Antibodies, targeted degradation agents of the extracellular inflammatory factor isg15, and methods of making and use

CN120842378BActive Publication Date: 2026-08-07SHANGHAI JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI JIAOTONG UNIV
Filing Date
2025-06-17
Publication Date
2026-08-07

Smart Images

  • Figure CN120842378B_ABST
    Figure CN120842378B_ABST
Patent Text Reader

Abstract

The present application relates to antibody, targeted degradation agent and preparation method and application of extracellular inflammatory factor ISG15, relate to the field of biological medicine technology.The present application provides antibody of extracellular inflammatory factor ISG15, with nM or nM or less binding capacity;Also provide ISG15 targeted degradation agent based on the antibody construction of ISG15, the amino acid sequence of the ISG15 targeted degradation agent is shown in any one of SEQ ID NO:17-22;The ISG15 targeted degradation agent is fused to the N terminal or / and C terminal of IGF2 protein by the flexible linker.The ISG15 targeted degradation agent of the present application can realize endocytosis of ISG15 protein, thereby effectively reducing the content of extracellular inflammatory protein ISG15, and has the potential to block the cascade reaction of cytokine storm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to antibodies, targeted degrading agents, preparation methods, and applications of the extracellular inflammatory factor ISG15. Background Technology

[0002] ISG15 is a ubiquitin-like modified protein with broad-spectrum antiviral activity. During immune stimulation and viral infection, ISG15 responds rapidly, undergoing a post-translational modification called ISGylation. Through three ubiquitin-like conjugating enzymes (UBE1L, UBCH8, and HERC5), it couples with host and viral proteins, directly inhibiting viral replication and modulating host immunity. Although ISGylation occurs in the cytoplasm, multiple studies have shown that free ISG15 can also be released from the cell into the extracellular environment, exhibiting extracellular cytokine-like activity.

[0003] Soluble extracellular ISG15, as a cytokine, can promote the proliferation of immune cells, such as natural killer cells, PBMCs, and T cells, and produce various inflammatory factors such as IFN-γ. Recent studies have found that highly pathogenic coronaviruses (such as SARS-CoV-2) evade the host's ISGylation antiviral mechanism by specifically hydrolyzing the ISG15-GlyGly motif through the encoded PLpro protease, promoting the release of free ISG15. This free extracellular form of ISG15 can trigger a pro-inflammatory cytokine storm, driving an excessive inflammatory response and exacerbating the pathological damage of the disease. Therefore, reducing the level of free extracellular ISG15 may be a potential strategy for managing the cytokine cascade of hyperinflammatory reactions.

[0004] Currently, selective protein degradation platforms have opened new avenues for therapeutic development and biological research. Lysosomal targeted chimeras (LYTACs) are a promising therapeutic approach that extends the scope of targeted protein degradation to extracellular targets, driving the degradation of extracellular proteins. Therefore, this invention provides an antibody against the extracellular inflammatory factor ISG15, a targeted degrading agent, a method for its preparation, and its applications. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide an antibody, a targeted degrading agent, a preparation method, and applications for the extracellular inflammatory factor ISG15. The aim is to develop a conformation recognition antibody for the extracellular inflammatory factor ISG15, which is fused with a ligand that binds to a lysosomal target receptor to achieve the degradation of extracellular ISG15.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] Firstly, antibodies against the extracellular inflammatory factor ISG15 include:

[0008] The amino acid sequences of the light chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 27, 28, and 11, respectively; the amino acid sequences of the heavy chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 3, 5, and 7, respectively.

[0009] Alternatively, the amino acid sequences of the light chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 27, 28, and 12, respectively; and the amino acid sequences of the heavy chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 4, 6, and 8, respectively.

[0010] Note: The amino acid sequence of any of the above-mentioned antibodies may also include a derived sequence that has optionally been added, deleted, modified, and / or substituted at least one (e.g., 1-3, preferably 1-2, more preferably 1) amino acid and is capable of retaining ISG15 binding affinity. The light chain variable region may also include a human FR region or a mouse FR region; the heavy chain variable region may also include a human FR region or a mouse FR region. The antibody has the ability to bind to ISG15, and generally recognizes ISG15 with a binding affinity below mM, such as mM, nM, or pM.

[0011] Based on the above technical solution, the present invention can be further improved as follows.

[0012] Furthermore, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 9; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 1;

[0013] Alternatively, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 10; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 2.

[0014] Furthermore, the antibody includes any one of double-chain antibodies, single-chain antibodies, and monoclonal antibodies. Specifically, the antibody is a partially or fully humanized monoclonal antibody.

[0015] Furthermore, the amino acid sequence of the antibody is shown in SEQ ID NO: 13 or SEQ ID NO: 14.

[0016] The amino acid sequence of the antibody also includes an amino acid sequence as shown in any one of SEQ ID NO: 13 or SEQ ID NO: 14, an amino acid sequence having more than 80% identity, or an amino acid sequence having identity relative to the amino acid sequence shown in any one of SEQ ID NO: 13 or SEQ ID NO: 14 by deletion, substitution, insertion and / or addition of one or more amino acid residues.

[0017] The second aspect is a recombinant protein, including an antibody against the extracellular inflammatory factor ISG15.

[0018] The recombinant protein also includes an optional tag sequence for expression and / or purification; the tag sequence includes a 6xHis tag. The recombinant protein (or polypeptide) includes a fusion protein. The recombinant protein is a monomer, dimer, or multimer.

[0019] Thirdly, an ISG15-targeting degrader, the ISG15-targeting degrader comprising an antibody of the extracellular inflammatory factor ISG15, insulin-like growth factor 2 (IGF2), and a flexible linker; wherein the insulin-like growth factor 2 is fused to the N-terminus and / or C-terminus of the antibody of the extracellular inflammatory factor ISG15 via the flexible linker.

[0020] Furthermore, the amino acid sequence of the insulin-like growth factor 2 is shown in SEQ ID NO:15 or SEQ ID NO:16; the flexible linker is a sequence with glycine and serine as repeating modules or a sequence with glycine as repeating module.

[0021] The flexible linker with glycine and serine as repeating modules includes any one of (GS)m, (GGS)m, (GGGS)m, (GGGGS)m, (GGGGS)m, and (GGGGS)m, where m = 1 to 20, and m is an integer; the flexible linker with glycine as repeating modules includes (G)n, where n = 1 to 40, and n is an integer.

[0022] Furthermore, the amino acid sequence of the ISG15 targeted degrader is shown in any one of SEQ ID NO:17-22.

[0023] Fourthly, a method for preparing an ISG15 targeted degrader, wherein the ISG15 targeted degrader is prepared by fusion expression or enzymatic linking.

[0024] The fusion expression method or enzymatic ligation preparation method is as follows:

[0025] 1. The fusion expression method includes the following steps:

[0026] (1) Construct an expression vector for the ISG15-targeting degrader and obtain the recombinant ISG15-targeting degrader protein through an Escherichia coli and / or mammalian cell expression system.

[0027] (2) The recombinant protein of the ISG15-targeting degrader is subjected to a refolding process to obtain an active ISG15-targeting degrader, and the amino acid sequence of the ISG15-targeting degrader is shown in any one of SEQ ID NO:17-20.

[0028] For example, the fusion expression method includes the following specific steps:

[0029] (1) The nucleic acid sequence of the antibody against the extracellular inflammatory factor ISG15 was constructed on the pET-28a (Novagen, Kan+) vector and transformed into Escherichia coli BL21 (DE3) competent cells by chemical transformation. Single clones were picked and cultured in LB medium. When the cells were in the logarithmic growth phase (OD600 was 0.6-0.8), IPTG was added to a final concentration of 0.5 mM. The cells were cultured at 37°C for 4-5 hours and then collected and lysed in PBS buffer.

[0030] (2) The lysis buffer was centrifuged at 12,000 rpm to collect the inclusion body precipitate. It was then washed twice with wash buffer 1 (wash buffer 1 contains: 50 mM Tris, 0.5% Tritan 100, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 8.0) and once with wash buffer 2 (wash buffer 2 contains: 50 mM Tris, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 8.0). The inclusion body proteins were dissolved in 6 M Gn·HCl and loaded onto a Ni-NTA column. Five column volumes were washed with wash buffer (wash buffer contains: 20 mM Tris-HCl, 6 M Gn·HCl, 300 mM NaCl, 20 mM imidazole, pH 7.4). Finally, the elution buffer (elution buffer contains: 20 mM Tris-HCl, 6 M Gn·HCl, 300 mM Tris-HCl, 20 mM DTT, pH 8.0) was used. The protein was eluted with NaCl, 400 mM imidazole, pH 7.4. The purified denatured protein was refolded by dialysis. The protein was diluted to 0.2 mg / mL and dialyzed into folding buffer (100 mM Tris, 400 mM L-Arg, 1 mM EDTA, 0.5 mM GSSG, 1 mM GSH, pH 8.4) and dialyzed at 4 °C for at least 6 h. The refolded protein was then transferred to PBS buffer to obtain a pure protein solution of ISG15 single-chain antibody.

[0031] 2. The enzymatic ligation method includes the following steps:

[0032] (1) A sortase enzyme recognition sequence was introduced into the C-terminus of the ISG15 single-chain antibody, as shown in any one of SEQ ID NO:23-24, and recombinant ISG15 antibody was obtained by E. coli expression system.

[0033] (2) Fragments A and B were synthesized separately using a standard solid-phase peptide synthesis method. Fragments A and B were then linked by natural chemical ligation and folded to obtain active IGF2 protein. The sequence of fragment A is shown in SEQ ID NO:25, the sequence of fragment B is shown in SEQ ID NO:26, and the GGGGS-IGF2 fragment is shown in SEQ ID NO:16. The ISG15 single-chain antibody was linked to the IGF2 protein by sortase transpeptidase to obtain an ISG15 targeted degrader. The sequence of the ISG15 targeted degrader is shown in any one of SEQ ID NO:21-22.

[0034] Fifthly, the use of the antibody against the extracellular inflammatory factor ISG15, or the fusion protein, or the ISG15-targeting degrader in the preparation of a drug for degrading the extracellular inflammatory factor ISG15 protein.

[0035] The beneficial effects of this invention are:

[0036] (1) The present invention provides an antibody against the extracellular inflammatory factor ISG15, which has a binding capacity of nM or less;

[0037] (2) The present invention also provides an ISG15 chimeric targeted degrader constructed from an antibody based on the extracellular inflammatory factor ISG15, wherein the amino acid sequence of the ISG15 targeted degrader is shown in any one of SEQ ID NO:17-22; the ISG15 chimeric targeted degrader fuses the ISG15 single-chain antibody to the N-terminus and / or C-terminus of the IGF2 protein through the flexible linker, which involves biological fusion expression and chemical recombination preparation methods.

[0038] (3) The ISG15 chimeric targeted degrader of the present invention can achieve endocytosis of ISG15 protein, thereby effectively reducing the content of extracellular inflammatory protein ISG15 and has the potential to block the cytokine storm cascade reaction. This invention is expected to break through the bottleneck of existing antiviral drugs being unable to balance immune activation and inflammation suppression, and provide a new direction for the treatment of severe COVID-19 and the design of broad-spectrum antiviral drugs. Attached Figure Description

[0039] Figure 1 This is an SDS-PAGE image of the ISG15 single-chain antibody protein expression and purification of the present invention;

[0040] Figure 2 The images show the gel chromatogram and corresponding SDS-PAGE chromatogram of the interaction between ISG15-E4 scFv and ISG15 protein in this invention; where A is the gel chromatogram and B is the SDS-PAGE chromatogram.

[0041] Figure 3 The images show the gel chromatogram and corresponding SDS-PAGE chromatogram of the interaction between ISG15-F4 scFv and ISG15 protein in this invention; where A is the gel chromatogram and B is the SDS-PAGE chromatogram.

[0042] Figure 4 This is a graph showing the results of surface plasmon resonance kinetic analysis of the ISG15 single-chain antibody and the ISG15 protein in this invention; where A represents F4-scFv and B represents E4-scFv.

[0043] Figure 5 This is an SDS-PAGE image of the expression and purification of the ISG15-targeted degrader fused in this invention;

[0044] Figure 6 This is a high-performance liquid chromatogram of the chemically synthesized active IGF2 of this invention;

[0045] Figure 7 This is the mass spectrum of the chemically synthesized active IGF2 of this invention;

[0046] Figure 8 SDS-PAGE image of the enzymatic preparation of the ISG15 targeted degrader of this invention;

[0047] Figure 9 This is a flow cytometry mid-fluorescence analysis of the ISG15 targeted degrader of this invention in K562 cells;

[0048] Figure 10 This is a fluorescence confocal microscopy image of the ISG15 targeted degrader of this invention in K562 cells; mCherry represents the fluorescence signal collected under excitation at 587 nm and emission at 610 nm; LysoGreen represents the fluorescence signal collected under excitation at 504 nm and emission at 511 nm; Bright Field represents the cell image taken under bright field.

[0049] Figure 11 This is a diagram showing the uptake of ISG15 by the ISG15-targeting degrader of this invention in K562 cells;

[0050] Figure 12 This is a reaction flow diagram of the enzymatic ligation method of the present invention. Detailed Implementation

[0051] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0052] Description of the source of materials and reagents:

[0053] BamHI, XhoI, and NdeI were purchased from New England Biolabs; DH5α competent cells were purchased from Shenzhen Kangti Life Technology Co., Ltd.; E. coli BL21(DE3) were purchased from Beijing TransGen Biotech; LB medium was purchased from Beijing Coollife Technology Co., Ltd.; IPTG was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; pET-28a(+) vector was purchased from Beijing Novagen Biotechnology Co., Ltd.; ISG15 plasmid was synthesized by Nanjing GenScript; K562 cells were donated by Dou Hongjing's research group at Shanghai Jiao Tong University; Sortase A enzyme was purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0054] Example

[0055] 1. Preparation of single-chain antibodies against extracellular inflammatory factor ISG15.

[0056] 1.1 Construction of a single-chain antibody (scFV) expression vector for the extracellular inflammatory factor ISG15.

[0057] The light chain variable region and heavy chain variable region selected by phage screening (the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 9; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 1; or, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 10; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 2) were respectively constructed into Escherichia coli expression vectors.

[0058] First, 1 μg of plasmid vector pTac28 (using pet28a(+) vector as a template, replacing its T7 promoter with tac promoter, and adding heat-stable enterotoxin ST-II signal peptide (MKKNIAFLLASMFVFSIATNAYA (SEQ ID NO:37)) as the starting expression sequence before the multiple cloning recognition site to obtain pTac28 vector) was selected. Suitable restriction endonucleases were used for double digestion. The vector was linearized by reacting with BamHI and XhoI in a 37℃ water bath for 4-8 h. After the reaction was complete, it was heated at 80℃ for 20 min to inactivate the restriction endonucleases. Based on the antibody sequence, the light and heavy chain variable regions were amplified by PCR (light chain variable region forward primer: CTACAAATGCCTATGCAGGATCCTCCGATATCCAGATGACCCAG (SEQ ID NO:29); light chain variable region reverse primer: CCTCTGAAGAACCAGAAGCAGCTGTAGTTCCTTTGATCTCCACCTTGGTACC (SEQ ID NO:29). NO:30); Forward primer for heavy chain variable region: TTCTGGTTCTTCAGGAGGTTCTTCATCTGGAGCTGAGATCTCCGAGGTTCAGC (SEQ ID NO:31); Reverse primer for heavy chain variable region: CTCAGAGGGTGGTGGTGGTGGTGCTCGAGGGCCGAGGAGACGGTGACCA (SEQ ID NO:32)) DNA fragments were obtained, and then single fragments were obtained by overlap PCR. The target DNA band was confirmed by agarose gel electrophoresis, and then the template plasmid was removed by digestion with DpnI enzyme at 37℃ for 1 h.

[0059] Finally, the linearized vector digested with enzymes and the PCR amplified fragment were ligated and recombined using Gibson to obtain a recombinant plasmid, which was then transformed into competent DH5α cells of E. coli plasmid clones. Subsequently, single clones were selected for Sanger sequencing to verify the sequence, and the ISG15 single-chain antibody expression vector pTac28-ISG15-scFv was obtained. The constructed ISG15 single-chain antibody protein sequence is shown in SEQ ID NO: 13 or SEQ ID NO: 14.

[0060] 1.2 Preparation of ISG15 single-chain antibody.

[0061] 1.2.1 Gene expression:

[0062] To detect the activity of the ISG15 single-chain antibody in vitro, the antibody was expressed and purified exogenously in *E. coli*. The host bacterium used in the examples was *E. coli* BL21(DE3) (purchased from TransGen), and the process included the following steps:

[0063] (1) The recombinant plasmid pTac28-ISG15-scFv expressing Escherichia coli was transformed into E. coli BL21(DE3) to obtain recombinant bacteria. Positive clones were selected using kanamycin resistance plates (Kan+, 50 μg / mL) and cultured overnight at 37°C;

[0064] (2) Pick a single colony and transfer it to 5 mL of LB liquid medium containing kanamycin (50 μg / mL), and incubate overnight at 37°C and 220 rpm. Transfer 5 mL of bacterial culture to 800 mL of LB medium containing kanamycin (50 μg / mL), and incubate at 37°C and 220 rpm until the OD600 reaches 0.6-0.8. Then add IPTG to a final concentration of 0.5 mM, and continue incubation at 37°C for 5 h to induce expression.

[0065] (3) Transfer the above bacterial solution into a collection bottle and centrifuge at 4000 rpm for 30 min;

[0066] (4) Discard the supernatant, suspend the obtained bacterial pellet with 50 mL of protein buffer (50 mM Tris-HCl, 500 mM NaCl, pH 7.5), pour it into a 50 mL centrifuge tube, and store it at -80°C.

[0067] 1.2.2 Protein purification:

[0068] (1) Bacterial lysis: The bacterial suspension was sonicated for 25-30 min on ice at 60% power and 37.5% duty cycle in an ultrasonic cell disruptor. The lysate was collected and centrifuged at 13000 rpm for 60 min. The precipitate and supernatant were collected and used for sample preparation.

[0069] (2) Purification: The supernatant was filtered through a 0.22 μm microporous membrane and purified by protein A affinity chromatography. The specific steps are as follows:

[0070] a: Column equilibration: Before hanging supernatant, wash with ddH2O for 2 column volumes, then equilibrate the protein A affinity chromatography column with protein buffer for 5 column volumes;

[0071] b: Sample loading: Slowly pass the supernatant through the protein A affinity chromatography column at a flow rate of 5 mL / min;

[0072] c: Elution of contaminating proteins: Wash with protein buffer for 5 column volumes;

[0073] d: Elution of target protein: The target protein was eluted using elution buffer (0.1M glycine) and the sample was prepared. Detection was performed using 4-20% SDS-PAGE. The results are shown below. Figure 1 As shown.

[0074] (3) Gel filtration chromatography: The collected target protein was concentrated by centrifugation (4℃, 4000rpm) using a 50mL Amicon ultrafiltration tube (10kDa, Millipore) to a final volume of 1mL. The sample was then loaded onto a Cytiva Superdex 75Increase 10 / 300GL molecular sieve, and the protein peak was collected and concentrated.

[0075] (4) The concentration of the concentrated protein was detected by Nanodrop 2000 micro spectrophotometer, and the purified and concentrated ISG15 single-chain antibody protein was obtained. The amino acid sequences were SEQ ID NO: 13 (E4-scFv) or SEQ ID NO: 14 (F4-scFv).

[0076] 1.3 ISG15 single-chain antibody activity test.

[0077] 1.3.1 Protein-protein interaction analysis.

[0078] Potential binding conditions of the two proteins can be tested by mixing separately purified ISG15-scFv (E4-scFv and F4-scFv) with ISG15 under specific buffer conditions and performing SEC separation under the same buffer conditions.

[0079] The purified ISG15-scFv was mixed with ISG15 at a molar ratio of 1:1.5 and incubated at 4°C for 1 h. The mixture was then passed through a gel filtration chromatography column (Superdex 75, Cytiva) pre-equilibrated with binding buffer (25 mM Tris-HCl, 150 mM NaCl, pH 7.4). The absorbance at 280 nm was used as the binding reading. The complex protein was separated and identified by SDS-PAGE. The results are as follows: Figure 2 and Figure 3 As shown, ISG15-single-chain antibody and ISG15 co-elute, and can bind in vitro to form a non-covalent complex.

[0080] 1.3.2 Affinity characterization.

[0081] The affinity between ISG15-scFv and ISG15 was determined by surface plasmon resonance (SPR) using a Biacore8K and His capture sensor chip NTA.

[0082] (1) Sample pretreatment:

[0083] ISG15-scFv-6His was replaced with the same buffer solution that does not contain high refractive index substances such as sucrose, glycerol, or imidazole, using dialysis or gel size exclusion.

[0084] (2) Chip preparation:

[0085] Rinse the chip surface with fresh ddH2O, then dry the remaining water droplets on the chip surface with nitrogen gas, execute the change chip software program, place the chip into the instrument in the specified orientation, and then execute the dock chip program to load the chip.

[0086] (3) Affinity analysis:

[0087] After coating the experimental and reference channels with 0.5 mM NiSO4, 10 nM of His-tagged ISG15-scFv protein was immobilized on the sensor chip. ISG15 was serially diluted from 200 nM to 3.125 nM using HBS-P buffer, and injected into the experimental and reference channels at low concentrations, binding for 250 s, followed by dissociation for 600 s. After each injection, the chip surface was regenerated with 350 mM EDTA and 50 mM NaOH, and then the ligands were immobilized for the next injection.

[0088] (4) Results analysis.

[0089] After the test is completed, the data is fitted using Biacore 8K Evaluation Software to determine the dynamic combination parameters. The test results are as follows: Figure 4 As shown, both ISG15-single-chain antibodies bind to ISG15 at low nmol concentrations.

[0090] 2. Construction of ISG15 targeted degradative agent.

[0091] IGF2 was linked to either the N-terminus or C-terminus of the ISG15 single-chain antibody to construct an ISG15-targeting degrader. Any gene sequence encoding the amino acid sequences SEQ ID NO:1 to SEQ ID NO:14 can be used for the construction of the expression vector. The gene sequence encoding the amino acid sequence SEQ ID NO:13 or SEQ ID NO:14 was obtained by PCR amplification (for the targeting degrader of the C-terminal single-chain antibody, the forward primer is: GGCGGTGGCGGATCCTCCGATATCCAGATGACCCAGTCC (SEQ ID NO:33), and the reverse primer is: GTGGTGGTGCTCGAGGGCCGAGGAGACGGTGACCAG (SEQ ID NO:34); for the targeting degrader of the N-terminal single-chain antibody, the forward primer is: GAAGGAGATATACATATGTCCGATATCCAGATGACCCAGTCCC (SEQ ID NO:35), and the reverse primer is: GGATCCGCCACCGCCGGCCGAGGAGACGGTGACCAG (SEQ ID NO:36)). Subsequently, 1 μg of the plasmid vector pET-28a-IGF2 (synthesized by Nanjing GenScript) was double-digested with appropriate restriction endonucleases. For the C-terminal single-chain antibody targeting degrader, the vector was linearized by reacting it with BamHI and XhoI in a 37℃ water bath for 4-8 h. For the N-terminal single-chain antibody targeting degrader, the vector was linearized by reacting it with NdeI and BamHI in a 37℃ water bath for 4-8 h. After the reaction was complete, the vector was heated at 80℃ for 20 min to inactivate the restriction endonucleases, resulting in the pET-28a-IGF2 linear expression vector containing the IGF2 sequence SEQ ID NO:15. Finally, the recombinant plasmid was obtained by Gibson ligation. The constructed ISG15 targeting degrader protein sequence is shown in any one of SEQ ID NO:17 to SEQ ID NO:20.

[0092] 2.1 ISG15 targeted degrader fusion expression.

[0093] 2.1.1 Gene expression:

[0094] The nucleic acid sequence (amino acid sequence as shown in SEQ ID NO:17-20) of the targeted degrader of the extracellular inflammatory factor ISG15 was constructed on the pET-28a(+) vector and transformed into Escherichia coli BL21(DE3) competent cells by chemical transformation. Single clones were picked and cultured in LB medium. When the single clones were in the logarithmic growth phase (OD600 of 0.6-0.8), the inducing agent IPTG was added to a final concentration of 0.5 mM. After culturing at 37°C for 4-5 hours, the cells were collected and lysed in PBS buffer.

[0095] 2.1.2 Protein purification:

[0096] Purification of ISG15-degraders requires a refolding process.

[0097] (1) Bacterial lysis: Using an ultrasonic cell disruptor, at 60% power and 37.5% duty cycle, the bacterial suspension was sonicated in an ice bath for 25-30 minutes. The lysate was collected and centrifuged at 13000 rpm for 20 minutes to collect the inclusion body precipitate. The precipitate and supernatant were then used for sample preparation.

[0098] (2) Purification: The lysis buffer was centrifuged at 12,000 rpm to collect the inclusion body precipitate. It was then washed twice with wash buffer 1 (50 mM Tris, 0.5% Tritan 100, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 8.0) and once with wash buffer 2 (50 mM Tris, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 8.0). The inclusion body protein was dissolved in 6 M Gn·HCl and loaded onto a Ni-NTA column. Five column volumes were washed with wash buffer (20 mM Tris-HCl, 6 M Gn·HCl, 300 mM NaCl, 20 mM imidazole, pH 7.4). Finally, the protein was eluted with elution buffer (20 mM Tris-HCl, 6 M Gn·HCl, 300 mM NaCl, 400 mM imidazole, pH 7.4).

[0099] (3) Renaturation: The purified denatured protein was renatured by dialysis. The protein was diluted to 0.2 mg / mL and dialyzed into folding buffer (100 mM Tris, 400 mM L-Arg, 1 mM EDTA, 0.5 mM GSSG, 1 mM GSH, pH 8.4) and dialyzed at 4°C for at least 6 h. The renatured protein was then transferred to PBS buffer, and the concentration of the concentrated protein was detected using a Nanodrop 2000 micro-spectrophotometer, yielding the purified and concentrated ISG15 targeted degradation agent (E4-IGF2, IGF2-E4, F4-IGF2, F4-IGF2, amino acid sequences as shown in SEQ ID NO:17-20). Samples were taken for SDS-PAGE analysis, and the results are as follows: Figure 5 As shown.

[0100] 2.2 Synthesis of active insulin-like growth factor 2 (IGF2) protein.

[0101] (1) Synthesis and purification of fragment A:

[0102] Using a standard microwave-assisted solid-phase peptide synthesis method, hydrazine resin was used to sequentially link amino acids starting from the C-terminus, and a GGGGS linker was added to the N-terminus to facilitate subsequent enzymatic reactions. The sequence of fragment A is shown in SEQ ID NO: 25.

[0103] a. Swelling of resin: Weigh 540 mg (0.25 mmol) of hydrazine resin with a degree of substitution of 0.46 mmol / g, add 10 mL of N,N-dimethylformamide (DMF) / dichloromethane solution (DCM) to the resin to swell the resin. The volume ratio of the added solution is DMF:DCM = 1:1. The swelling time is 10 minutes. Use a diaphragm pump as the power source to dry the swollen product to obtain the swollen resin.

[0104] b. Condensation reaction: The first amino acid was linked from the C-terminus using the standard microwave-assisted Fmoc solid-phase peptide synthesis method. The reaction was carried out at 89°C for 1.5 minutes with 4 equivalents of Fmoc amino acids, 4 equivalents of 1,3-diisopropylcarbodiimide (DIC), and 4 equivalents of cyano(hydroxyimino)ethyl acetate (Oxyma). After the reaction, the resin was washed with DMF.

[0105] c. Deprotection: Add a DMF solution containing 20% ​​(volume fraction) piperidine and 0.1M Oxyma to the resin, react at 90°C for 1 minute to remove the Fmoc protecting group, and then wash the resin with DMF.

[0106] d. Amino acid linkage: Repeat steps b and c, linking amino acids sequentially from the C-terminus until the last amino acid.

[0107] f. Resin cleavage: After amino acid condensation, the resin was washed three times with DCM, and the DCM solvent was removed under reduced pressure to obtain dry resin. Then, 20 mL of a pre-prepared cleavage reagent (trifluoroacetic acid: water: phenol: anisole: 1,2-ethylenedithiol volume ratio = 82:5:5:5:3) was added to the dry resin, and the reaction was carried out at room temperature for 2.5 hours. The polypeptide chain was cleaved from the resin, and the filtrate was collected into a centrifuge tube. The cleavage solution was concentrated using nitrogen bubbling. Finally, after the cleavage solution was concentrated to less than 10 mL, 40 mL of ice-cold ether was added for sedimentation. The mixture was centrifuged at low speed (3500 rpm) to allow the crude peptide to settle to the bottom. The washing was repeated three times with ice-cold ether to remove small molecule impurities remaining from the cleavage reaction. After washing, the solid sediment was placed in a cool place to air dry, yielding solid crude peptide.

[0108] g. Peptide purification: Dissolve a small amount of crude peptide in 6M Gn·HCl, filter through a membrane, and analyze using analytical reversed high performance liquid chromatography (RP-HPLC); the analyte gradient is 20%-60% acetonitrile concentration, and the time is 30 minutes; after chromatographic analysis, the main peak is identified by ESI-MS to verify the correctness of linearity P1; after verification, the solid crude peptide is separated and purified by semi-preparative RP-HPLC (semi-preparative gradient is 20%-50% acetonitrile concentration, and the time is 30 minutes), the correct product peak solution is collected and freeze-dried in a freeze dryer to obtain a white flocculent product.

[0109] (2) Synthesis and purification of fragment B:

[0110] Using a standard microwave-assisted solid-phase peptide synthesis method, amino acids were sequentially linked from the C-terminus using an amino resin. The synthesis method was similar to that of fragment A and will not be repeated here. The only difference was the resin used. Fragment B used Rink AM amide resin with a substitution degree of 0.56 mmol / g. The sequence of fragment B is SEQ ID NO: 26.

[0111] (3) Fragment connection:

[0112] a. Lysing: Dissolve fragments A and B in a buffer solution containing 6M Gn·HCl, 100mM NaH2PO4, pH 2.3, to achieve a final concentration of 1 mmol for fragment A.

[0113] b. Oxidation: Pre-cool the polypeptide solution in an ice-salt bath, add 10 times the equivalent amount of NaNO2 solution, stir in an ice-salt bath for 30 min, and monitor the reaction temperature between -10 and -20℃ during the reaction process.

[0114] c. Connection: Add 50 equivalents of MPAA and stir in an ice-salt bath. Adjust the pH to 4.8-5.0 and react for 1 min. Then adjust the pH to 6.3 and react at 120 rpm for 4-8 h. Monitor the reaction using analytical RP-HPLC. After the reaction is complete, separate and purify the product using preparative RP-HPLC. After lyophilization, obtain pure linear IGF2 protein powder. The protein sequence is SEQ ID NO: 15-16.

[0115] (4) IGF2 refolding:

[0116] Linear IGF2 protein was dissolved in 6M Gn·HCl, then diluted with water to a guanidine hydrochloride concentration of less than 1M. 100-fold equivalents of GSH and 10-fold equivalents of GSSG were added, bringing the final IGF2 protein concentration to 10 μM. The pH was adjusted to 8.0, and the mixture was allowed to stand for 6–8 hours. The refolding product was monitored using analytical RP-HPLC. After complete refolding, the pH was adjusted to 2–3 using trifluoroacetic acid, and the mixture was dialyzed into a 1‰ trifluoroacetic acid solution. The refolded product was then separated and purified using preparative RP-HPLC, and lyophilized to obtain pure active IGF2 protein. Mass spectrometry characterization was performed as follows. Figure 6 , 7 As shown.

[0117] 2.3 ISG15 targeted degradation agent preparation by enzymatic method.

[0118] The enzymatic ligation method includes the following steps:

[0119] (1) A sortase enzyme recognition sequence was introduced into the C-terminus of the ISG15 single-chain antibody, as shown in any one of SEQ ID NO:23-24, and recombinant ISG15 antibody was obtained by E. coli expression system.

[0120] (2) Fragments A and B were synthesized separately using a standard solid-phase peptide synthesis method. Fragments A and B were then linked by natural chemical ligation and folded to obtain active IGF2 protein. The reaction process is shown in Figure 12 below. The sequence of fragment A is shown in SEQ ID NO:25, the sequence of fragment B is shown in SEQ ID NO:26, and the GGGGS-IGF2 fragment is shown in SEQ ID NO:16. The ISG15 single-chain antibody was linked to the IGF2 protein by sortase transpeptidase to obtain an ISG15 targeted degrader. The sequence of the ISG15 targeted degrader is shown in any one of SEQ ID NO:21-22.

[0121] The specific process is as follows:

[0122] (1) The nucleic acid sequence of the ISG15 single-chain antibody containing the sortase enzyme recognition sequence was constructed on the Escherichia coli expression vector and transformed into Escherichia coli BL21(DE3) competent cells by chemical transformation. Single clones were picked and cultured in LB medium. When the cells were in the logarithmic growth phase (OD600 of 0.6-0.8), the inducing agent IPTG was added to a final concentration of 0.5 mM. After culturing at 37°C for 5 hours, the cells were collected and lysed in protein buffer (50 mM Tris-HCl, 500 mM NaCl, pH 7.5). The cell supernatant was collected by ultracentrifugation and filtered through a 0.22 μm filter membrane. The supernatant was loaded onto a protein A affinity column pre-equilibrated with protein buffer. The cells were then washed with buffer for 5 column volumes and eluted with elution buffer (0.1 M glycine) for 2-3 column volumes to obtain the recombinant ISG15 single-chain antibody.

[0123] (2) Microwave-assisted solid-phase peptide synthesis was used to obtain peptide fragments A and B, respectively. Fragment A was synthesized using hydrazine resin, and fragment B was synthesized using amino resin. Fragments A and B were dissolved together in 6M Gn·HCl. Under low pH conditions, the C-terminal acyl hydrazine of fragment A was oxidized with sodium nitrite to form a highly active acyl azide. In the presence of the highly active catalyst MPAA, an electrophilic thioester was formed. After attack by the N-terminal thiol group of fragment B, the acyl group was rapidly transferred from the sulfur atom to the nitrogen atom, thereby achieving the connection of fragments A and B to obtain a linear IGF2 fragment. The IGF2 protein was diluted and refolded under 100-fold equivalents of reduced glutathione (GSH) and 10-fold equivalents of oxidized glutathione (GSSG) and allowed to stand for 6-8 hours. The reaction progress was monitored by analytical reversed-phase high-performance liquid chromatography, and the product was determined by mass spectrometry to have the correct molecular weight. Finally, the main product with the correct molecular weight was separated and purified by semi-preparative reversed-phase high-performance liquid chromatography and lyophilized to obtain the active IGF2 protein.

[0124] (3) The purified ISG15 single-chain antibody containing the sortase enzyme recognition sequence was reacted with IGF2 protein in 1 μM sortase transpeptidase and 10 mM CaCl2 for 0.5-1 h; svFv-LPETGG was diluted to 0.2 mM with reaction buffer (50 mM HEPES, 150 mM NaCl, 1 mM CaCl2, pH 7.0), and then Sortase A enzyme (5 μM) and IGF2 protein (1 mM) were added and incubated at room temperature for 0.5-1 h; unreacted ISG15 single-chain antibody was back-coated with Ni-NTAbeads, and the flow-through was collected. The ISG15 targeted degrader and excess IGF2 protein were separated by gel filtration chromatography, and the product was identified by SDS-PAGE. The results are as follows. Figure 8 As shown.

[0125] 3. Application of ISG15 targeted degradation agent.

[0126] First, an ISG15 fluorescent protein labeled with red fluorescent protein mCherry was constructed. Then, mCherry red fluorescent protein was added to the N-terminus or C-terminus of the ISG15 protein to achieve intracellular visualization.

[0127] 3.1 Flow cytometry evaluation of ISG15 uptake by ISG15-targeted degraders:

[0128] ISG15 uptake assays were performed using the suspension cell line K562. Cells were grown in a 37°C, 5% CO2 incubator. Cells were cultured at a rate of 2 × 10⁶ cells / year. 5 Cells were seeded at a density of [number] cells / mL in 48-well plates and cultured overnight. Then, 100 nM ISG15-mCherry or a mixture of mCherry-ISG15 and 1 μM degrades were added, and the cells were cultured at 37°C for another 24 h. Cells were then collected by centrifugation at 1000 rpm for 5 min, washed three times with cold PBS, resuspended in complete culture medium, filtered, and transferred to flow cytometry tubes. The median fluorescence of K562 cells was analyzed by flow cytometry, and the data were processed using FlowJo v9 software. Results are shown below. Figure 9 As shown in the figure, all four ISG15-targeting degraders can achieve the endocytosis of extracellular ISG15, and IGF2-E4 and F4-IGF2 have better endocytosis effects than IGF2-F4 and E4-IGF2.

[0129] 3.2 Confocal live-cell imaging to detect ISG15 uptake in K562 cells:

[0130] K562 cells were seeded in 96-well plates. The next day, cells were treated individually with ISG15-mCherry or a mixture of ISG15-mCherry and degrades, and cultured for 24 hours. Cells were then collected at 1000 rpm and resuspended in warm PBS, washed three times. After incubation with 0.1 mg / mL heparin-PBS buffer for 5 min, the cells were centrifuged and washed with complete culture medium. Lyso-TrackerGreen (Beyotime) was added to the cell culture medium at a ratio of 1:20,000 to prepare lysosome staining working solution. Cells were resuspended in the staining solution and incubated at 37°C for 30 min. The staining solution was then removed, and cells were resuspended in live-cell imaging medium and transferred to live-cell culture dishes. Live-cell imaging was then performed under a Zeiss LSM900 laser confocal microscope to observe the co-localization of ISG15 and lysosomes. The experimental results are shown below. Figure 10 As shown in the figure, endocytosed ISG15 is colocalized with lysosomes, indicating that endocytosed ISG15 is degraded via the lysosomal pathway.

[0131] 3.3 ISG15 supernatant removal experiment:

[0132] K562 cells were divided into 2x10 5 Cells were seeded at a density of [number] cells / mL in 96-well plates and incubated for 72 h alone or in combination with ISG15-mCherry and ISG15-degrader. Cells were collected, centrifuged, and 30 μL of supernatant was extracted and diluted to 45 μL with PBS buffer. After shaking for 5 minutes on a microplate reader, fluorescence intensity was measured at 610 nm using a microplate reader. The percentage of ISG15 clearance by ISG15-degraders was measured using a normalized control group without the addition of ISG15-degraders. Results are shown below. Figure 11 As shown, the results indicate that compared with the control group without ISG15-degraders, the extracellular ISG15 content decreased significantly after the addition of ISG15-degraders, demonstrating that ISG15-degraders have the ability to clear extracellular ISG15.

[0133] In summary, this invention provides an antibody against the extracellular inflammatory cytokine ISG15, possessing a binding capacity of nM or less. This invention also provides an ISG15 chimeric targeted degrader constructed from the antibody against the extracellular inflammatory cytokine ISG15, the amino acid sequence of which is shown in any one of SEQ ID NO: 17-22. The ISG15 chimeric targeted degrader fuses the ISG15 single-chain antibody to the N-terminus and / or C-terminus of the IGF2 protein via the flexible linker, involving biological fusion expression and chemical recombination preparation methods. Using the ISG15 chimeric targeted degrader of this invention, endocytic uptake of the ISG15 protein can be achieved, thereby effectively reducing the content of the extracellular inflammatory protein ISG15 and possessing the potential to block the cytokine storm cascade reaction. This invention is expected to overcome the bottleneck of existing antiviral drugs' inability to balance immune activation and inflammation suppression, providing a new direction for the treatment of severe COVID-19 and the design of broad-spectrum antiviral drugs.

[0134] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. An antibody against the extracellular inflammatory factor ISG15, characterized in that, Include: The amino acid sequences of the light chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 27, 28, and 11, respectively; the amino acid sequences of the heavy chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 3, 5, and 7, respectively. Alternatively, the amino acid sequences of the light chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 27, 28, and 12, respectively; and the amino acid sequences of the heavy chain variable regions CDR1, CDR2, and CDR3 of the antibody are shown in SEQ ID NO: 4, 6, and 8, respectively.

2. The antibody against the extracellular inflammatory factor ISG15 according to claim 1, characterized in that, The amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 9; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 1; Alternatively, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 10; the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO:

2.

3. The antibody against the extracellular inflammatory factor ISG15 according to claim 1, characterized in that, The antibody includes any one of double-chain antibody, single-chain antibody, and monoclonal antibody.

4. The antibody against the extracellular inflammatory factor ISG15 according to claim 1, characterized in that, The amino acid sequence of the antibody is shown in SEQ ID NO: 13 or SEQ ID NO:

14.

5. A recombinant protein, characterized in that, Including antibodies to the extracellular inflammatory cytokine ISG15 as described in any one of claims 1 to 4; The recombinant protein also includes a tag sequence that assists in expression and / or purification; the tag sequence includes a 6xHis tag.

6. An ISG15 targeted degradation agent, characterized in that, The ISG15 targeted degrader comprises an antibody of the extracellular inflammatory factor ISG15 as described in any one of claims 1 to 4, insulin-like growth factor 2, and a flexible linker; the insulin-like growth factor 2 is fused to the N-terminus and / or C-terminus of the antibody of the extracellular inflammatory factor ISG15 via the flexible linker; the amino acid sequence of the insulin-like growth factor 2 is shown in SEQ ID NO:

16.

7. The ISG15 targeted degrader according to claim 6, characterized in that, The flexible linker is a sequence with glycine and serine as repeating modules or a sequence with glycine as repeating module.

8. The ISG15 targeted degrader according to claim 6, characterized in that, The amino acid sequence of the ISG15 targeted degrader is shown in any one of SEQ ID NO:17-20.

9. A method for preparing an ISG15 targeted degrader according to any one of claims 6 to 8, characterized in that, The ISG15 targeted degrader was prepared by fusion expression or enzymatic linking.

10. The use of the antibody of any one of claims 1 to 4, or the recombinant protein of claim 5, or the ISG15-targeting degrader of any one of claims 6 to 8, in the preparation of a reagent for degrading the extracellular inflammatory factor ISG15 protein.

Citation Information

Patent Citations

  • Anti-human ISG15 protein antibody gene and application thereof

    CN109694871A

  • Monoclonal antibody specifically reacting with ISG15 protein, hybridoma producing the same and method for detecting cancer and virus infection

    JP2007106716A