Application of combined haplotype molecular marker of early rice grain cadmium content related genes LCd41, CAL1, LCd38

Abstract

The application discloses application of a combined haplotype molecular marker of early rice grain cadmium content related genes LCd41, CAL1 and LCd38, belongs to the technical field of biology, and particularly relates to application of a combined haplotype molecular marker Multi-LCL of early rice grain cadmium content related genes LCd41, CAL1 and LCd38. The cadmium content of early rice varieties is identified or assisted to be identified by detecting the three SNP polymorphisms or genotypes of the materials, the cadmium content of early rice grain of the early rice variety with the low-cadmium combined haplotype Multi-LCL1 is significantly lower than that of Multi-LCL2, Multi-LCL3 and Multi-LCL4, and it is explained that the combined haplotype Multi-LCL1 can be used for early prediction and screening of early rice grain cadmium accumulation, and is used for rice breeding and selection of low-cadmium rice.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of combined haplotype molecular markers of genes LCd41, CAL1, and LCd38 related to cadmium content in early rice grains. Background Technology

[0002] Cadmium is a heavy metal element that is toxic to humans and is classified as a Group 1 carcinogen. Chronic cadmium exposure can lead to a variety of health problems.

[0003] Cadmium pollution in farmland soil is a serious problem in some parts of southern my country, leading to excessive cadmium levels in agricultural products and jeopardizing their quality and safety. Rice, as a staple food for Chinese residents, is a major source of dietary cadmium intake.

[0004] Numerous studies both domestically and internationally have reported significant differences in the cadmium accumulation capacity of different rice varieties, with cadmium concentrations varying by more than tenfold, and these traits exhibit strong heritability. Cadmium content in rice grains is controlled by quantitative trait (QTL), and several genes related to cadmium content in rice grains have been identified through genome-wide association analysis and genetic population mapping.

[0005] Single nucleotide polymorphism (SNP) refers to a variation in a single nucleotide in the genome. It is the smallest unit of variation, formed by the substitution, inversion, insertion, or deletion of a single nucleotide pair. SNP markers are genetically stable, numerous, widely distributed, and easy to detect, making them suitable for large-scale detection and analysis. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide the application of a combined haplotype molecular marker of LCd41, CAL1, and LCd38, genes related to cadmium content in early rice grains. This invention belongs to the field of biotechnology and specifically involves the application of the three combined haplotype molecular markers Multi-LCL for LCd41, CAL1, and LCd38, genes related to cadmium content in early rice grains. By detecting the polymorphisms or genotypes of these three SNPs in early rice varieties to identify or assist in the identification of cadmium content in rice grains, the cadmium content of early rice grains with the low-cadmium combined haplotype Multi-LCL1 is significantly lower than that of Multi-LCL2, Multi-LCL3, and Multi-LCL4. This indicates that the combined haplotype Multi-LCL1 can be used for early prediction and screening of cadmium accumulation in early rice grains, and can be used for rice breeding and the selection of low-cadmium rice varieties.

[0007] To achieve the above technical effects, the following technical solution is adopted: The combined haplotype molecular markers of the genes LCd41, CAL1, and LCd38 related to cadmium content in early rice grains are described. These combined haplotype molecular markers consist of LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955, and are denoted as Multi-LCL. Multi-LCL is a polymorphic combination of the three SNPs LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 on the rice chromosome. Wherein, LCd41-TagSNP-20844875 is a SNP in the rice genome, with the sequence listing SEQ ID NO.1; it is the 308th nucleotide in the sequence listing SEQ ID NO.1, which is either T or A; Wherein, CAL1-TagSNP-25190881 is a SNP in the rice genome, with the sequence listing SEQ ID NO.2; and is the 308th nucleotide in the sequence listing SEQ ID NO.2, which is C or G; Wherein, LCd38-TagSNP-20089955 is a SNP in the rice genome, with the sequence listing SEQ ID NO.3; it is the 283rd nucleotide in the sequence listing SEQ ID NO.3, which is C or T; The cadmium content in the grains of early rice with the genotype AAGGCC of the three SNPs is lower than or candidate to be lower than that of early rice with the genotype TTCCCC, genotype TTCCTT, or genotype AACCCC of the three SNPs. The early rice with genotype AAGGCC has genotype AA of LCd41-TagSNP-20844875, genotype GG of CAL1-TagSNP-25190881, and genotype combination of 3 SNPs of CC of LCd38-TagSNP-20089955. The early rice with the genotype TTCCCC is a combination genotype of 3 SNPs, namely LCd41-TagSNP-20844875 with genotype TT, CAL1-TagSNP-25190881 with genotype CC, and LCd38-TagSNP-20089955 with genotype CC. The early rice with the genotype TTCCTT has the genotype AA of LCd41-TagSNP-20844875, the genotype CC of CAL1-TagSNP-25190881, and the genotype LCd38-TagSNP-20089955 is a combination genotype of TT with 3 SNPs. The early rice with genotype AACCCC is a combination genotype of three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

[0008] The application method of the combined haplotype molecular markers LCd41, CAL1, and LCd38, which are related to cadmium content in early rice grains, is used to detect the polymorphism or genotype of the combined haplotype molecular marker Multi-LCL in the identification or auxiliary identification of cadmium content in rice grains.

[0009] The application method of the combined haplotype molecular markers LCd41, CAL1, and LCd38, which are related to cadmium content in early rice grains, is used to detect the polymorphism or genotype of the combined haplotype molecular markers Multi-LCL in the preparation, identification, or auxiliary identification of cadmium content in rice grains.

[0010] The method for applying the combined haplotype molecular markers LCd41, CAL1, and LCd38, which are related to cadmium content in early rice grains, is used to detect the polymorphism or genotype of the combined haplotype molecular markers Multi-LCL in rice breeding or the preparation of rice breeding products. The purpose of rice breeding is to cultivate rice with low cadmium content or to select rice varieties with low cadmium content in grains.

[0011] Furthermore, the substance is D1, D2, or D3 as follows: D1: Contains PCR primers for amplifying rice genomic DNA fragments including LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 as described in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

[0012] Furthermore, the PCR forward primer sequence for LCd41-TagSNP-20844875 is: F1: 5'-GATGTCTCGCATCGATCAACCGGTTCCGCCAT-3', which is SEQ ID NO.4; the PCR reverse primer sequence for LCd41-TagSNP-20844875 is: R1: 5'-GACACTTCACATTCTCACAAAC-3', which is SEQ ID NO.5; the PCR forward primer sequence for CAL1-TagSNP-25190881 is: F1: ACCAAGGTGGCGGAGGC, which is SEQ ID NO.6; the PCR reverse primer sequence for CAL1-TagSNP-25190881 is: R1: AGCCGACGAGCAATGCG, which is SEQ ID NO. NO.7; The PCR forward primer sequence for LCd38-TagSNP-20089955 is: F1: 5'-ATACAGATGCCTTCTCCAATAC-3', which is SEQ ID NO.8; The PCR reverse primer sequence for CAL1-TagSNP-25190881 is: R1: 5'-TTTTTAATCTGTCTCACTATGCTTATCCAGATTAACTTATGGAATGCTTACCTACA-3', which is SEQ ID NO.9.

[0013] The product contains a substance for detecting the polymorphisms or genotypes of the three SNPs LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 in the rice genome, and may be any one of the following G1-G3: G1: Products for detecting single nucleotide polymorphisms or genotypes related to cadmium content in rice grains; G2: Products used to identify or assist in identifying the cadmium content of rice grains; G3: A product used for rice breeding, the purpose of which is to cultivate rice with low cadmium content or to select rice varieties with low cadmium content. Rice varieties with low cadmium content.

[0014] Furthermore, the substance is D1, D2, or D3 as follows: D1: Contains PCR primers for amplifying rice genomic DNA fragments including LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 as described in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

[0015] A method for identifying or assisting in the identification of cadmium content in rice grains, wherein the method is as follows: The method involves detecting polymorphic combinations or genotypes of the three SNPs (LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955) in the rice genome as described in claim 1, and then using the genotype of the rice to identify or assist in the identification of cadmium content in the rice grains. The cadmium content in the grains of early rice with the genotype AAGGCC of the three SNPs is lower than or candidate to be lower than that of early rice with the genotype TTCCCC, genotype TTCCTT, or genotype AACCCC of the three SNPs. The early rice with genotype AAGGCC has genotype AA of LCd41-TagSNP-20844875, genotype GG of CAL1-TagSNP-25190881, and genotype combination of 3 SNPs of CC of LCd38-TagSNP-20089955. The early rice with the genotype TTCCCC is a combination genotype of 3 SNPs, namely LCd41-TagSNP-20844875 with genotype TT, CAL1-TagSNP-25190881 with genotype CC, and LCd38-TagSNP-20089955 with genotype CC. The early rice with the genotype TTCCTT has the genotype AA of LCd41-TagSNP-20844875, the genotype CC of CAL1-TagSNP-25190881, and the genotype LCd38-TagSNP-20089955 is a combination genotype of TT with 3 SNPs. The early rice with genotype AACCCC is a combination genotype of three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

[0016] The method is applied in rice breeding, the purpose of which is to cultivate rice with low cadmium content or to select rice varieties with low cadmium content; the specific rice breeding method is as follows: The polymorphic combinations or genotypes of the three SNPs LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 in the genome of the rice to be tested were detected. Early rice with the genotype AAGGCC of the three SNPs was selected as the parent for breeding. The early rice with the genotype AAGGCC is the combination genotype of the three SNPs LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype GG), and LCd38-TagSNP-20089955 (genotype CC). The purpose of the rice breeding is to cultivate rice with low cadmium content in the grains or to select rice varieties with low cadmium content in the grains.

[0017] In the above applications and methods, the substance used to detect the polymorphism or genotype of the three SNPs LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 in early rice, or the substance used to detect combined haplotypes, can be determined by at least one of the following methods to identify the nucleotide types of the three sites LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 in the early rice genome: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarray.

[0018] In the above applications and methods, the product may be a reagent, kit, or system. The system may include a combination of reagents or kits, instruments, and analytical software, such as a product consisting of PCR primers, Phanta® Mix reagents, an ELISA reader, and the online SNP decoder software (http: / / www.snpway.com / snpdecoder / ), or a combination of PCR primers, Phanta® Mix reagents, the online SNP decoder software, and quantitative real-time PCR. The product includes the substance described above for detecting the polymorphisms or genotypes of the three SNPs LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955 in the early rice genome.

[0019] The beneficial effects of this invention are as follows: This invention discloses the application of a combined haplotype molecular marker of LCd41, CAL1, and LCd38, genes related to cadmium content in early rice grains, belonging to the field of biotechnology. Specifically, it involves the application of the three combined haplotype molecular markers Multi-LCL for LCd41, CAL1, and LCd38, genes related to cadmium content in early rice grains. By detecting the polymorphisms or genotypes of three SNPs in early rice varieties, the cadmium content of rice grains can be identified or assisted in the identification of cadmium content. The cadmium content of early rice grains with the low-cadmium combined haplotype Multi-LCL1 is significantly lower than that of Multi-LCL2, Multi-LCL3, and Multi-LCL4, indicating that the combined haplotype Multi-LCL1 can be used for early prediction and screening of cadmium accumulation in early rice grains, and can be used for rice breeding and the selection of low-cadmium rice varieties.

[0020] This invention provides a method for joint haplotype identification or auxiliary identification of cadmium content in early rice grains using three genes related to cadmium accumulation in early rice grains. Using molecular marker-assisted selection breeding, selection can be performed at the DNA level for target traits. This method not only provides stable results but also allows selection to be performed at the seedling stage, reducing the cost of phenotypic evaluation and improving breeding efficiency. Detailed Implementation

[0021] The present invention will be further described below, but the scope of protection of the present invention is not limited to the following: Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0024] The 59 early rice materials in the following examples were provided by the College of Agriculture of Jiangxi Agricultural University and the laboratory of Jiangxi Academy of Agricultural Sciences, and their germplasm resources were obtained from the National Rice Data Center (https: / / www.ricedata.cn / variety / index.htm).

[0025] Example 1: Discovery of low-cadmium co-halotypes of three cadmium accumulation genes in early rice grains Joint haplotype analysis was performed on the SNP molecular markers of three genes related to cadmium content in early rice grains, including LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955. Each SNP locus was divided into two genotypes (detailed genotypes are shown in Table 1).

[0026] The LCd41-TagSNP-20844875 sequence is listed in SEQ ID NO.1; the CAL1-TagSNP-25190881 sequence is listed in SEQ ID NO.2; and the LCd38-TagSNP-20089955 sequence is listed in SEQ ID NO.3. 1. The LCd41 gene is located at nucleotide 20844875 on chromosome 10 of rice. TagSNP-20844875 is a SNP site in the rice genome, which is an A / T polymorphism. There are two genotypes: genotype AA is the homozygous type of LCd41-TagSNP-20844875 in the rice genome where LCd41-TagSNP-20844875 is A, genotype TT is the homozygous type of LCd41-TagSNP-20844875 in the rice genome where LCd41-TagSNP-20844875 is T, and genotype AT is the heterozygous type of LCd41-TagSNP-20844875 in the rice genome where LCd41-TagSNP-20844875 is both A and T. A dCAPS molecular marker was designed using this SNP and PCR amplified the genomic DNA of different early rice varieties. The PCR products were digested with the restriction endonuclease NdeI, and two bands of different sizes were detected in electrophoresis. The band size of the variety with high cadmium content in the grain was 194 bp (base pair), and the band size of the variety with low cadmium content in the grain was 163 bp (base pair). These two bands showed good polymorphism in agarose gel electrophoresis. This dCAPS marker can analyze the polymorphism of nucleotides at position 20844875 of the LCd41 gene in the tested rice varieties.

[0027] Primer Design: The TagSNP-20844875 primer pair is a primer pair designed based on dCAPS technology for detecting SNP polymorphic sites. The TagSNP-20844875 primer pair consists of one forward primer and one reverse primer, with the specific sequences as follows: Forward primer F1: 5'-GATGTCTCGCATCGATCAACCGGTTCCGCCAT-3' (SEQ ID NO.4), Reverse primer R1: 5'-GACACTTCACATTCTCACAAAC-3' (SEQ ID NO.5). The primers can be synthesized by Qingke Biotechnology Co., Ltd.

[0028] DNA extraction: Genomic DNA is extracted from rice leaves, and many DNA extraction methods have been reported. This invention uses the CTAB extraction method.

[0029] PCR amplification: In a 0.2 ml PCR amplification-specific thin-walled tube, add 20 ng of rice genomic DNA, 0.25 μM each of forward and reverse primers, and 10 μl of 2×Rapid Master Mix (P222). Adjust the volume to 20 μl with double-distilled water and mix thoroughly. The PCR reagents used in this invention are from Novizan. PCR amplification was performed on a thermal cycler under the following conditions: denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, for 35 cycles; followed by a final extension at 72°C for 5 minutes. The thermal cycler used in this invention is a BioRad T100 model.

[0030] Enzyme digestion of PCR products: Take 10 μl of the obtained PCR product, add 2 μl of CutSmart Buffer and 1 unit of restriction endonuclease NdeI, and bring the volume to 20 μl with double-distilled water. Mix thoroughly and incubate at 37°C for 3 hours or overnight. The endonuclease and buffer used in this invention are products of NEB Corporation.

[0031] Electrophoresis of enzyme digestion products: A 4% agarose gel was prepared using 1×TBE electrophoresis buffer. 20 μl of the resulting digestion product was mixed with 2 μl of 10×Loading Buffer and added to the wells of the gel. A 100bp DNA Marker Ladder (Vazyme) was used as a molecular weight control. Electrophoresis was performed at 100V–120V for 1 hour. The gel was stained with ethidium bromide (EB) to reveal the DNA bands. The staining method followed the procedure described in *Molecular Cloning: A Laboratory Manual* (Science Press, 3rd Edition).

[0032] Electrophoretic pattern analysis: Electrophoretic bands on the gel were observed on a gel imaging system (BioRad). The size of the electrophoretic bands was determined by comparing them with DNA markers. The 194bp band of the early rice variety LCd41 gene TagSNP-20844875 nucleotide site was TT type. The 163bp band of the early rice variety LCd41 gene TagSNP-20844875 nucleotide site was AA type. The 194bp and 163bp bands of the early rice variety LCd41 gene TagSNP-20844875 nucleotide site was AT type.

[0033] 2. The CAL1 gene is located at nucleotide 25190881 on chromosome 2 of rice. TagSNP-25190881 is a SNP site in the rice genome, which is C / G polymorphic and has two genotypes. Genotype CC is the homozygous type of CAL1-TagSNP-25190881 in the rice genome, and genotype GG is the homozygous type of G in CAL1-TagSNP-25190881 in the rice genome. Genotype CG is the heterozygous type of CAL1-TagSNP-25190881 in the rice genome. Genomic DNA was extracted from the leaves of early rice varieties. PCR amplification was performed using the specific primer pairs shown in SEQ ID No. 6 and SEQ ID No. 7. The forward primer sequence for CAL1-TagSNP-25190881 was F1: ACCAAGGTGGCGGAGGC (SEQ ID No. 6); the reverse primer sequence was R1: AGCCGACGAGCAATGCG (SEQ ID No. 7). The PCR products were analyzed using sequencing to determine the nucleotide types of TagSNP-25190881. The TagSNP-25190881 genotype was then determined for each early rice variety based on the nucleotide types.

[0034] 3. The LCd38 gene is located at nucleotide 20089955 on chromosome 10 of rice. TagSNP-20089955 is a SNP site in the rice genome, which is a C / T polymorphism. There are two genotypes: genotype CC is the homozygous type of LCd38-TagSNP-20089955 in the rice genome where LCd38-TagSNP-20089955 is C, genotype TT is the homozygous type of LCd38-TagSNP-20089955 in the rice genome where LCd38-TagSNP-20089955 is T, and genotype CT is the heterozygous type of LCd38-TagSNP-20089955 in the rice genome where LCd38-TagSNP-20089955 is both C and T. A dCAPS molecular marker was designed using this SNP and PCR amplified the genomic DNA of different early rice varieties. The PCR products were digested with the restriction endonuclease TspRI, and two bands of different sizes were detected in electrophoresis. The band size of the variety with high cadmium content in the grain was 114 bp (base pair), and the band size of the variety with low cadmium content in the grain was 168 bp (base pair). These two bands showed good polymorphism in agarose gel electrophoresis. This dCAPS marker can analyze the polymorphism of nucleotides at position 20089955 of the LCd38 gene in the tested rice varieties.

[0035] Primer Design: The TagSNP-20089955 primer pair is a primer pair designed based on dCAPS technology for detecting SNP polymorphic sites. The TagSNP-20089955 primer pair consists of one forward primer and one reverse primer, with the specific sequences as follows: Forward primer F1: 5'-ATACAGATGCCTTCTCCAATAC-3' (SEQ ID NO.8), Reverse primer R1: 5'-TTTTTAATCTGTCTCACTATGCTTATCCAGATTAACTTATGGAATGCTTACCTACA-3' (SEQ ID NO.9). The primers can be synthesized by Qingke Biotechnology Co., Ltd.

[0036] Genomic DNA was extracted from the leaves of early rice varieties. PCR amplification was performed using the specific primer pairs shown in SEQ ID No. 8 and SEQ ID No. 9. The PCR products were digested with the restriction endonuclease TspRI, and the digested products were detected by electrophoresis. The nucleotide position of TagSNP-20089955 in the LCd38 gene of early rice varieties with an electrophoretic band of 114 bp was CC type, the nucleotide position of TagSNP-20089955 in the LCd38 gene of early rice varieties with an electrophoretic band of 168 bp was TT type, and the nucleotide position of TagSNP-20089955 in the LCd38 gene of early rice varieties with electrophoretic bands of 114 bp and 168 bp was CT type.

[0037] Table 1. Location information of three genes and their SNP sites

[0038] Joint haplotype analysis was performed on the SNP molecular markers of the three genes obtained in Example 1. The results showed that there were a total of four joint haplotypes among the three SNP molecular markers: 1) The combined haplotype Multi-LCL1 is a combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38)AA-GG-CC in the rice genome. That is, the combined haplotype Multi-LCL1 has the genotype AAGGCC, which is a combination genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype GG), and LCd38-TagSNP-20089955 (genotype CC).

[0039] 2) The combined haplotype Multi-LCL2 is a combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38) AA-CC-CC in the rice genome. That is, the combined haplotype Multi-LCL2 has the genotype AACCCC, which is a combination genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

[0040] 3) The combined haplotype Multi-LCL3 is a combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38)TT-CC-TT in the rice genome. That is, the genotype of the combined haplotype Multi-LCL3 is TTCCTT, which is a combination genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype TT), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype TT).

[0041] 4) The combined haplotype Multi-LCL4 is a combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38)TT-CC-CC in the rice genome. That is, the genotype of the combined haplotype Multi-LCL4 is TTCCCC, which is a combination genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype TT), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

[0042] Example 2: Determination of Cadmium Content in Early Rice Grains Using the average value of each planting area as the standard for distinguishing between high and low cadmium content in rice, the LCd41-CAL1-LCd38 genotype of 59 early rice materials was identified using three molecular markers of early rice according to the present invention. The cadmium accumulation phenotypes of the 59 early rice materials were collected from three field trials (Field 1, Field 2, and Field 3) with light and moderate pollution. In Field 1, the cadmium concentration was 0.48 mg / kg and the pH was 5.13; in Field 2, the cadmium concentration was 1.33 mg / kg and the pH was 5.82; and in Field 3, the cadmium concentration was 0.67 mg / kg and the pH was 5.61. Genomic DNA was extracted from the 59 early rice materials listed in Table 2, and genotyping was performed using the three molecular markers of the rice cadmium accumulation-related gene LCd41-CAL1-LCd38, following the method described in Example 1.

[0043] Table 2 shows the cadmium content of the combined haplotypes in 59 early rice varieties. The results indicate that there are a total of 4 combined haplotypes for the above 3 molecular markers: 1) The combined haplotype Multi-LCL1 is the combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38)AAGGCC in the rice genome. That is, the combined haplotype Multi-LCL1 has the genotype AAGGCC, which is the combined genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype GG), and LCd38-TagSNP-20089955 (genotype CC).

[0044] 2) The combined haplotype Multi-LCL2 is the combined haplotype of the three SNPs in the rice genome with molecular markers (LCd41-CAL1-LCd38)AACCCC. Specifically, the combined haplotype Multi-LCL2 has the genotype AACCCC, which is a combination of three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC). 3) The combined haplotype Multi-LCL3 is the combined haplotype of the three SNP molecular markers (LCd41-CAL1-LCd38)TTCCTT in the rice genome. Specifically, the genotype of the combined haplotype Multi-LCL3 is TTCCTT, which is the combined genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype TT). 4) The combined haplotype Multi-LCL4 is the combined haplotype of the three SNPs in the rice genome with molecular markers (LCd41-CAL1-LCd38)TTCCCC. Specifically, the combined haplotype Multi-LCL4 has the genotype TTCCCC, which is a combination of the three SNPs: LCd41-TagSNP-20844875 (genotype TT), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC). Table 2 shows the cadmium content of the combined haplotypes in 59 early rice varieties. The mean cadmium content of rice grains in the combined haplotype Multi-LCL1 in the three field trials (Field 1 to Field 3) was 0.05 mg / kg, 0.40 mg / kg, and 0.04 mg / kg, respectively. The mean cadmium content of rice grains in the combined haplotype Multi-LCL2 in the three field trials (Field 1 to Field 3) was 0.06 mg / kg, 0.53 mg / kg, and 0.03 mg / kg, respectively. The mean cadmium content of rice grains in the combined haplotype Multi-LCL3 in the three field trials (Field 1 to Field 3) was 0.21 mg / kg, 0.96 mg / kg, and 0.21 mg / kg, respectively. The mean cadmium content of rice grains in the combined haplotype Multi-LCL4 in the three field trials (Field 1 to Field 3) was 0.27 mg / kg, 1.01 mg / kg, and 0.26 mg / kg, respectively. The cadmium content in rice grains of Multi-LCL1 was significantly lower than that of Multi-LCL3 and Multi-LCL4 under all three field trial conditions. The cadmium content in rice grains of Multi-LCL1 was within the safe limit for rice (<0.2 mg / kg) under both Field 1 and Field 3 field trial conditions, and significantly lower than that of Multi-LCL2 under Field 2 field trial conditions. This indicates that Multi-LCL1 is a low-cadmium combined haplotype and can be used for early pre-selection and screening of cadmium accumulation in early rice grains, for molecular marker-assisted selection breeding of early rice, and for the breeding of low-cadmium early rice. In breeding low-cadmium early rice, it is best to select the combined haplotype Multi-LCL1, specifically early rice with the (LCd41-CAL1-LCd38)AAGGCC genotype, as the parent for breeding.

[0045] Table 2. Cadmium content in rice grains of 59 early rice varieties and genotypes of four combined haplotypes LCd41-CAL1-LCd38

[0046] In summary, this invention discloses the application of a combined haplotype molecular marker of LCd41, CAL1, and LCd38, genes related to cadmium content in early rice grains. This belongs to the field of biotechnology, specifically involving the application of the three combined haplotype molecular markers Multi-LCL for LCd41, CAL1, and LCd38. By detecting the polymorphisms or genotypes of these three SNPs in early rice varieties to identify or assist in the identification of cadmium content in rice grains, the cadmium content in early rice grains with the low-cadmium combined haplotype Multi-LCL1 was significantly lower than that of Multi-LCL2, Multi-LCL3, and Multi-LCL4. This indicates that the combined haplotype Multi-LCL1 can be used for early prediction and screening of cadmium accumulation in early rice grains, and can be used for rice breeding and the selection of low-cadmium rice varieties.

[0047] SEQ ID NO.1 (LCd41-TagSNP-20844875): GGCTCTCAACTCAAGTATTCATCCTTCTGAAATCTGATTTCTTTCTTTCCAATTACCAGTATTTCTGATGTTATCTGTTGCAATGTGCAGGGTTTGCTCTTGTATGCAGGTAATGGCACATTTTTTTTTTTACTTTCCTCCTGAATAATCTCACTGCTTTAAATTCCTGATATCTTATGATGAAACTGCAAAATGTAAATTCAGACACAGCACAAGGTCGAGATGGACAAGAGG GACGGCAAGTTTGGACCTATGACAGTGCCTCCAATGCAGCAGATGTCTCGCATCGATCAACCGGTTCCGCCTTWTGTTGGGTATGCGCCACAGGCACAGCCAGCATACTACAGGTAGCCTGATGGTGGCTATCCAAGAGTTCAACATACAGATCATGCATGCTCAAGATTTTCTGTAGCAAAGTGAAGGATGGTGATCAAGTAGATACATAGTGTTTGTGAGAATGTGAAGTGTC SEQ ID NO.2 (CAL1-TagSNP-25190881): AGATGGGGACGACCAAGGTGGCGGAGGCGAGGCACTGCCTGTCGCAGAGCCACAGGTTCAAGGGCATGTGCGTGAGCAGCAACAACTGCGCCAACGTGTGCAGGACGGAGAGCTTCCCCGACGGCGAGTGCAAGTCGCACGGCRTCGAGCGCAAGTGCTTCTGCAAGAAGGTCTGCTAGTGCATGCTAGCCCCGCTGTCTCTGCAGTCGCATTGCTCGTCGGCTGTGTATCT SEQ ID NO.3(LCd38-TagSNP-20089955): GTCACAAAGAAGAAATAATGGCACCATGGTAACTATGCAAGTGGTGAAAGTCTTCAACTGAAAAACCATTTGCTTTTGTTTTCCTTATGGTGCAGTATTCTAACCAAATCAAGAATCATATGTAGAGATTGCAGGGTATTTTATATTTTAATGAAACATTTCACAGGATAAGCATACAGATGCCTTCTCCAATACTGGCTTCAGACAAAAGCAAAGGATATCAGCTAAGACAGAATGATGATGTCATTGGCAGGCAGCAGGGAAGTGGTAAAAGCACCCACAYTGTGTAGGTAAGCATTCCATAAG SEQ ID NO.4: GATGTCTCGCATCGATCAACCGGTTCCGCCAT SEQ ID NO.5: GACACTTCACATTCTCACAAAC SEQ ID NO.6: ACCAAGGTGGCGGAGGC SEQ ID NO.7: AGCCGACGAGCAATGCG SEQ ID NO.8: ATACAGATGCCTTCTCCAATAC SEQ ID NO.9: TTTTTAATCTGTCTCACTATGCTTATCCAGATTAACTTATGGAATGCTTACCTACA Therefore, those skilled in the art will recognize that although embodiments of the present invention have been shown and described in detail herein, many other variations or modifications conforming to the principles of the present invention can be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the invention. Thus, the scope of the present invention should be understood and recognized as covering all such other variations or modifications.

Claims

1. The application of a substance containing the genotype of the combined haplotype molecular marker Multi-LCL (LCd41, CAL1, and LCd38) related to the detection of cadmium content in early rice grains in the identification of cadmium content in early rice grains or in the preparation of products for identifying cadmium content in early rice grains, characterized in that, The combined haplotype molecular marker consists of three SNPs: LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955, and is denoted as the combined haplotype molecular marker Multi-LCL. The sequence of LCd41-TagSNP-20844875 is SEQ ID NO.1, and the 308th nucleotide in SEQ ID NO.1 is either T or A; The sequence of CAL1-TagSNP-25190881 is SEQ ID NO.2, and the 144th nucleotide in SEQ ID NO.2 is C or G; The sequence of LCd38-TagSNP-20089955 is SEQ ID NO.3, and the nucleotide at position 283 in SEQ ID NO.3 is C or T; The cadmium content in the grains of early rice with the genotype AAGGCC for the three SNPs is lower than that of early rice with the genotypes TTCCCC, TTCCTT, or AACCCC for the three SNPs. The early rice with genotype AAGGCC has genotype AA of LCd41-TagSNP-20844875, genotype GG of CAL1-TagSNP-25190881, and genotype combination of 3 SNPs of CC of LCd38-TagSNP-20089955. The early rice with the genotype TTCCCC is a combination genotype of 3 SNPs, namely LCd41-TagSNP-20844875 with genotype TT, CAL1-TagSNP-25190881 with genotype CC, and LCd38-TagSNP-20089955 with genotype CC. The early rice with the genotype TTCCTT has the genotype AA of LCd41-TagSNP-20844875, the genotype CC of CAL1-TagSNP-25190881, and the genotype LCd38-TagSNP-20089955 is a combination genotype of TT with 3 SNPs. The early rice with genotype AACCCC is a combination genotype of three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

2. The application of the substance as described in claim 1 in early rice breeding or the preparation of early rice breeding products, characterized in that, The purpose of the early rice breeding is to cultivate early rice with low cadmium content or to select early rice varieties with low cadmium content.

3. The application as described in any one of claims 1-2, characterized in that, The substance is D1, D2 or D3 as follows: D1: Contains PCR primers for amplifying early rice genomic DNA fragments including LCd41-TagSNP-20844875, CAL1-TagSNP-25190881 and LCd38-TagSNP-20089955 as described in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

4. The application as described in claim 3, characterized in that, The PCR forward primer sequence for LCd41-TagSNP-20844875 is: F1: 5'-GATGTCTCGCATCGATCAACCGGTTCCGCCAT-3', which is SEQ ID NO.4; the PCR reverse primer sequence for LCd41-TagSNP-20844875 is: R1: 5'-GACACTTCACATTCTCACAAAC-3', which is SEQ ID NO.5; the PCR forward primer sequence for CAL1-TagSNP-25190881 is: F1: ACCAAGGTGGCGGAGGC, which is SEQ ID NO.6; the PCR reverse primer sequence for CAL1-TagSNP-25190881 is: R1: AGCCGACGAGCAATGCG, which is SEQ ID NO.7; the PCR forward primer sequence for LCd38-TagSNP-20089955 is: F1: 5'-ATACAGATGCCTTCTCCAATAC-3' is SEQ ID NO.8; the PCR reverse primer sequence for CAL1-TagSNP-25190881 is: R1: 5'-TTTTTAATCTGTCTCACTATGCTTATCCAGATTAACTTATGGAATGCTTACCTACA-3', which is SEQ ID NO.

9.

5. A method for identifying the cadmium content in early rice grains, characterized in that, The method is as follows: The combined genotypes of the three SNPs described in claim 1—LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955—were detected in the early rice to be tested. The cadmium content of the early rice grains was then determined based on the genotypes of the tested early rice. The cadmium content in the grains of early rice with the genotype AAGGCC for the three SNPs is lower than that of early rice with the genotypes TTCCCC, TTCCTT, or AACCCC for the three SNPs. The early rice with genotype AAGGCC has genotype AA of LCd41-TagSNP-20844875, genotype GG of CAL1-TagSNP-25190881, and genotype combination of 3 SNPs of CC of LCd38-TagSNP-20089955. The early rice with the genotype TTCCCC is a combination genotype of 3 SNPs, namely LCd41-TagSNP-20844875 with genotype TT, CAL1-TagSNP-25190881 with genotype CC, and LCd38-TagSNP-20089955 with genotype CC. The early rice with the genotype TTCCTT has the genotype AA of LCd41-TagSNP-20844875, the genotype CC of CAL1-TagSNP-25190881, and the genotype LCd38-TagSNP-20089955 is a combination genotype of TT with 3 SNPs. The early rice with genotype AACCCC is a combination genotype of three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype CC), and LCd38-TagSNP-20089955 (genotype CC).

6. The application of the method according to claim 5 in early rice breeding, characterized in that, The early rice breeding specifically refers to: The combined genotypes of the three SNPs described in claim 1—LCd41-TagSNP-20844875, CAL1-TagSNP-25190881, and LCd38-TagSNP-20089955—were detected in the early rice to be tested. Early rice with the genotype AAGGCC of these three SNPs was selected as the parent for breeding. The early rice with genotype AAGGCC is the combined genotype of the three SNPs: LCd41-TagSNP-20844875 (genotype AA), CAL1-TagSNP-25190881 (genotype GG), and LCd38-TagSNP-20089955 (genotype CC). The purpose of this early rice breeding is to cultivate early rice with low cadmium content in the grains or to select early rice varieties with low cadmium content in the grains.

Images