as described herein can be further humanized by producing human constant region chimeras, in which the conserved framework regions of the variable regions, particularly the antigen binding domains, are of human origin, and only the hypervariable regions are of non-human origin. Such immunoglobulin molecules can be made by techniques known in the art (e.g., Teng et al., 1983; Kozbor, D, and Roder, J, 1983; Olsson and Kaplan; 1982; PCT Publication WO 92 / 06193; Antibodies: A Laboratory Manual, 2 ndEdition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014; each incorporated herein by reference). Humanized antibodies can also be produced commercially.

[0088] Rabbit antibodies are suitable for humanization. Rabbit antibodies have limited framework variability due to the preferential use of VH germline segments (80-90% of VDJ genes) and association with multiple cognate VJ genes. The fact that rabbit variable domain frameworks are highly homologous to each other makes them more suitable for universal human acceptor frameworks (Borras et al., 2010). Humanized antibodies can be generated by grafting CDRs onto human antibody acceptor frameworks. Rabbit variable regions or domains can be humanized by grafting the antigen-binding loops onto a human framework (i.e., human framework FW1.4). Affinity and stability can be optimized by substituting residues that are highly conserved in rabbit variable domains (i.e., human framework FW1.4gen) that are included in the CDR conformation (Borras et al., 2010 and U.S. Patent No. 8,293,235, each incorporated herein by reference).

[0089] Rabbit monoclonal antibodies can also be humanized by grafting combined CDRs (Kabat, IMGT, and Paratome) onto stable human Ig germline frameworks (i.e., IGHV3-66*01, IGHJ4*01, IGKV1-27*01, and IGKJ4*01). The combined CDR grafting strategy includes antigen-contacting residues as well as supporting residues (Zhang and Ho, 2017, incorporated herein by reference).

[0090] Humanization can also be achieved by grafting only specificity-determining residues (SDRs) onto human antibody frameworks. Doing so reduces the number of non-human residues while retaining residues essential for antigen-antibody interactions, and thus reduces immunogenicity (Kashmiri et al., 2005, incorporated herein by reference). Similarly, selective determining residues contained in rabbit CDR regions can be transferred to cognate acceptor human antibody variable heavy and light chain sequences (US 20090104187, incorporated herein by reference).

[0091] Another CDR grafting technique involves human framework sequences based on CDR similarity to human germline genes. Antibody humanization is done based on similarity of CDR sequences rather than framework similarity. Human antibodies with similar structured CDRs support CDRs of another species and retain affinity. This is achieved by comparing residue-to-residue homology and converting residues in human CDRs that are not exactly identical to rabbit sequences (US 6881557, incorporated herein by reference).

[0092] Humanized rabbit monoclonal antibodies can be generated using mutational lineage guided (MLG) humanization. The heavy and light chain variable region sequences are aligned with comparable human germline VH and VK sequences. Rabbit residues in the framework regions that participate in contacting the CDRs are not changed. Structurally related and exchangeable residues, as well as non-critical structural residues, are humanized. Solvent facing residues are also replaced with human germline residues. Selective replacement of non-human residues within the CDRs and in both frameworks results in a humanized antibody guided by biological and sequence information (Yu et al., 2010; WO 2005016950; US 7462697, each incorporated by reference herein).

[0093] Antibodies can also be humanized by resurfacing, which replaces surface accessible residues in the variable region. Replacing these exposed residues reduces immunogenicity in humans (US20040086979, each incorporated by reference herein). Similarly, rabbit monoclonal antibodies can be humanized by changing amino acids within the framework regions of the variable regions or domains to produce sequences similar to the framework regions of similar human antibodies (WO 2005016950, incorporated by reference).

[0094] Alternatively, using phage display methods, chimeric rabbit / human antibodies can be generated that contain rabbit variable regions or domains and human constant regions, and thus have been partially humanized. The rabbit variable regions or domains can then be humanized. Humanization can be achieved by phage display using CDR grafting framework fine-tuning. Rabbit CDR sequences can be grafted into suitable human frameworks. Framework fine-tuning can then change residues in the human framework that participate in antigen binding (Rader et al., 2000; US 6346269, each incorporated by reference herein). Chimeric rabbit / human Fabs can also be converted to chimeric rabbit / human IgGl (Steinberger et al., 2000, US20030049251, each incorporated by reference herein).

[0095] To generate recombinant antibodies (see generally Huston et al, 1991; Johnson and Bird, 1991; Mernaugh and Mernaugh, 1995), the messenger RNA of B lymphocytes or hybridomas of an animal producing an antibody is reverse transcribed to obtain complementary DNA (cDNA). The antibody cDNA, which can be full-length or partial-length, is amplified and cloned into a bacteriophage or plasmid. The cDNA can be partial-length heavy and light chain cDNAs, separated by a linker or joined. The antibody or binding fragment thereof is expressed using a suitable expression system to obtain a recombinant antibody. Antibody cDNA can also be obtained by screening a relevant expression library.

[0096] The term "signal peptide" or "signal sequence" as used herein refers to a short amino acid sequence located at the start (N-terminal) of a newly synthesized polypeptide (e.g., a heavy or light chain of an antibody or fusion protein comprising the variable regions of these chains). This sequence, usually spanning 15-30 amino acids, targets the nascent antibody molecule to the endoplasmic reticulum (ER) or other relevant organelle, laying the foundation for its secretion, membrane integration, or specific compartmentalization. Upon reaching the target site, the signal peptide is cleaved, processing the antibody into a mature form, ready to fold and attain its functional configuration. When the signal peptide is not at the N-terminus, it can lose its function as a signal peptide and does not provide a cleavage site for processing. An internal signal peptide can serve or be used as a linker. The antibodies and fusion proteins described herein can have or not have a signal peptide, whether at the N-terminus or internally.

[0097] As used herein, the term "E3 ligase" or "E3 ubiquitin ligase" refers to a protein in the ubiquitin proteasome pathway that recruits an E2 ubiquitin-conjugating enzyme that is already loaded with ubiquitin, recognizes a protein substrate, and assists or directly catalyzes the transfer of ubiquitin from the E2 to the protein substrate. E3 ligases interact with both the target protein and the E2 enzyme, and thereby confer E2 substrate specificity. E3 ligases typically polyubiquitinate their substrates with Lys48-linked ubiquitin chains, targeting the substrate for proteasomal destruction, but many other types of ligation are possible and alter the activity, interaction, or localization of the protein. Ubiquitination by E3 ligases is regulated in many areas, such as cell cycle control, cellular transport, DNA repair, and signal transduction. The human genome encodes over 600 putative E3 ligases, including CHIP (UniProtKB ID: Q9UNE7), UBE4A (UniProtKB ID: Q14139), NEDD4L (UniProtKB ID: Q96PU5), UBR5 (UniProtKB ID: O95071), RNF4 (UniProtKB ID: P78317), UBOX5 (UniProtKB ID: O94941), Parkin (UniProtKB ID: O60260), and BTrCP (UniProtKB ID: Q9Y297), which are selected here as representatives of different E3 ligase families. An E3 ligase or active fragment thereof can be fused to an anti-misfolded SOD1 antibody or binding fragment thereof described herein to generate a fusion protein called a misfolded-specific ubiquitin ligase fusion protein (mUbL or MisfoldUbL). The binding domain of an E3 ligase confers E3 substrate specificity. This specificity can change when the binding domain is removed or replaced. A truncated form of an E3 ligase without a binding domain can be used to target misfolded SOD1 when fused to an antibody or binding fragment thereof disclosed herein. An active fragment of an E3 ligase retains the catalytic function of an E3 ligase and can be used to target misfolded SOD1 when fused to an antibody or binding fragment thereof disclosed herein. The molecular biology techniques for making such fusion proteins are known to those of skill in the art.

[0098] As used herein, the term "effective amount" refers to a therapeutic amount (e.g., a prophylactic or therapeutic agent) sufficient to achieve a beneficial or desired result, including a clinical result. An effective amount can be administered in one or more administrations.

[0099] As used herein, the term "isolated" refers to material that is removed from its original environment (e.g., the natural environment, if it is natural). For example, a native antibody present within a living animal is not isolated, but the same antibody, separated from some or all of the coexisting materials in the natural system, is isolated.

[0100] As used herein, the term specific binding includes low affinity and high affinity specific binding. Specific binding can be exhibited, for example, by a low affinity misfolded SOD1 antibody or binding fragment thereof, or a fusion protein that selectively binds misfolded SOD1 with a Kdof about 10 -4 M to about 10 -7 M Kd D of a fusion protein. Specific binding can also be exhibited by a high affinity misfolded SOD1 antibody or binding fragment thereof, or a fusion protein, for example, a misfolded SOD1 antibody or binding fragment thereof, or a fusion protein that selectively binds misfolded SOD1 with a Kdof at least about 10 -7 M, at least about 10 -8 M, at least about 10 -9 M, at least about 10 -10 M, or at least about 10 -11 M or 10 -12 M or greater Kd D Misfolded SOD1 antibody or binding fragment thereof or fusion protein can have, for example, a Kdof about 2 x 10 -5 M to 10 -7 M Kd D of about 10 -6 to 10 -7 M or about 10 -8 M to 10 -10 M Kd D ( e.g., as measured by SPR), or about 10 -9 M to 5 x 10 -7 M Kd D Misfolded SOD1 antibody or binding fragment thereof or fusion protein that selectively binds misfolded SOD1 can be used in the methods described herein.

[0101] The term “pharmaceutically acceptable carrier” refers to any such carrier that is suitable for a particular mode of administration known to those skilled in the art. For example, the term “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are, or can be, used in the manufacture of pharmaceuticals. Moreover, the active ingredients can also be mixed with other inactive ingredients or with other active ingredients as desired for a particular application.

[0102] As used herein, the term "pharmaceutically acceptable salt" refers to salts that are known and used commonly in the pharmaceutical literature. Typical inorganic acids used to form such salts include hydrochloric, hydrobromic, hydriodic, nitric, sulfuric, phosphoric, phosphorous, and the like. Salts derived from organic acids, such as aliphatic monocarboxylic and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic and amino alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, can also be used. Such pharmaceutically acceptable salts include acetate, phenylacetate, trifluoroacetate, acrylate, ascorbate, benzoate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, hydrobromide, isobutyrate, phenylbutyrate, beta-hydroxybutyrate, hydrochloride, cinnamate, citrate, formate, fumarate, glycolate, heptanoate, lactate, maleate, hydroxymaleate, malonate, mesylate, nitrate, oxalate, phthalate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, propionate, phenylpropionate, salicylate, succinate, sulfate, bisulfate, pyrosulfate, sulfinate, bisulfite, sulfonate, benzene sulfonate, p-bromophenyl sulfonate, chlorobenzene sulfonate, ethyl sulfonate, 2-hydroxyethyl sulfonate, methanesulfonate, naphthalene- 1 -sulfonate, naphthalene-2-sulfonate, p-toluenesulfonate, xylene sulfonate, tartarate, and the like.

[0103] As used herein, the terms "treat," "treatment," and "treating" refer to preventing, reducing, or ameliorating the progression, severity, and / or duration of at least one pathology and / or symptom of any condition or disease. The term "treatment" or "treating" refers to any administration of a compound disclosed herein, and includes (i) inhibiting a disease or inhibiting a disease state in an individual who is experiencing or displaying the pathology or symptom of a disease, or arresting the disease state (e.g., stopping the pathology and / or symptom from developing) or (ii) ameliorating a disease or disease state in an individual who is experiencing or displaying the pathology or symptom of a disease (e.g., reversing the pathology and / or symptom). The term "control" includes preventing, treating, eradicating, ameliorating, or otherwise lessening the severity of a disease symptom or disease state.

[0104] In the context of a disease or condition herein, the terms "reducing," "reduce," or "reduction" refer to a decrease in a cause, symptom, or effect of the disease or condition. Thus, in the disclosed methods, "reducing" can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the amount of injury due to reperfusion, or any value or range therebetween.

[0105] As used herein, the term "subject" or "patient" or synonyms thereof includes all members of the animal kingdom, particularly mammals, including humans. The subject or patient is human where appropriate.

[0106] Numerical ranges expressed in endpoints by the present document include all numbers and fractions subsumed within that range (e.g., 1 to 5 includes, for example, 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions therein are presumed to be modified by the term "about."

[0107] II. Misfolded SOD1 antibodies or binding fragments, fusion proteins, or nucleic acids and compositions thereof

[0108] Misfolded SOD1 specific antibodies or binding fragments or fusion proteins thereof can be used to treat a medical condition, disease, or disorder mediated by misfolded forms of SOD1 in a subject in need of treatment.

[0109] A. Misfolded SOD1 binding antibodies

[0110] Disclosed herein are antibodies or binding fragments thereof that bind to misfolded SOD1. Variants and improved embodiments of the antibodies that can be used in these methods are also provided.

[0111] The present disclosure provides the misfolded SOD1 epitope ESTKTGN (SEQ ID NO: 144), which is the core of the epitope recognized by misfolded SOD1 antibodies. In one embodiment, the antibody or binding fragment thereof binds to the epitope ESTKTGN (SEQ ID NO: 144).

[0112] In one embodiment, the antibody binding fragment is an Fv, scFv, Fab, Fab', F(ab')2, dsFv, ds-scFv, sdAB, dimer, minibody, diabody, or multimer thereof. In one embodiment, the antibody binding fragment is an scFv.

[0113] In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 comprises one or more modifications that increase protease resistance, serum stability, and / or bioavailability. In some embodiments, the modification is selected from pegylation, acetylation, glycosylation, biotinylation, prenylation, or substitution of D-amino acids and / or non-natural amino acids of the antibody or binding fragment thereof. The antibody or binding fragment thereof can comprise one or more atypical disulfide bonds, e.g., at IMGT positions 54 and 78, to increase stability, protease resistance, serum stability, and / or bioavailability. Accordingly, in some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 comprises one or more atypical disulfide bonds to increase stability, protease resistance, serum stability, and / or bioavailability. In some embodiments, the one or more atypical disulfide bonds are at IMGT positions 54 and 78.

[0114] As understood in the art, the amino acid positions or boundaries describing antibody CDR regions can vary, depending on the context and different definitions known in the art. Some positions within the variable region can be considered hybrid CDRs, as these positions can be within a CDR region according to one set of criteria, while considered outside of a CDR region according to another set of criteria. In some embodiments, CDRs in the variable light and variable heavy chains can be described using the IMGT, Kabat, Chothia, AbM, Contact, or Paratome schemes, or another scheme known in the art. The "Kabat" method for defining CDRs uses sequence variability (Kabat et al. (1991); incorporated herein by reference). "Chothia" uses the positions of structural loops (Chothia and Lesk, (1987), Chothia et al. (1992); incorporated herein by reference). The IMGT numbering scheme is adapted from Chothia's numbering scheme (Lefranc et al., (1999); see also http: / / imgt.cines.fr; incorporated herein by reference). CDRs defined by "AbM" are a compromise between Kabat and Chothia, and are described using the Oxford Molecular AbM antibody modeling software (see Martin et al. (1989); see also www.bioinf-org.uk / abs; incorporated herein by reference). The antibody numbering scheme developed by the Computational Chemistry Group (CCG) combines several antibody numbering schemes and provides a more extensive definition of CDR boundaries based on the CDR definition of Martin and coworkers (see Maier et al. (2014); incorporated herein by reference). The "Contact" CDRs are based on an analysis of known antibody-antigen crystal structures (see, e.g., MacCallum et al. (1996)). The "Paratome" method involves a computational procedure based on a set of consensus regions derived from a structural alignment of a non-redundant set of known antibody-antigen complexes (Kunik et al. (2012); see also www.ofranlab.org / paratome / ; incorporated herein by reference). The "Aho" or Honegger scheme numbers variable domains of the immunoglobulin superfamily in a homology-modeled form. The system is based on a structural alignment of 3D structures of immunoglobulin variable regions covering observed lengths. It allows definition of structurally conserved C alpha positions and thus deduces appropriate framework regions and CDR lengths (see H Honegger, A. and Pluckthun A. (2001); incorporated herein by reference).The CDRs described herein include CDRs based on the CCG, Paratome, Kabat, Chothia, or Aho definitions (see Table 7), and it should be understood that CDRs based on other methods are also included herein. In some embodiments, the CDRs described herein are based on IMGT, CCG, Paratome, Kabat, Chothia, or Aho.

[0115] In exemplary embodiments of the present disclosure, the isolated antibody or binding fragment thereof that binds to a misfolded superoxide dismutase 1 (SOD1) epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, comprises:

[0116] (i) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6;

[0117] (ii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0118] (iii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0119] (iv) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0120] (v) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0121] (vi) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58;

[0122] (vii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or

[0123] (viii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0124] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0125] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0126] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0127] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0128] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0129] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.

[0130] In some embodiments, the isolated antibody or binding fragment thereof binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28.

[0131] In some embodiments, the isolated antibody or binding fragment thereof binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0132] In some embodiments, the CDRs described herein have one or two positions of mutation. In some embodiments, the CDRs comprising one or two positions of mutation retain specific binding activity for a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144.

[0133] In some embodiments, the isolated antibody or binding fragment thereof binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising:

[0134] (i) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, the heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, and the light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0135] (ii) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0136] (iii) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0137] (iv) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0138] (v) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0139] (vi) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0140] (vii) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86; or

[0141] (viii) a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91.

[0142] In some embodiments, the isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70.

[0143] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70.

[0144] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76.

[0145] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76.

[0146] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82.

[0147] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82.

[0148] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86.

[0149] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, and a light chain comprising a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91.

[0150] In some embodiments, the percentage identity is outside of the CDRs described herein.

[0151] In some embodiments, the antibody binding fragment is a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, diabody, minibody, bispecific antibody binding fragment, or a bispecific antibody binding fragment. In some embodiments, the antibody binding fragment is a scFv.

[0152] Also provided is an isolated antibody that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody comprising:

[0153] (i) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 109, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 114;

[0154] (ii) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 112, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 114;

[0155] (iii) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 116, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 120;

[0156] (iv) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 118, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 120;

[0157] (v) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 122, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 126;

[0158] (vi) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 124, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 126;

[0159] (vii) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 128, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 130; or

[0160] (viii) a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 132, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 135.

[0161] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 109, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 114.

[0162] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 112, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 114.

[0163] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 116, and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 120.

[0164] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 118 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 120.

[0165] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 122 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 126.

[0166] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 124 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 126.

[0167] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 128 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 130.

[0168] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 132 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 135.

[0169] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 93 and a light chain comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 95.

[0170] In some embodiments, the percent identity is outside of the CDRs described herein.

[0171] B. Modified Antibodies and Antibody Analogs

[0172] In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 comprises one or more L-amino acids, D-amino acids, and / or non-standard amino acids. In various embodiments, the antibody or binding fragment thereof comprises amino acids, including the carboxy terminal amino acid and / or the amino terminal amino acid of the antibody, or the antibody or binding fragment thereof can be modified by pegylation, methylation, amidation, acetylation, prenylation, and / or substitution with other chemical groups that can alter the circulating half-life of the antibody or binding fragment thereof without adversely affecting its activity. Examples of non-conventional or non-natural amino acids include, but are not limited to, citrulline, ornithine, norleucine, norvaline, 4-(E)-butenyl-4(R)-methyl-N-methyl threonine (MeBmt), N-methyl-leucine (MeLeu), aminobutyric acid, statine, and N-methyl-alanine (MeAla). The amino acids can participate in disulfide bonds. In some embodiments, the amino acid has the general structure H2N-C(H)(R)-COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a synthetic amino acid or a non-natural amino acid (e.g., an a, a-disubstituted amino acid, an N-alkyl amino acid); in some embodiments, the amino acid is a D-amino acid; in some embodiments, the amino acid is an L-amino acid. In some embodiments, the modified amino acid comprises a modification selected from the group of methylation, amidation, acetylation, and / or substitution with other chemical groups. In some embodiments, the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation, or prenylation.

[0173] The antibodies or binding fragments thereof described herein can be fused to an Fc domain and can also be multimeric, e.g., to generate bispecific / biparatopic molecules. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is fused to an Fc domain. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is multimeric. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is fused to an Fc domain and is multimeric.

[0174] The antibodies and binding fragments thereof are useful for diagnostic purposes, including in vivo imaging to identify endogenous sites of misfolded SOD1, as well as for sample testing to detect SOD1. The antibodies and binding fragments thereof are also useful for therapeutic purposes to treat diseases involving misfolded SOD1. In some embodiments, the antibodies or binding fragments thereof described herein are used to treat or diagnose a medical condition, disease, or disorder in a subject mediated by misfolded forms of SOD1.

[0175] For whatever purpose, the antibody or binding fragment can be coupled to a suitable agent, forming a conjugate. The active sequence-bearing antibody or binding fragment thereof is not significantly affected by the suitable agent. For diagnostic purposes, the suitable agent is a detectable label, including radioisotopes for whole body imaging or fluorescent labels, and radioisotopes, enzymes, peptides, fluorescent labels, etc. for sample testing. In these diagnostic methods, the agent can be used as a label directly, or indirectly as an agent that binds a desired label, such as a labeled secondary antibody that binds the agent. For diagnostics, the detectable label can be any of various types used in the field of in vitro diagnostics, including microparticle labels, including biotin / streptavidin, metal sols such as colloidal gold, radioisotopes such as I 125 or Tc 99 , chromophores (including fluorescent labels such as FITC and PE), luminescent labels, phosphorescent labels, etc., and enzyme labels that convert a given substrate to a detectable label, and polynucleotide labels that are revealed after amplification, such as by polymerase chain reaction. Suitable enzyme labels include horseradish peroxidase, alkaline phosphatase, etc. For example, the label can be the enzyme alkaline phosphatase, and the presence or formation of chemiluminescence after conversion of a luminescent substrate such as 1,2-dioxetane substrates such as adamantanemethoxypyrophenyldioxetane (AMPPD), 3-(4-(methoxyspiro{1,2-dioxetane-3,2'-(5'-chloro)tricyclo{3.3.1.13,7}decane}-4-yl)phenyl phosphate disodium (CSPD), and CDP-Star® and or other luminescent substrates (e.g. chelates of suitable lanthanides such as terbium (III) and europium (III)) that are chemiluminescent upon conversion as is known in the art. The means of detection is determined by the label chosen. The appearance of the label or its reaction products can be obtained by the naked eye, in the case of labels that are particulate or colored and accumulate at appropriate levels, or using instruments such as spectrophotometers, luminometers, fluorometers, etc., all of which are in accordance with standard practice. In some embodiments, the antibody or binding fragment thereof further comprises a suitable agent as described herein. In some embodiments, the antibody or binding fragment thereof further comprises a detectable label as described herein.

[0176] Imaging agents can be included in the composition or additional compositions. Suitable imaging agents include commercially available agents for positron emission tomography (PET), computed axial tomography (CAT), single photon emission computed tomography, x-ray, fluoroscopy, and magnetic resonance imaging (MRI).

[0177] Imaging agents for use with antibodies or binding fragments thereof to screen endogenous sites for misfolded SOD1 include metals, radioisotopes, and radio-opaque agents (e.g., gallium, technetium, indium, strontium, iodine, barium, bromine, and phosphorus-containing compounds), radio- transparent agents, contrast agents, dyes (e.g., fluorescent dyes and chromophores), and enzymes that catalyze colorimetric or fluorescent reactions. Generally, these agents can be attached or captured using various techniques as described above, and can be present in any orientation. See, e.g., U.S. Patent Nos. 6,391,280; 7,875,454; 8,102,945; 10,086,073; and 10,449,261, expressly incorporated herein by reference.

[0178] Contrast agents according to the present disclosure can be used in imaging modalities such as X-ray contrast agents, optical imaging probes, spin labels, or radioactive units. Examples of suitable materials for use as contrast agents in MRI include the currently available gadolinium chelates such as diethylene triamine pentaacetic acid (DTPA) and gadopentetic acid dimeglumine, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials useful for CAT and x-ray include iodine-based materials such as ionic monomers represented by diatrizoate and iopanoic acid, non-ionic monomers such as iopamidol, iohexol, and ioversol, non-ionic dimers such as iotrol and iodixanol, and ionic dimers such as ioxagalte.

[0179] Agents for use in PET scanning include N 13 and fluorodeoxyglucose (FDG).

[0180] In some embodiments, the detectable label is a peptide label comprising three or more amino acid residues at the C-terminus, the N-terminus, or both the C-terminus and the N-terminus. In some embodiments, the antibody or binding fragment thereof comprises one or more peptide labels. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide labels comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at the N-terminus. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide labels comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at the C-terminus. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide labels comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at both the C-terminus and the N-terminus.

[0181] C. Misfolded specific ubiquitin ligase fusion proteins

[0182] The present disclosure also provides fusion proteins comprising an antibody or binding fragment thereof that binds to misfolded SOD1 and an E3 ligase or active fragment thereof. In some embodiments, the fusion protein comprises an antibody or binding fragment thereof described herein and an E3 ligase or active fragment thereof. The sequence of the E3 ligase described herein, a truncated form thereof, or an active fragment thereof can have at least 85% identity and retain ubiquitin ligase activity.

[0183] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds to an epitope of misfolded SOD1 having the amino acid sequence of SEQ ID NO: 142 or 144, including:

[0184] (i) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6;

[0185] (ii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0186] (iii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12;

[0187] (iv) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0188] (v) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13;

[0189] (vii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, respectively, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, respectively.

[0190] (vii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, respectively, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, respectively.

[0191] (vii) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, respectively, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, respectively.

[0192] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0193] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0194] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0195] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0196] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0197] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.

[0198] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28.

[0199] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0200] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 97, SEQ ID NO: 99, and SEQ ID NO: 101, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 103, SEQ ID NO: 105, and SEQ ID NO: 107.

[0201] In some embodiments, the CDRs described herein have one or two positions of mutation. In some embodiments, the CDRs comprising one or two positions of mutation retain specific binding activity for a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144.

[0202] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising:

[0203] (i) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0204] (ii) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70;

[0205] (iii) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0206] (iv) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76;

[0207] (v) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0208] (vi) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82;

[0209] (vii) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86; or

[0210] (viii) a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91.

[0211] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70.

[0212] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68 and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70.

[0213] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76.

[0214] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76.

[0215] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82.

[0216] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82.

[0217] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86.

[0218] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof, and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain having a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, and a light chain having a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91.

[0219] In some embodiments, the fusion protein comprises a heavy chain variable region, a first linker, a light chain variable region, a second linker, and an active E3 ligase fragment. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186 or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 88, a first linker, a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 91, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the antibody or antigen-binding fragment thereof or fusion protein described herein further comprises a methionine or signal peptide at the N-terminus. In some embodiments, the polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 65, 68, 72, 74, 78, 80, 84, 88, 162, 164, 166, 168, 170, 172, 174, or 176 further comprises a methionine or signal peptide at the N-terminus. In some embodiments, the signal peptide is not at the N-terminus, e.g., it can be present in the fusion protein and can not function as a cleavage site. In other embodiments, the antibody or antigen-binding fragment thereof or fusion protein lacks any signal peptide. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 224. In some embodiments, the polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 82, 86, 91, 166, 168, 170, 172, 174, or 176 further comprises a methionine or signal peptide at the N-terminus. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 225. In some embodiments, the polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 70, 162, or 164 further comprises a methionine or signal peptide at the N-terminus. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 226.In some embodiments, any antibody, antigen binding fragment, fusion protein, or polypeptide described herein can have or lack a signal peptide and / or methionine at the N-terminus. In some embodiments, any of the amino acid sequences in Table 5, Table 6, or Table 12 can have or lack a signal peptide and / or methionine at the N-terminus. In some embodiments, any antibody, antigen binding fragment, fusion protein, or polypeptide described herein can have or lack a signal peptide of optional SEQ ID NO: 224, 225, or 226. In some embodiments, a polypeptide comprising an amino acid sequence that is at least 85% identical to the amino acid sequence of SEQ ID NO: 166, 168, 170, 172, 174, or 176 can have a deletion of the amino acid sequence comprising SEQ ID NO: 225. In some embodiments, a polypeptide comprising an amino acid sequence that is at least 85% identical to the amino acid sequence of SEQ ID NO: 162 or 164 can have a deletion of the amino acid sequence comprising SEQ ID NO: 226. In some embodiments, a signal peptide can be used as a linker. In some embodiments, a first linker comprises the amino acid sequence GSGSG (SEQ ID NO: 222) or SEQ ID NO: 221. In some embodiments, a second linker comprises the amino acid sequence GSGSG (SEQ ID NO: 222) or SEQ ID NO: 221. In some embodiments, a fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NO: 162, 164, 166, 168, 170, 172, 174, and 176. In some embodiments, a fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NO: 162, 164, 166, 168, 170, 172, 174, and 176, and further comprises a 6-His tag or a FLAG tag at the 5’ end or the 3’ end. In some embodiments, a fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NO: 162, 164, 166, 168, 170, 172, 174, and 176, and further comprises a 6-His tag at the 3’ end. Sequences described herein can add and / or delete tags such as 6-His tags or FLAG tags and nucleic acids encoding these tags.

[0220] The E3 ligase that is used as part of the fusion protein can be a member of the E3 ligase family U-BOX, HECT, F-BOX, RBR, or RING. In some embodiments, the E3 ligase is a member of the U-BOX, HECT, F-BOX, RBR, or RING family of E3 ligases, or an active fragment thereof. In some embodiments, the member of the U-BOX family of ligases is CHIP, UBE4A, or UBOX5 (RNF37), or an active fragment thereof. In some embodiments, the member of the HECT family of ligases is NEDD4L or UBR5, or an active fragment thereof. In some embodiments, the member of the F-BOX family of ligases is BTrCP, or an active fragment thereof. In some embodiments, the member of the RBR family is Parkin, or an active fragment thereof. In some embodiments, the member of the RING family is RNF4, or an active fragment thereof. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 145, 147, 149, 151, 153, 155, 157, and 159. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 128-303 of SEQ ID NO: 145. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 873-1066 of SEQ ID NO: 147. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 2-340 of SEQ ID NO: 149. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 616-975 of SEQ ID NO: 151. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 2455-2799 of SEQ ID NO: 153.In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 1-261 of SEQ ID NO: 155. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 220-465 of SEQ ID NO: 157. In some embodiments, the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 76-190 of the sequence of SEQ ID NO: 159. The sequence of any one of SEQ ID NOs: 145, 147, 149, 151, 153, 155, 157, and 159. In some embodiments, the active fragment of the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the active fragment of the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193, or a truncated E3 ligase comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the active fragment of the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 186-193. In some embodiments, the active fragment of the E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186.In some embodiments, the active E3 ligase comprises a truncated E3 ligase having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the percent identity is outside of the CDRs described herein.

[0221] D. Nucleic Acids

[0222] Nucleic acids encoding the antibodies or binding fragments or fusion proteins thereof described herein are also provided. Nucleic acid sequences encoding the antibodies or binding fragments or fusion proteins thereof can be expressed in a variety of host cells that secrete the expression product, including E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells, such as COS, CHO, and HeLa cell lines and myeloma cell lines. The recombinant protein genes are operably linked to appropriate expression control sequences for each host. For E. coli, this includes a promoter (such as T7, trp, or lambda promoter), a ribosome binding site, and preferably a transcription termination signal. For eukaryotic cells, the control sequences include a promoter, and can include enhancers derived from immunoglobulin genes, SV40, cytomegalovirus, and the like, as well as polyadenylation sequences, and can include splice donor and acceptor sequences.

[0223] Vectors of the present disclosure can be transferred into selected host cells by well-known methods, such as calcium chloride transformation for E. coli and calcium phosphate treatment or electroporation for mammalian cells. Cells transformed with the vectors can be selected by antibiotic resistance conferred by genes on the vector, such as amp, gpt, neo, and hyg genes. In addition, nucleic acids can be introduced into mammalian cells by viral vectors.

[0224] Once expressed and secreted, the antibodies or binding fragments or fusion proteins thereof can be purified according to standard procedures in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis, and the like (see Scopes, R. K. Protein Purification: Principles and Practice. Springer Science & Business Media, 2013; Burgess, Richard R., and Murray P. Deutscher, eds. Guide to Protein Purification. Academic Press, 2009). Substantially pure compositions of at least about 90-95% homogeneity can be obtained, and 98-99% or greater homogeneity can also be obtained for pharmaceutical uses. Once partially or substantially pure, the antibodies or binding fragments or fusion proteins thereof can be used therapeutically.

[0225] Accordingly, isolated antibodies or binding fragments thereof that bind to a misfolded SOD1 epitope having an amino acid sequence of SEQ ID NO: 142 or 144 are also provided, the antibodies or binding fragments thereof comprising:

[0226] (i) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 66 or 67, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71;

[0227] (ii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 69, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71;

[0228] (iii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 73, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77;

[0229] (iv) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 75, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77;

[0230] (v) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 79, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83;

[0231] (vi) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 81, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83;

[0232] (vii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 85, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 87; or

[0233] (viii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 89 or 90, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 92;

[0234] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 66 or 67, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71.

[0235] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 69, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71.

[0236] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence of SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 73, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77.

[0237] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 75, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77.

[0238] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 79, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83.

[0239] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 81, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83.

[0240] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 85, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 87.

[0241] In some embodiments, the isolated antibody or binding fragment thereof that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 89 or 90, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 92.

[0242] In some embodiments, the percent identity is outside of the CDRs described herein.

[0243] Also provided is an isolated antibody that binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising:

[0244] (i) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 110 or 111, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 115;

[0245] (ii) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 113, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 115;

[0246] (iii) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 117, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 121;

[0247] (iv) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 119, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 121;

[0248] (v) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 123, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 127;

[0249] (vi) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 125, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 127;

[0250] (vi) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 129, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 131; or

[0251] (vii) a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 133 or 134, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 136.

[0252] In some embodiments, the isolated antibody binds a misfolded SODl epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 110 or 111, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 115.

[0253] In some embodiments, the isolated antibody binds a misfolded SODl epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 113, and a light chain encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 115.

[0254] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 117, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 121.

[0255] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 119, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 121.

[0256] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 123, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 127.

[0257] In some embodiments, the isolated antibody binds a misfolded SODl epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 125, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 127.

[0258] In some embodiments, the isolated antibody binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 129, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 131.

[0259] In some embodiments, the isolated antibody binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising a heavy chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 133 or 134, and a light chain encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 136.

[0260] Also provided are fusion proteins comprising an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising:

[0261] (i) a heavy chain comprising a heavy chain variable region, and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 66 or 67, and wherein the light chain variable region is encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71;

[0262] (ii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 69, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71 ;

[0263] (iii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 73, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77;

[0264] (iv) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 75, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77;

[0265] (v) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 79, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83;

[0266] (xii) a heavy chain comprising a heavy chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 81, and a light chain comprising a light chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83;

[0267] (xiv) a heavy chain comprising a heavy chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 85, and a light chain comprising a light chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 87; or

[0268] (xv) a heavy chain comprising a heavy chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 89 or 90, and a light chain comprising a light chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 92.

[0269] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 66 or 67, and a light chain comprising a light chain variable region encoded by a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71.

[0270] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 69, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 71.

[0271] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 73, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77.

[0272] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having an amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 75, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 77.

[0273] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142 or 144, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 79, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83.

[0274] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 81, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83.

[0275] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 81, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 83.

[0276] In some embodiments, the fusion protein comprises an E3 ligase or active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence of SEQ ID NO: 142, the antibody or binding fragment thereof comprising a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 89 or 90, and wherein the light chain variable region is encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 92.

[0277] In some embodiments, the active fragment of the E3 ligase comprises an amino acid sequence encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 146, 148, 150, 152, 154, 156, 158, and 160. In some embodiments, the fusion protein comprises an amino acid sequence encoded by a nucleic acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 161, 163, 165, 167, 169, 171, 173, 175, and 179-185.

[0278] In some embodiments, the percent identity is outside of the CDRs described herein.

[0279] In some embodiments, the antibody or antigen-binding fragment thereof or fusion protein described herein comprises the sequence shown in Table 4, wherein the N-terminal methionine is deleted. In some embodiments, the antibody or antigen-binding fragment thereof or fusion protein described herein comprises the sequence shown in Table 4, wherein the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids are deleted and optionally replaced by a methionine. In some embodiments, the sequence shown in Table 4 further comprises a signal peptide at the N-terminus. In some embodiments, the antibody or antigen-binding fragment thereof or fusion protein described herein comprises the sequence shown in Table 5, wherein the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids are deleted. In some embodiments, the antibody or antigen-binding fragment thereof or fusion protein described herein comprises the sequence shown in Table 5, wherein the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids are deleted and optionally replaced by a methionine.

[0280] In some embodiments, the polypeptides disclosed herein are encoded by a nucleic acid.

[0281] In some embodiments, vectors comprising nucleic acids encoding the antibodies or binding fragments thereof or fusion proteins comprising the E3 ligase or active fragment thereof described herein and the antibody or binding fragment thereof are also provided. To express the antibody or fragment thereof or fusion protein, the nucleic acid is operably linked to transcriptional and translational control sequences. Useful vectors include plasmids, retroviruses, cosmids, and the like. Selection of an appropriate vector and expression control sequences will be determined by

[0282] III. Pharmaceutical formulations and agents

[0283] In another aspect, the antibodies or binding fragments thereof, fusion proteins, or nucleic acids described herein, and variants and modifications thereof, are provided as pharmaceutical compositions for therapeutic use. In one embodiment, the pharmaceutical formulation comprises an isolated antibody or binding fragment thereof or fusion protein described herein.

[0284] Representative delivery protocols include oral, parenteral (including subcutaneous, intramuscular, and intravenous injection), rectal, buccal (including sublingual), transdermal, inhalation, ocular, and intranasal. In one embodiment, delivery of the compound requires subcutaneous injection of a controlled release injectable formulation. In some embodiments, the compounds described herein are useful for subcutaneous, intranasal, and inhalation administration.

[0285] The exact dosage and composition and the choice of the most suitable delivery protocol will be influenced by factors such as the pharmacological properties of the selected antibody or binding fragment thereof, fusion protein, or nucleic acid, the nature and severity of the condition being treated, and the physical condition and mental acuity of the recipient. Moreover, the route of administration will result in varying amounts of the absorbed substance. Bioavailability of compounds administered by different routes varies greatly, from less than 1% to nearly 100%. Generally, bioavailability for routes other than intravenous, intraperitoneal, or subcutaneous injection is 50% or less.

[0286] The pharmaceutical compositions or formulations of the present disclosure can be formulated with a physiologically acceptable carrier or excipient to prepare a pharmaceutical composition. The carrier and composition can be sterile. The formulation should suit the mode of administration, e.g., intravenous or subcutaneous administration. Methods of formulating compositions are known in the art (see, e.g., Remington's Pharmaceuticals Sciences, 17th Edition, Mack Publishing Co., (Alfonso R. Gennaro, editor) (1989); incorporated herein by reference).

[0287] Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions (e.g., NaCl), saline, buffered saline, alcohol, glycerol, ethanol, acacia, vegetable oils, benzyl alcohol, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, sugar such as mannitol, sucrose or other, dextrose, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidone, etc., and combinations thereof. If desired, the pharmaceutical formulations can be mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, and / or aromatics, etc.) which do not deleteriously react with the active compounds or interfere with their activity. In one embodiment, a water-soluble carrier suitable for intravenous administration is used. Pharmaceutically acceptable salts retain the desired biological activity of the parent antibody or binding fragment thereof, without toxic side effects.

[0288] The composition or medicament can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. The composition can be a liquid solution, suspension, emulsion, sustained-release formulation, or powder. The composition can also be formulated as a suppository, with traditional binders and vehicles such as triglycerides.

[0289] The composition or medicament can be formulated into a pharmaceutical composition suitable for human administration according to conventional procedures. For example, in one embodiment, the composition for intravenous administration is generally a solution in sterile isotonic aqueous buffer. Where necessary, the composition can also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or aqueous

[0290] In some embodiments, the pharmaceutical composition comprises a liquid carrier such as, but not limited to, water, saline, phosphate buffered saline, Ringer's solution, dextrose solution, serum-containing solutions, Hank's solution, other physiologically balanced salt solutions, oils, esters, and glycols.

[0291] The antibody or binding fragment thereof, fusion protein, or nucleic acid described herein can be formulated in neutral or salt forms. Pharmaceutically acceptable salts include, as indicated above, salts of an amino group formed with inorganic acids such as hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and salts formed with an organic acid such as, for example, methanesulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, malic acid, lactic acid, benzoic acid, acetic acid, salicylic acid, etc., and salts formed with an organic base, such as isopropylamine, trimethylamine, 2- ethylamino ethanol, histidine, procaine, etc.

[0292] The pharmaceutical formulations of the present disclosure contain, as the binding agent, an antibody or binding fragment thereof, which can be mixed with excipients, diluted by excipients, or enclosed in a carrier which can be in the form of a capsule, sachet, paper, or other container according to well-known methods and pharmaceutical compositions. The compositions can be administered by any route suitable for the antibody or binding fragment thereof, fusion protein, or nucleic acid, including parenterally, intravenously, subcutaneously, or intramuscularly. Typically, the antibody or binding fragment thereof, fusion protein, or nucleic acid is dissolved or suspended in a sterile injectable solution at a concentration sufficient to provide the desired dosage in 0.5 ml to 2 ml or less. Pharmaceutical compositions of the present disclosure suitable for parenteral administration include one or more compounds of the present disclosure in combination with one or more pharmaceutically acceptable, sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or dry powders to be reconstituted into sterile injectable solutions or dispersions prior to use, which can contain antioxidants, buffers, solutes to make the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

[0293] Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers, such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the particular polymer used, the release of drug can be controlled. Examples of other biodegradable polymers include polyorthoesters and polyanhydrides. Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.

[0294] The pharmaceutical compositions can be provided in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier, such as water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type described above.

[0295] IV. Methods of Treatment and Use

[0296] Methods of treatment and use of diseases and conditions mediated by misfolded SOD1 (e.g., amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, or Parkinson’s disease, or frontotemporal dementia) are contemplated. Misfolded SOD1 targets provide an opportunity for an antibody or binding fragment thereof, fusion protein, or nucleic acid (such as those described herein) to treat or prevent diseases and conditions mediated by misfolded SOD1.

[0297] Accordingly, in one embodiment, there is provided a method of treating a medical condition, disease, or disorder mediated by misfolded forms of SOD1 in a subject in need thereof, the method comprising administering to the subject an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded forms of SOD1 comprise SOD1 monomers, dimers comprising SOD1 monomers, or aggregates comprising SOD1 monomers and / or dimers or toxic trimers. In some embodiments, the SOD1 monomers comprise mutant SOD1 monomers. In some embodiments, the mutant SOD1 monomers comprise one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation. In some embodiments, the mutant SOD1 monomers comprise one or more mutations selected from Table 1.

[0298] Table 1. List of SOD1 mutations detected in ALS (including FALS).

[0299]

[0300]

[0301] Also provided is the use of an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein for treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises a SOD1 monomer, a dimer comprising a SOD1 monomer, or an aggregate comprising a SOD1 monomer and / or dimer or toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0302] Also provided is the use of an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein in the manufacture of a medicament for treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises a SOD1 monomer, a dimer comprising a SOD1 monomer, or an aggregate comprising a SOD1 monomer and / or dimer and a toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0303] Also provided are the antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions described herein for use in treating or preventing a disease in a subject. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson’s disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises a SOD1 monomer, a dimer comprising a SOD1 monomer, or an aggregate comprising a SOD1 monomer and / or dimer and a toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0304] In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition can be administered in combination with one or more other therapeutic agents. Co-administration includes simultaneous administration in separate compositions, administration at different times, or administration in the presence of a combination of the two agents. In some embodiments, the other therapeutic agent is an ALS therapeutic agent. In some embodiments, the ALS therapeutic agent is tofersen (Qalsody), AMX0035 (RELYVRIO), edaravone (Radicava TM ), riluzole (Rilutek), thickened riluzole (Tiglutik), riluzole oral film (Exservan TM ) or In some embodiments, the ALS therapeutic agent is an antisense oligonucleotide. In some embodiments, the ALS therapeutic agent is tofersen.

[0305] V. Routes of administration

[0306] The antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 can be administered by any suitable route. In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition is administered parenterally. In some embodiments, the parenteral administration is selected from intravenous, intradermal, inhalation, transdermal (topical), intraocular, intramuscular, subcutaneous, intramuscular, and / or transmucosal administration. In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein is administered subcutaneously. As used herein, the term "subcutaneous tissue" is defined as a loose, irregular layer of connective tissue immediately beneath the skin. For example, subcutaneous administration can be performed by injection of the composition into an area including, but not limited to, the thigh, abdomen, buttocks, or shoulder blade. In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein is administered intravenously. In other embodiments, the antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 are administered by direct administration to the target tissue, nervous system (e.g., direct injection into the brain; intracerebroventricular; intrathecal). Alternatively, the antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 (or compositions or medicaments described herein containing the misfolded SOD1 antibodies or binding fragments thereof, fusion proteins, or nucleic acids) can be administered by inhalation, parenterally, intradermally, transdermally, or transmucosally (e.g., orally or nasally). If desired, more than one route can be used simultaneously.

[0307] In some embodiments, the antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 are administered orally. In some embodiments, the present disclosure provides a solid dosage form of an antibody or fragment described herein that binds to misfolded SOD1, fusion protein, or pharmaceutical composition thereof for oral administration, comprising (a) an antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, (b) at least one pharmaceutically acceptable pH-lowering agent, (c) at least one absorption enhancer effective to increase bioavailability of the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, and (d) a protective medium. In some embodiments, the solid dosage form is a capsule or a tablet.

[0308] The present disclosure also contemplates other methods for administering the antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions across the blood-brain barrier, such as those described in U.S. Patent 7,012,061, "Methods of increasing blood-brain barrier permeability," which is incorporated herein by reference, that are intended to temporarily increase blood-brain barrier permeability.

[0309] Those skilled in the art will recognize various suitable methods of administering the compounds of the present application directly to the brain or across the blood-brain barrier, and will be able to modify these methods to safely administer the products of the present application.

[0310] VI. Administration and Formulations

[0311] An effective amount of an antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, or a nucleic acid encoding the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition is used in the treatment. The dosage of the antibody or fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition used in accordance with the present disclosure varies depending on the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition, and the condition being treated.

[0312] The dosage form is optionally a liquid dosage form. The term "liquid dosage form" refers to a non-solid dosage form suitable for, but not limited to, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraventricular, intrathecal, intraorbital, intraocular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration. Solutions of the compounds of the present application can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol. Under normal storage and use conditions, these preparations contain a preservative to retard the growth of microorganisms. Those skilled in the art know how to prepare suitable preparations. For example, conventional procedures and ingredients for selecting and preparing suitable formulations are described in Remington's Pharmaceutical Sciences (2003 - 20th Edition) and United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999. The formulations optionally contain excipients, including but not limited to, buffers, antioxidants, stabilizers, carriers, diluents, and pH adjusting agents.

[0313] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists.

[0314] Those skilled in the art will recognize that the dosage form and formulation selected depends on the nature of the composition. For example, those skilled in the art know that a composition comprising an antibody can require a different formulation than a composition comprising a nucleic acid, and will select a formulation and dosage form appropriate for that composition.

[0315] Other factors that affect the effective dose of a formulation include the route of administration, the target site, the physiological state of the subject, the species of the subject, whether the treatment is prophylactic or therapeutic, and whether other drugs are being administered in addition to the formulation.

[0316] Antibodies, e.g., anti-SOD1 antibodies, such as scFv or fusion proteins comprising scFv, can be used by intravenous infusion. The therapeutic concentration of SOD1 scFv or scFv-E3 ligase fusion proteins can be 1 microgram - 10 microgram / mL in local concentration in the CNS. Without disruption of the blood brain barrier (BBB), only 1 / 100 to 1 / 1000 of antibodies, e.g., IgG, penetrate the CNS. Thus, the concentration of therapeutic antibodies in the peripheral circulation needed to achieve this concentration in the CNS is approximately 100 microgram / ml, up to 10 mg / ml, close to the pre-treatment level of antibodies in human plasma. Given that the blood volume of a human is approximately 5 liters, a dose of 50 grams would be the upper limit, similar to the dose of pooled polyclonal intravenous immunoglobulin (IVIG) used to treat many conditions. Given that degradation of human antibodies, e.g., IgG, takes 3-4 weeks, dosing once every 3 weeks should constitute an effective regimen. However, the dose of scFv or scFv-E3 ligase fusion proteins can be higher or lower than the above calculation, depending on the specifics of the particular condition. For example, mild disruption of the BBB has been found in ALS, and this disruption can be most severe in areas of most severe neuroinflammation, e.g., areas where the disease is most apparent, such as the anterior horn motor neurons and cortical motor neurons, and fiber tracts innervated by certain cortical motor neurons. Thus, in areas of most severe disease, selective BBB disruption can lower the circulating concentration of anti-misfolded SOD1 antibodies needed to achieve a therapeutic effect.

[0317] Antibodies or fusion proteins described herein can be used for direct infusion into the CNS by intraventricular routes or by intrathecal routes. An example of medical equipment for this purpose is manufactured by MedTronic. Because CSF is recirculated several times a day, continuous infusion is needed, rather than a 3-4 week dosing regimen. By infusing up to 5 mg per day in 500 mL of CSF per day, a final concentration of 1 microgram - 10 microgram per mL can be achieved.

[0318] Various embodiments can include different dosing regimens. In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1 is administered by continuous infusion. In some embodiments, the continuous infusion is intravenous. In other embodiments, the continuous infusion is subcutaneous. Alternatively or additionally, in some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1 is administered every two months, every month, twice a month, every three weeks, every two weeks, every week, twice a week, three times a week, every day, twice a day, or in another clinically desirable dosing regimen. The dosing regimen for an individual subject need not be at fixed intervals, but can vary over time according to the needs of the subject.

[0319] In one embodiment, the local dose is administered at least once a day until a therapeutic result is achieved. While the dose can be administered twice a day, more or less frequent dosing can be appropriate. Once a therapeutic effect is achieved, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition of interest can be gradually reduced or discontinued. At times, side effects require that treatment be stopped. An effective amount of the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition of interest is used in the treatment. The dose should be sufficient to ameliorate symptoms or signs of the disease being treated without unacceptably toxic side effects to the patient.

[0320] The antibody or binding fragment thereof or fusion protein described herein can be delivered by any method known to the skilled artisan, e.g., by delivery using a recombinant viral vector. In some embodiments, the antibody or binding fragment thereof or fusion protein described herein is delivered by a recombinant viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated virus (AAV) vector, a herpes simplex virus (HSV) vector, a lentivirus vector, a retrovirus vector, an SV-40 type virus vector, or a vaccinia virus vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector is an AAV9 vector. In some embodiments, the AAV vector has an engineered capsid effective to transduce the central and / or peripheral nervous system. In some embodiments, the AAV is AAV-PHP.eB.

[0321] The recombinant viral vector can comprise regulatory sequences, such as promoters, enhancers, internal ribosome entry sites (IRES), and / or sequences encoding protein transduction domains (PTDs), that allow expression of the encoded antibody or binding fragment thereof or fusion protein. In some embodiments, the viral vector comprises a promoter region operably linked to the coding sequence to cause or improve expression of the antibody or binding fragment thereof or fusion protein. In some embodiments, the promoter is ubiquitous, tissue-specific, strong, weak, regulated, or chimeric to allow efficient and appropriate production of the antibody or binding fragment thereof or fusion protein. In some embodiments, the promoter is cellular, viral, fungal, plant, or synthetic. In some embodiments, the promoter used functions in neural and muscle cells. In some embodiments, the promoter functions in motor neurons and glial cells. In some embodiments, the promoter functions in neurons, glial cells, and skeletal muscle cells, e.g., the promoter is a neural-specific promoter, a glial-specific promoter, or a skeletal muscle-specific promoter, wherein, e.g., the operably linked sequence is not substantially activated in other cell types. In some embodiments, the promoter is an RNA polymerase III-dependent promoter or an RNA polymerase II-dependent promoter. In some embodiments, the regulated promoter is a Tet-on / off element-containing promoter, a rapamycin-inducible promoter, or a metallothionein promoter. In some embodiments, the motor neuron-specific promoter is a calcitonin gene-related peptide (CGRP) promoter, a choline acetyltransferase (ChAT) promoter, or a homeobox 9 (HB9) promoter. In some embodiments, the neuron-specific promoter is a neuron-specific enolase (NSE) promoter, a synapsin promoter, or a neuron-restrictive silencer element (NRSE) promoter. In some embodiments, the glial cell-specific promoter is a glial fibrillary acidic protein (GFAP) promoter. In some embodiments, the promoter is a CMV promoter, an RSV promoter, an SV40 promoter, or a chicken beta actin / CMV (CBA) promoter. In some embodiments, the promoter is a phosphoglycerate kinase (PGK) promoter or an elongation factor 1 alpha (EF1 alpha) promoter. In some embodiments, the promoter is a prion promoter. In some embodiments, the promoter is a CAG promoter.

[0322] The recombinant viral vector for delivery and expression of mUBL can be delivered by direct stereotactic brain infusion, spinal cord injection, intravascular delivery, or intramuscular delivery, at a pharmaceutically acceptable dose. In some embodiments, the recombinant viral vector encoding mUBL is administered by stereotactic brain infusion or spinal cord injection. In some embodiments, the recombinant viral vector encoding mUBL is administered intravascularly or intramuscularly.

[0323] VII. Kits

[0324] In some embodiments, the present disclosure also provides kits or other articles of manufacture containing an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein that binds to misfolded SOD1, as well as instructions for reconstitution (if lyophilized) and / or use thereof. The kits or other articles of manufacture can include containers, syringes, vials, and any other article of manufacture, device, or apparatus for administration (e.g., subcutaneously, by inhalation). Suitable containers include, for example, bottles, vials, syringes (e.g., pre-filled syringes), ampoules, cartridges, reservoirs, or lyo-jects. The containers can be formed from a variety of materials such as glass or plastic. In some embodiments, the container is a pre-filled syringe. Suitable pre-filled syringes include, but are not limited to, borosilicate glass syringes with baked silicone coating, silicone-coated borosilicate glass syringes, or plastic resin syringes without silicone.

[0325] Generally, the container can hold the formulation and a label on or associated with the container can indicate directions for reconstitution and / or use. For example, the label can indicate that the formulation is to be reconstituted to a concentration as described above. The label can further indicate that the formulation can be used or is intended for use, for example, for subcutaneous administration. In some embodiments, the container can comprise a single dose of a stable formulation comprising an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition bound to misfolded SOD1. In various embodiments, the single dose of the stable formulation is present in a volume of less than about 15 ml, about 10 ml, about 5.0 ml, about 4.0 ml, about 3.5 ml, about 3.0 ml, about 2.5 ml, about 2.0 ml, about 1.5 ml, about 1.0 ml, or about 0.5 ml. Alternatively, the container holding the formulation can be a multi-use vial that allows for repeated administration (e.g., 2-6 administrations) of the formulation. The kit or other article of manufacture can further include a second container comprising a suitable diluent (e.g., BWFI, saline, buffered saline). Upon mixing the diluent and the formulation, the final polypeptide or nucleic acid concentration in the reconstituted formulation can be at least about 0.2 pg / ml (e.g., at least about 0.5 pg / ml, at least about 1 pg / ml, at least about 2 pg / ml, at least about 5 pg / ml, at least about 10 pg / ml, at least about 20 pg / ml, at least about 25 pg / ml, at least about 50 pg / ml, at least about 75 pg / ml, at least about 0.1 mg / ml, at least about 0.2 mg / ml, at least about 0.5 mg / ml, at least about 1 mg / ml, at least about 2 mg / ml, at least about 2.5 mg / ml, at least about 5 mg / ml, at least about 10 mg / ml, at least about 20 mg / ml, at least about 30 mg / ml, at least about 40 mg / ml, at least about 50 mg / ml, at least about 75 mg / ml, at least about 100 mg / ml). The kit or other article of manufacture can also include other materials as desired in the art and user, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In some embodiments, the kit or other article of manufacture can include instructions for self-administration.

[0326] The following non-limiting examples are illustrative of the disclosure: Example

[0327] Example 1. Epitope mapping of mouse antibodies 3H1 and 8D1

[0328] Peptide targets of misfolded, aggregated SOD1 were synthesized and characterized to biochemically characterize exposed epitopes to provide immunogens for the development of mouse monoclonal antibodies. The peptide DLGKGGNEESTKTG (SEQ ID NO: 137) was synthesized and conjugated to KLH (keyhole limpet hemocyanin) for immunization of mice. Since the sequence DLGKGGNEESTKTG (SEQ ID NO: 137) has no endogenous cysteine ​​residues, it was coupled to KLH using the sulfo-MBS method for sulfhydryl coupling (Pierce reagents and methods).

[0329] The SOD1 epitope DLGKGGNEESTKTG (SEQ ID NO: 137) was further analyzed to identify immunogenic sub-portions (e.g., discrete epitopes). Immunogenicity analysis of SOD1, including antigenicity mapping, was used to identify discrete epitopes. Isolated peptides corresponding to these discrete epitopes were synthesized, and immunogens containing isolated peptides corresponding to one or more of these discrete epitopes were used to generate antibodies.

[0330] Epitope mapping experiments were performed using isolated peptides to reveal the binding targets of the mouse anti-misfolded SOD1 antibodies 3H1 and 8D1. The isolated peptides used included DLGKGGNEESTKTG (SEQ ID NO: 137), GKGGNEESTKTGN (SEQ ID NO: 138), GGNEESTKTGNAG (SEQ ID NO: 139), NEESTKTGNAGSR (SEQ ID NO: 140), ESTKTGNAGSRLA (SEQ ID NO: 141), TKTGNAGSRLACG (SEQ ID NO: 194), and NAGSRLAZGVIGI (SEQ ID NO: 195). Figure 1 shows the results of the epitope mapping experiments. Experiments showed that 3H1 and 8D1 bind to at least the isolated peptides GKGGNEESTKTGN (SEQ ID NO: 138), GGNEESTKTGNAG (SEQ ID NO: 139), NEESTKTGNAGSR (SEQ ID NO: 140), and ESTKTGNAGSRLA (SEQ ID NO: 141), which represent a minimal epitope of ESTKTGN (SEQ ID NO: 144). This epitope, ESTKTGN (SEQ ID NO: 144), is located in the electrostatic loop of the DLGKGGNEESTKTG (SEQ ID NO: 137) portion of the SOD1 protein.

[0331] Example 2. Sequence of 3H1

[0332] The mouse 3H1 antibody was isolated and fully sequenced. RT-PCR was performed using 5' RACE and gene-specific reverse primers that amplify the appropriate mouse immunoglobulin heavy chain (IgG2a) and light chain (kappa) variable region sequences. The characteristic bands were excised and cloned into pCR-Blunt II-TOPO vectors for sequencing, and the constructs were transformed into E. coli. Prior to sequencing, at least 8 colonies were picked for each chain, and the presence of the amplified region was screened by PCR, and additional colonies were picked as needed (see Table 2). The selected PCR-positive clones were sequenced. The DNA sequences were analyzed by BLAST and SnapGene to confirm homology to mouse antibody sequences.

[0333] Table 2. Summary of 3H1 PCR detection and DNA sequencing

[0334] Sample Isotype Number of sequences of antibody ORF with correct isotype Mouse 3H1 IgG2a 8 Mouse 3H1 Kappa 6

[0335] DNA & amino acid sequence analysis The DNA sequences for the 3H1 heavy chain and K chain are shown in Table 4 below. The consensus DNA sequence and translated protein sequence for 3H1 are shown in Table 3. The ATG start codon and corresponding methionine amino acid are shown in italics, and the complementarity determining regions (CDRs) are shown in bold according to IMGT / LIGM-DB. 3H1 produces mRNA containing sequences encoding an IgG2a heavy chain and kappa. The consensus sequences for the heavy and light chain variable regions have been determined (see Table 3 for consensus sequences, and Table 4 for original sequences).

[0336] Table 3. Consensus DNA sequence and translated protein sequence for the 3H1 variable regions.

[0337]

[0338] The mouse 3H1 antibody has the following consensus heavy chain CDR sequences:

[0339] GSTFSNYW (SEQ ID NO: 97) corresponding to the nucleic acid sequence GGATCCACTTTCAGTAACTACTGG (SEQ ID NO: 98);

[0340] VAEIRLKSNT (SEQ ID NO: 99) corresponding to the nucleic acid sequence GTTGCTGAAATTAGATTGAAATCTAATACT (SEQ ID NO: 100); and

[0341] TGNAMDF (SEQ ID NO: 101) corresponding to the nucleic acid sequence ACCGGCAATGCTATGGACTTC (SEQ ID NO: 102).

[0342] The mouse 3H1 antibody has the following consensus light chain CDR sequences:

[0343] QSLVYSNGNTY (SEQ ID NO: 103) corresponds to the nucleic acid sequence CAGAGCCTTGTATATAGTAATGGAAACACCTAT (SEQ ID NO: 104);

[0344] KVS (SEQ ID NO: 105) corresponds to the nucleic acid sequence AAAGTTTCC (SEQ ID NO: 106); and

[0345] SQSTHVPPWT (SEQ ID NO: 107) corresponds to the nucleic acid sequence TCTCAAAGTACACATGTTCCTCCGTGGACG (SEQ ID NO: 108).

[0346] Table 4. Original amino acid and nucleic acid sequences of heavy and light chain variable regions

[0347]

[0348] Example 3A. Rabbit anti-misfolded SOD1 antibodies

[0349] Additional anti-misfolded SODl antibodies were generated in rabbits using the isolated peptide NEESTKTGN (SEQ ID NO: 142). The amino acid and corresponding nucleic acid sequences are listed in Table 5. Mature variable regions Underlined and are shown separately in Table 6. The CDRs of these antibodies are shown in Table 7.

[0350] Table 5. Amino acid and nucleic acid sequences of anti-SODl rabbit antibodies

[0351]

[0352]

[0353]

[0354] Table 6. Amino acid and nucleic acid sequences of variable regions

[0355]

[0356] Table 7. Amino acid sequences of CDRs

[0357]

[0358]

[0359] Example 3B. Generation of rabbit anti-misfolded SOD1 antibodies by hybridoma

[0360] New Zealand rabbits 3 months old were immunized with 100 pg of soluble synthetic peptide NEESTKTGN (SEQ ID NO: 142) or ESTKTGN (SEQ ID NO: 144) administered with Freund’s adjuvant, following a protocol of five subcutaneous injections and two blood tests per rabbit. Titers were monitored periodically during immunization. Positive immunized rabbits were identified by ELISA and Western blot and selected for rabbit monoclonal production. To generate rabbit hybridomas, spleen cells were isolated from immunized rabbits and fused with rabbit hybridoma fusion partners. Hybridoma clones secreting misfolded SOD1 -specific antibodies were selected by ELISA screening of hybridoma supernatants.

[0361] Using a panel of cell lines expressing wild-type SOD1 (with or without amplification) or misfolded SOD1 with linearized a-helix sequence from the electrostatic loop, the clonal cell lines expressing rabbit IgG to misfolded-specific antigens were further screened by Western blot analysis and immunohistochemistry.

[0362] Example 3C: Generation of humanized rabbit anti-misfolded SOD1 antibodies by CDR grafting

[0363] Rabbit monoclonal antibodies to misfolded SOD1 were prepared as in Example 3B. Antibody structure and / or sequence were analyzed to determine the combined Kabat, IMGT, and Paratome complementarity determining regions (CDRs; Zhang et al., 2017). Humanization was then performed by grafting the CDRs identified from the rabbit monoclonal antibodies to misfolded SOD1 onto suitable stable human Ig germline frameworks to generate equivalent humanized scFv for each rabbit monoclonal antibody. Genes encoding the DNA sequences of the scFv with grafted CDRs were synthesized by overlap extension PCR. The DNA constructs were then transformed into E. coli with expression plasmids. Three hours after induction, E. coli cells were harvested, inclusion bodies were isolated, and humanized scFv proteins were purified and then refolded by rapid dilution into refolding buffer.

[0364] Humanized scFv were then characterized by ELISA and compared to the original rabbit monoclonal antibodies to misfolded SOD1. Using a panel of cell lines expressing wild-type SOD1 (with or without amplification) or misfolded SOD1 with linearized a-helix sequence from the electrostatic loop, the humanized scFv were further screened by Western blot analysis and immunohistochemistry.

[0365] Example 4A. Binding analysis of rabbit anti-SOD1 antibodies

[0366] Supernatants produced by hybridoma cell cultures producing rabbit monoclonal antibodies were analyzed for antibody activity by indirect ELISA on plates coated with 1 pg / well of peptide or protein antigen. The results of the binding assay are summarized in Table 8A. As shown in the experiment, two A-7-85 antibodies (7-85H3-2 / L1-2 and 7-85H3-2 / L2-2) showed 2-fold higher specificity than 3H1. Sequence analysis in Example 3A indicated that 7-85H3-2 / L1-2 and 7-85H3-2 / L2-2 have identical sequences. The binding of anti-SOD1 antibodies was also characterized by ratio analysis. By the peak agg / dim OD ratio method, all A-7 antibodies analyzed were more specific than 3H1. According to the EC 50 ratio method, most A-7 antibodies were less specific than 3H1, however, the EC 50 values for dimeric SOD1 were extrapolated (except for A-7-63) as no complete curve was obtained.

[0367] Table 8A. Binding analysis of rabbit anti-SOD1 antibodies

[0368]

[0369] Example 4B. Generation of scFv

[0370] B lymphocytes from rabbits immunized with the antigen NEESTKTGN were isolated and immortalized with myeloma cells. Hybridoma cell lines that secreted monoclonal antibodies were then selected using the limiting dilution cloning method. Rabbit antibodies were isolated and sequenced. RT-PCR was performed using 5’ RACE and gene-specific reverse primers that amplify the appropriate rabbit immunoglobulin heavy and light chain variable region sequences. The characteristic bands were excised and cloned into pCR-Blunt II-TOPO vectors for sequencing and the constructs were transformed into E. coli. Colonies of each chain were picked and screened by PCR for the presence of the amplified region prior to sequencing and additional colonies were picked as needed. The selected PCR positive clones were sequenced. The DNA sequences were analyzed by BLAST and SnapGene to confirm homology to rabbit antibody sequences. Once the sequences were confirmed, the heavy and light chain variable sequences were cloned into the expression vector pcDNA3-R4-uAb to generate anti-SOD1 scFv (e.g., A-7-35a, 35, 58a, 58b, 63a, 63b, 85, and 93).

[0371] Example 5A. Proteasome degradation by targeting misfolded SOD1 with SOD1-scFv-E3 ligase fusion proteins Methods and materials

[0372] Plasmids

[0373] mUbL number

[0374] The expression vector pcDNA3-R4-uAb, which contains a single-chain variable fragment of beta-galactosidase fused to the carboxy terminus of the truncated E3 ligase CHIP (Hsc70 interacting protein), was obtained from Addgene (Addgene plasmid 101800, deposited by Matthew De Lisa (Portnoff et al., 2014)). The mUbL used in this study was generated by replacing the beta-galactosidase scFv with the anti-SOD1 scFv described in Example 4B. Table 8B shows the mUbL numbers corresponding to the fusion proteins containing the specific scFv (sequences in Table 12).

[0375] Table 8B. mUbL numbers, mUbL names, and A-scFv

[0376] mUbL name A-scFv Image analysis 1 35a 35a 2 35b 35b 3 58a 58a 4 58b 58b 5 63a 63a 6 63b 63b 7 85 85 8 93 93

[0377] A vector for expressing C-terminal EGFP-tagged SOD1 variants SOD1 WT , SOD1 A4V , SOD1 G93A , SOD1 G85R , SOD1 D90A , SOD1 G127X , SOD1 V148G , SOD1 H46R , SOD1 G37R , SOD1 C6G , SOD1 E100G on a pEGFP-N1 backbone has been described previously (Turner et al 2005, Farrawell et al 2019).

[0378] Cell culture and transfection

[0379] Human embryonic kidney (HEK293), Neuro2a (N2a) and neuroblastoma SHSY5Y cells were maintained in Dulbecco’s Modified Eagle Medium / Ham’s Nutrient Mixture F12 (DMEM / F12) supplemented with 10% fetal bovine serum (FBS, Bovogen Biologicals, Australia). Cells were kept in a humidified incubator at 37 °C with 5% atmospheric CO2. For confocal microscopy, cells were grown in 96-well optical bottom plates (Thermoscientific, Australia). Cells were grown in six-well plates for cell lysate experiments. Cells were plated to approximately 25% confluency 24 h prior to transfection with TransIT-X2 transfection reagent (Mirus Bio, USA). Transfection was performed according to the manufacturer’s instructions with 0.1 pg DNA / well for 96-well plates, 0.5 pg DNA / well for 24-well plates and 2.5 pg DNA / well for 6-well plates. For co-transfections, the amount of DNA was equally divided between constructs.

[0380] Immunofluorescence

[0381] HEK293 cells were plated into 96-well optical bottom plates (Thermofisher, USA) or coverslips and co-transfected with GFP-tagged SOD1 A4V and different mUbLs. After 48 h, cells were fixed with 4% paraformaldehyde (PFA) (Merck Millipore, USA) in phosphate-buffered saline (PBS) for 20 min at room temperature (RT). Cells were permeabilised in 0.11% Triton X-100 (TX-100) PBS for 10 min and then blocked with 5% FBS, 1% bovine serum albumin (BSA), 0.3% TX-100 in PBS for 1 h at RT. Cells were incubated with anti-histidine tag mouse primary antibody (Ab18184, Abeam, UK; 1 : 1000 dilution) overnight at 4 °C and then with Alexa Fluor 647-labelled goat anti-mouse IgG secondary antibody (ab150115, Abeam, UK; 1 : 1000 dilution) for 1 h at RT. All antibodies were diluted in blocking buffer and cells were washed with PBS between each incubation step.

[0382] Measurement of ubiquitin-proteasome system function

[0383] To determine the mode of action of mUbLs, HEK293 cells were co-transfected with SOD1-A4V-EGFP and mUbLs and treated overnight (approximately 18 h) with 10 mM proteasome inhibitor MG132.

[0384] Fluorescence measurements

[0385] Fluorescence of SOD1 -expressing cells was monitored in an Incucyte automated fluorescence microscope (Essen BioScience, USA) for 48 h as described in McAlary et al. (2016). Images were taken every 2 h and analyzed using a processing definition trained to select GFP-positive cells. For mUbL wells, the number of GFP-positive cells was normalized to the number of GFP-positive cells in the control. To measure insoluble GFP aggregates, cells were treated with PBS containing 0.03% saponin (Sigma, Germany) 48 h after transfection. After incubation at room temperature for 10 min, GFP signal was analyzed using a processing definition trained to select GFP-positive cells. To measure soluble fluorescence after saponin treatment, 100 μΐ of medium was transferred to a fresh 96-well plate and GFP soluble fluorescence was measured on a POLARstar Omega microplate reader (BMG, Germany). Settings included 2 x 2 matrix well scan readings from the bottom optical element at 485 nm excitation and 520 nm emission.

[0386] High-throughput fluorescence measurements

[0387] A Thunder automated microscope (Leica, Germany) was used for plate-based image acquisition. HEK293 cells co-expressing EGFP-tagged constructs of SOD1 mutants and mUbL were co-transfected into 96-well optical bottom plates. Each well was imaged in a 9 x 9 tile scan. No image overlap was used to avoid duplicate cell counting in the later analysis stage.

[0388] Cell lysis

[0389] All images generated by the automated microscope were pre-processed for quality control to ignore out-of-focus images. Out-of-focus images were manually assessed by the user and excluded from the dataset. After quality control processing, images were processed in CellProfiler to segment cells in the 30-130 pixel unit range and measure intensity, granularity, size / shape, intensity distribution, and texture.

[0390] Protein analysis

[0391] HEK293 cells grown in six-well plates and transfected with mUbL were harvested 48h post transfection with Trypsin-EDTA (Gibco). Cells were washed with PBS and then resuspended in RIPA buffer [50mM Tris-HCl pH 7.4, 1% (w / v) deoxycholic acid sodium salt, 150mM NaCl, 1mM EDTA, 1% TX-100, 0.1% SDS, 10mM NEM, 1mM sodium orthovanadate, Halt™ Protease Inhibitor Cocktail (Thermo Scientific)]. Protein concentration was determined with DC assay.

[0392] Results and discussion

[0393] Cell lysates with a total protein concentration of 30μg were mixed with 4x reducing SDS-PAGE sample buffer [200mM Tris-HCl pH 6.8, 8% SDS (w / v), 40% glycerol (v / v), 50mM EDTA, 0.08% bromophenol blue (w / v), 4% beta mercaptoethanol (v / v)]. And heated at 70°C for 10min before loading onto 4%-20% Criterion TGX Stain-Free TM TGX Stain-Free TM gels (BioRad, Australia). Gels were run at 100V for 5min and then at 150V for 1h. After electrophoresis, total protein on the gels was quantified using a Criterion Stain Free TM Imager (BioRad, Australia) before being transferred for immunoblotting. SDS-PAGE separated proteins were transferred to a methanol activated Amersham Hybond ECL TM Hybond TM0.2 pm PVDF membranes (GE Healthcare, USA) for 1 h. After transfer, the membranes were imaged using a stain-free imager to confirm transfer and measure total protein. Membranes were blocked in 5% skimmed milk powder in Tris-buffered saline containing 0.2% (v / v) Tween-20 (TBST) for 1 h at RT before probing with primary antibodies overnight at 4°C. The following day, membranes were washed 3 times for 30 min in TBST before incubating with secondary antibodies for 1 h at RT. Membranes were visualized using chemiluminescent substrate (Thermo Scientific) on an Amersham Imager 6600 RGB. Analysis and quantification was performed using ImageJ (version 1.53c). Membranes were then stripped with sodium azide for 2 h at RT if required. The following primary antibodies were used for immunoblotting: mouse anti-FLAG (F1804 and F3165, Sigma, Germany; 1 :2500), rabbit anti-SOD1 (Ab 13498, Abeam, UK; 1 :5000), rabbit anti-GFP (ab290, Abeam, UK; 1 :10 000), rabbit anti-GAPDH (G8795, Sigma, Germany; 1 :50 000), mouse anti-GAPDH (G9545, Sigma, Germany; 1 :50 000). HRP-labelled goat anti-mouse IgG secondary antibody (P044701-2, Dako Agilent; 1 :5000) or HRP-labelled goat anti-rabbit secondary antibody (P044801-2, Dako Agilent; 1 :5000) were used as required.

[0394] Co-immunoprecipitation

[0395] The Dynabead co-immunoprecipitation kit (Thermofisher, USA) was used to detect the binding of mUbL to SOD1 according to the manufacturer’s instructions. Briefly, HEK293 cells were grown in 6-well plates and co-transfected with 250 ng of each mUbL and SOD1 A4V-GFP. 48 h after transfection, cells were lysed with IP extraction buffer. Cell lysate was mixed with 1.5 mg of magnetic beads coupled to anti-His tag antibody (ab18184, Abeam) for 30 min at 4°C. After washing, bound proteins were eluted and boiled in 4x Laemmeli sample buffer for immunoblotting analysis.

[0396] Figure 3A

[0397] Figure 3 shows the design of misfolded specific ubiquitin ligase fusion proteins (mUbL). The heavy and light chain variable fragments of 8 different scFv clones specific for misfolded SOD1 (labeled mUbL1-8; see Table 9) were fused to a truncated E3 ligase via a flexible glycine-serine linker Figure 3B ). The amino acid and nucleic acid sequences of the heavy and light chain variable fragments present in each clone are found in Table 6. These constructs included Flag and His tags for detection. Initially, the E3 ligase of the carboxy terminus of Hsc70 interacting protein (CHIP) was chosen for the mUbL constructs due to its high expression level and localization in human and mouse cell lines, (see Table 10A). The mUbLs were designed to specifically bind to misfolded forms of SOD1 and thus bring the E3 ubiquitin ligase in close proximity to the misfolded SOD1, resulting in ubiquitination of the misfolded SOD1 and degradation by the proteasome. A construct containing a scFv to beta-galactosidase fused to a truncated CHIP was used as a control. mUbL number Gene expression data from human post-mortem anterior horn is shown. E3 ligases have been shown to be part of a large group of proteins that show differential expression in the ventral horn tissue of the spinal cord of ALS donors relative to control samples (D’Erchia et al., 2017).

[0398] Table 9. Heavy and light chain variable fragments of 8 different scFv clones.

[0399] mUbL name Variable region A-35L15 + A-35H17 1 35a A-35L15 + A-35H18 2 35b A-58L1 + A-58H1 3 58a A-58L1 + A-58H2 4 58b A-63L1 + A-63H2 5 63a A-63L1 + A-63H3 6 63b A-85H3-2 + A-85L1-2 7 85 A-93H1 + A-93L1 8 93 Figure 4A

[0400] Table 10A. Expression levels and cellular localization of ligases that can be used for mUbLs.

[0401]

[0402]

[0403] The data in Table 10A was derived from proteinatlas.org. By combining data from three transcriptomic datasets, Human Protein Atlas (HPA), Genotype-Tissue Expression Project (GTEx), and CAGE data generated by the Fantom5 consortium, mRNA expression data was given either NX or Normalized Expression Score.

[0404] Figure 4 shows that mUbLs are expressed in the nucleus and cytoplasm of HEK293 cells and interact with misfolded SOD1-A4V. HEK293 cells transfected with mUbLs and SOD1-A4V-GFP were fixed, permeabilized and stained for the C-terminal His tag of the mUbLs using an anti-His antibody 48h post transfection Figure 4B; scale bar 10 uM). HEK293 cells were transfected with mUbLs and lysed 48 h post-transfection with RIPA buffer. Immunoblotting with anti-FLAG antibody shows that mUbLs are present in the soluble fraction Figure 4C ; control is beta-galactosidase scFv and "UT" is untransfected). Significance was determined using one-way ANOVA with Dunnett's multiple comparison test compared to HEK293 cells transfected with mUbLs and control, and no differences were detected between mUbLs and between mUbLs and control. Figure 4D are western blots showing that mUbLs do not degrade endogenous SOD1. Error bars represent SD of the mean of 2 independent experiments, and the entire experiment was repeated. Significance was determined using one-way ANOVA with Dunnett's multiple comparison test compared to untransfected HEK293 cells. No significant differences were detected between mUBLs and between mUbLs and control. Next, magnetic beads were coupled to anti-His antibody and then mixed with lysates containing different combinations of mUbL 2 or control construct and SOD1-EGFP. Flow-through fractions were probed with anti-SOD1 and anti-FLAG antibodies, which confirmed SOD1 and mUbLs in the lysates Figure 5A ). Elution fractions show that mUbL 2 can strongly bind SOD1 A4V -EGFP and weakly bind SOD1 WT -EGFP. mUbL 5 also binds to SOD1 A4V . Blots represent 3 biological replicates.

[0405] Figure 5 shows that mUbLs reduce SOD1-A4V-GFP fluorescence in HEK293, Neuro2a, and SHSY5Y cell lines. Cells were cotransfected with SOD1-WT-GFP, SOD1-A4V-GFP, or SOD1-G93A-GFP and each mUbL, and fluorescence was measured every 3 h for 48 h, then cells were treated with saponin to induce pores in the membrane, allowing soluble proteins to diffuse outside the cell, but insoluble aggregates were still trapped and counted. Total fluorescence measurements normalized to SOD1-A4V-GFP over 48 h show that all mUbLs are able to reduce the amount of SOD1-A4V-GFP Figure 5B ). Area under the curve calculations show that fluorescence decreases over time relative to cells cotransfected with control mUbL and SOD1-A4V-GFP. mUbL 2 is consistently effective across all 3 cell lines, with fluorescence reduction from 5% for SHSY5Y cells to 40% for HEK293 cells Figure 5C G93A ​In cells co-transfected with -EGFP, the four mUbLs could significantly reduce the amount of insoluble aggregates compared with cells transfected with the contr...

Claims

1. An isolated antibody or binding fragment thereof that binds to a misfolded superoxide dismutase 1 (SOD1) epitope having the amino acid sequence of SEQ ID NO: 144, the antibody or binding fragment thereof comprising: (i) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; (ii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iv) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (v) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (vi) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58; (vii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequence of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or (viii) a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequence of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequence of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO:

34.

2. The antibody or binding fragment thereof according to claim 1, wherein (i) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70; (ii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 68, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70; (iii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:72, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:76; (iv) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76; (v) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 78, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 82; (vi) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:80, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:82; (vii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:84, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO:86; or (viii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical to the amino acid sequence of SEQ ID NO:88, and the light chain comprises a light chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical to the amino acid sequence of SEQ ID NO:

91.

3. The antibody or binding fragment thereof according to claim 1 or 2, wherein the binding fragment is Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, minibody, diabody or bispecific antibody binding fragment.

4. The antibody or binding fragment thereof according to any one of claims 1 to 3, wherein the binding fragment is a scFv.

5. The antibody or binding fragment thereof according to any one of claims 1 to 4, wherein the antibody or binding fragment thereof comprises one or more amino acids selected from D-amino acids, modified amino acids, amino acid analogs or a combination thereof. 6 . The antibody or binding fragment thereof according to claim 5 , wherein the modified amino acid comprises a modification selected from methylation, amidation, acetylation and / or substitution with other chemical groups.

7. The antibody or binding fragment thereof according to any one of claims 1 to 6, wherein the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation or prenylation. A fusion protein comprising the antibody or binding fragment thereof according to any one of claims 1 to 7 and an E3 ligase or an active fragment thereof.

9. The fusion protein of claim 8, wherein the E3 ligase is CHIP, UBE4A, NEDD4L, UBR5, RNF4, UBOX5, BTrCP or Parkin or an active fragment thereof.

10. The fusion protein of claim 8 or 9, comprising a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, the light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, the active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, the truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, The amino acid sequence of ID NO: 223 has an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical.

11. The fusion protein of claim 10, comprising a heavy chain variable region comprising an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical to the amino acid sequence of SEQ ID NO: 68, a first linker, a light chain variable region, a second linker, and an active E3 ligase fragment or a truncated E3 ligase, wherein the heavy chain variable region comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical to the amino acid sequence of SEQ ID NO:

70. NO:186 has an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical, and the truncated E3 ligase comprises an amino acid sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identical to the amino acid sequence of SEQ ID NO:

223.

12. The fusion protein of claim 10 or 11, formulated for viral delivery to a subject.

13. The fusion protein of claim 12, wherein the fusion protein is expressed and delivered via AAV.

14. A nucleic acid encoding the antibody or binding fragment thereof according to any one of claims 1 to 7 or the fusion protein according to any one of claims 8 to 13. A vector comprising the nucleic acid according to claim 14 . 16 . A pharmaceutical composition comprising the antibody or antibody thereof according to claim 1 , the fusion protein according to claim 8 , the nucleic acid according to claim 14 , or the vector according to claim 15 , and at least one drug carrier.

17. A method for treating a medical condition, disease or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, the method comprising administering to the subject the antibody or binding fragment thereof according to any one of claims 1 to 7, the fusion protein according to any one of claims 8 to 13, the nucleic acid according to claim 14, the vector according to claim 15 or the pharmaceutical composition according to claim 16.

18. The method of claim 17, wherein the medical condition, disease or disorder is a neurodegenerative condition, disease or disorder.

19. The method of claim 18, wherein the neurodegenerative condition, disease or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease or frontotemporal dementia.

20. The method of claim 19, wherein the ALS is sporadic ALS.

21. The method of claim 19, wherein the ALS is familial ALS.

22. The method of claim 19, wherein the neurodegenerative condition, disease or disorder is Alzheimer's disease.

23. The method of claim 19, wherein the neurodegenerative condition, disease or disorder is Parkinson's disease.

24. The method of claim 19, wherein the neurodegenerative condition, disease, or disorder is frontotemporal dementia.

25. The method of any one of claims 17 to 24, wherein the misfolded form of SOD1 comprises a SOD1 monomer, a dimer comprising a mutant SOD1 monomer, or an aggregate comprising SOD1 monomers and / or dimers, or a toxic trimer.

26. The method of claim 25, wherein the SOD1 monomer comprises a mutant SOD1 monomer.

27. The method of claim 26, wherein the mutant SOD1 monomer comprises one or more mutations selected from A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, and wherein X is a truncating mutation.

28. The method of claim 26, wherein the mutant SOD1 comprises G93A.

Images