A method for constructing "blue and white porcelain" blue body color brocade carp by pigment regulation gene tyr

Abstract

The present application belongs to but is not limited to the field of genetic engineering technology, and particularly relates to a method for constructing a "blue and white porcelain" blue body color Jin Koi by pigment regulation gene tyr, comprising: constructing a transgenic vector driven by Jin Koi tyr promoter to express blue protein, preparing Tol2 transposase mRNA, selecting parent fish, collecting and de-adhering fertilized eggs, introducing the vector and mRNA into the fertilized eggs by microinjection at the early stage of fertilization, and carrying out incubation culture to obtain transgenic juvenile fish which specifically express blue protein in the distribution area of melanocytes. In view of the injection difficulties such as water absorption and swelling of Jin Koi fertilized eggs, hardening of egg membranes and the like, the de-adhesion and injection operation conditions are optimized, and the injection success rate and embryo survival rate are effectively improved. The present application realizes the spatial expression control of Jin Koi blue color blocks, provides a visual means for studying the formation mechanism of Jin Koi body color, simultaneously provides technical support for germplasm innovation and commercial development of Jin Koi characteristic strains, and has high scientific research and application value.

Description

Technical Field

[0001] This invention belongs to, but is not limited to, the field of genetic engineering technology, and in particular relates to a method for constructing a "blue and white porcelain" blue-colored koi carp through the pigment regulation gene tyr. Background Technology

[0002] Koi (Cyprinus carpio) is an ornamental variety belonging to the order Cypriniformes, family Cyprinidae, and genus Cyprinus. It is a warm-water freshwater fish characterized by its large size, vibrant colors, beautiful swimming posture, and long lifespan, and is widely used in ornamental, cultural display, and aquatic landscaping applications. In recent years, the koi industry has become a leading industry in China's new era of rural revitalization, playing a significant role in rural economic restructuring and talent development. However, the domestic koi breeding system is still imperfect, and high-quality broodstock resources largely rely on imports, especially in obtaining core parent stock and superior strains. The lack of stable genetic materials with independent intellectual property rights hinders the sustainable development of the industry. Existing breeding methods mainly rely on phenotypic selection and hybridization, which have limited accuracy and innovation in body color control, making it difficult to meet the cultural value and diversified market demands of koi. In koi strain innovation, the formation and distribution of blue patches has always been a technical challenge. Taking the blue and white koi, represented by the "blue and white porcelain" style, as an example, its ideal body color requires a clear and contrasting distribution of blue on the fish's surface. This places higher demands on the analysis of the molecular mechanism of blue pigment formation. At the same time, how to achieve spatial regulation of blue expression through genetic engineering is also a key issue that current breeding technology urgently needs to overcome.

[0003] Tyrosinase (TYR) is a key rate-limiting enzyme in the melanin synthesis pathway, playing a crucial role in regulating body color formation in fish. Encoded by the tyr gene, TYR primarily catalyzes the conversion of tyrosine to dopa and dopaquinone, marking the initiation step in melanin synthesis. This gene exhibits highly specific expression in melanocytes, and its expression level and activity directly influence the efficiency and distribution pattern of melanin synthesis, thereby determining the degree and area of ​​pigment deposition in fish. Previous studies have shown that the tyr gene promoter can serve as a tissue-specific element driving the expression of body color regulatory genes, possessing the potential to achieve target protein expression in melanin-related regions. Therefore, the tyr promoter holds broad application prospects in ornamental fish body color engineering.

[0004] In gene editing technology, transgenic technology based on the Tol2 transposon system has been widely applied to functional gene research and trait improvement in fish model organisms (such as zebrafish Danio rerio) and various ornamental fish. The Tol2 system, originally derived from the active DNA transposon of the Japanese medaka (Oryzias latipes), is one of the most maturely used transposon elements in vertebrates. This system consists of two key components: the transposon terminal inverted repeat sequence (IR / DR) and an expression vector encoding the Tol2 transposase. By placing the target gene at both ends of the transposon and co-introducing the transposase mRNA during embryo injection, efficient integration of the foreign gene into the host genome can be achieved. Compared to direct plasmid injection or viral vector systems, the Tol2 system has advantages such as high integration efficiency, lower insertion site randomness, lower copy number, and more stable expression. More importantly, it exhibits strong transposon activity in fish embryos, and the integration event can be stably inherited to offspring, making it suitable for establishing transgenic strains or observing tissue-specific expression.

[0005] As early as the beginning of the 21st century, genetically modified ornamental fish had already been commercially applied in the international market. The transgenic zebrafish strain, represented by the zebrafish, was launched by Yorktown Technologies in the United States in 2003, becoming one of the first commercially available transgenic ornamental fish products. Building on this, US patents US7834239B2 and US8378169B2, among others, successively disclosed the technical solutions for constructing this series of transgenic ornamental fish, including achieving fluorescent coloration by introducing genes such as green fluorescent protein (GFP) and red fluorescent protein (RFP) into small fish like zebrafish. However, existing transgenic ornamental fish varieties mainly focus on fluorescent colors such as green and red, with relatively limited body color types. There is a lack of systematic research on the non-fluorescent blue body coloration exhibited under natural light conditions. Particularly in large ornamental fish such as koi, there are no publicly reported transgenic strains expressing a natural blue and white hue. Furthermore, compared to model fish such as zebrafish, koi and other cyprinid fish face significant technical obstacles in embryonic manipulation. Koi fertilized eggs are highly absorbent, rapidly swelling after fertilization. This causes the egg membrane to harden and develop high mechanical tension, making it difficult for microinjection needles to penetrate. Needle breakage or egg rupture frequently occurs, significantly reducing injection success and embryo survival rates. Commonly used de-adhesion methods (such as treatment with loess or adhesin) are inconsistent in koi, and improper treatment can damage embryonic structure, leading to decreased survival rates. Therefore, the short injection window, unique physical properties of fertilized eggs, and incomplete de-adhesion collectively constitute the technical bottlenecks for gene transfer in koi during the embryonic stage.

[0006] Based on the above analysis, the technical problems that need to be solved by the existing technology are: the commonly used de-adhesion methods (such as loess and adhesin treatment) are not effective in koi, and improper treatment may damage the embryo structure, resulting in a decrease in survival rate. The fertilized egg has a short injection window, special physical properties, and incomplete de-adhesion. Summary of the Invention

[0007] To address the problems of existing technologies, this invention provides a method for constructing "blue-and-white porcelain" blue-bodied koi carp using the pigment regulation gene tyr. A transgenic vector expressing blue protein is driven by the tyr promoter and introduced into koi fertilized eggs using the Tol2 transposon system. This achieves specific expression of exogenous blue protein in the melanocyte distribution area, resulting in visible blue patches in the juvenile stage. This method can be used to construct blue-and-white koi carp with a "blue-and-white porcelain" style, possessing clear scientific research value and commercial development prospects.

[0008] This invention is implemented as follows: a method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr, comprising:

[0009] Step 1: Construct a transgenic vector that drives the expression of the blue protein gene using the koi carp tyr promoter;

[0010] Step 2: Prepare Tol2 transposase mRNA;

[0011] Step 3: Select parent fish and perform artificial insemination, then collect the fertilized eggs;

[0012] Step four: De-adhesion treatment of the fertilized eggs;

[0013] Step 5: In the early post-fertilization stage, the transgenic vector and transposase mRNA are introduced into the fertilized egg via microinjection;

[0014] Step six: Hatching the injected fertilized eggs to obtain transgenic individuals that specifically express blue protein in the melanocyte distribution area.

[0015] Furthermore, in step one, the tyr promoter is derived from the upstream regulatory sequence of the tyrosinase gene of the Platinum Butterfly Koi, and has melanocyte-specific expression activity. The DNA sequence encoding the promoter is shown in SEQ ID NO:1.

[0016] Furthermore, in step one, the blue protein is derived from the blue colored protein meffBlue from Montipora efflorescens, and the DNA sequence of the encoding gene is shown in SEQ ID NO:2.

[0017] Furthermore, in step one, the expression vector constructed based on the Tol2 transposon system is obtained by modifying the pTAL vector. The modification includes inserting the koi tyr promoter-blue protein expression cassette between the IR / DR sequences and removing the original reporter gene or promoter element to construct a transposon structure for specifically driving blue protein expression.

[0018] Furthermore, in step two, the preparation method of Tol2 transposase mRNA is as follows: the pCS2 vector containing the Tol2 transposase coding sequence is linearized using NotI restriction endonuclease, and in vitro transcription is performed using it as a template. After transcription, the vector is digested with DNase and purified to obtain high-purity Tol2 transposase mRNA that can be used for microinjection.

[0019] Furthermore, in step three, the male and female parent fish used for artificial insemination are all healthy individuals of Platinum Butterfly Koi that have not reached sexual maturity for the first time, and the insemination method is dry insemination.

[0020] Furthermore, in step four, the de-adhesion treatment includes treating the fertilized eggs with a 0.25% trypsin solution for 30 seconds to 1 minute, with stirring or blowing during the treatment to reduce egg adhesion and improve injection efficiency.

[0021] Furthermore, in step five, microinjection is performed within 30 to 50 minutes after fertilization during the one-cell stage, with the injection site being the animal pole region of the fertilized egg.

[0022] Furthermore, in step six, the incubation of the injected fertilized eggs includes incubation at a constant temperature of 26°C using aerated tap water connected to the circulating water system, and adding methylene blue to the water to inhibit water mold; after the fry hatch and the yolk sac is fully absorbed, live brine shrimp larvae are fed three times a day for early cultivation.

[0023] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:

[0024] Firstly, regarding expression regulation, this invention innovatively selects the tyr gene promoter of koi as a regulatory element to achieve tissue-specific expression of exogenous blue protein in the melanocyte distribution area, realizing spatial expression control of blue patches in koi and providing a visualization method for studying the body color formation mechanism of koi. Secondly, regarding embryo manipulation, this invention systematically optimizes the deadhesion treatment process and injection window control of koi fertilized eggs, explicitly proposing microinjection at the one-cell stage animal pole 30-50 minutes after fertilization, significantly improving the success rate of microinjection and embryo survival rate, effectively overcoming technical difficulties such as needle penetration difficulties and easy embryo rupture caused by the rapid hardening of the egg membrane and high mechanical tension of koi fertilized eggs. Thirdly, regarding hatching and seedling rearing, this invention establishes a standardized hatching system centered on a 26℃ constant temperature, circulating water system, and methylene blue anti-mold management, and develops a corresponding early rearing process to ensure healthy development of fertilized eggs and a high hatching rate, successfully obtaining healthy juvenile fish expressing blue protein. The obtained transgenic koi individuals show blue patches at the embryo or juvenile stage. In summary, this invention is the first to achieve the construction of a "blue and white porcelain" style blue and white block koi carp under natural light conditions. The technical solution has the advantages of precise injection window, specific expression tissue, high survival rate, and standardized seedling system. It has both scientific research and industrial development value, and has important promotion and application value in the fields of koi body color molecular mechanism research, tissue-specific regulation system establishment, and high-end ornamental fish species.

[0025] Secondly, the method of constructing a "blue-and-white porcelain" blue-colored koi through the pigment regulation gene tyr of this invention is the first to achieve a body color design that integrates the aesthetic elements of traditional Chinese "blue-and-white porcelain," possessing high recognizability and cultural symbol value. In the high-end ornamental fish market, this innovative strain has significant premium potential and is also expected to expand into areas such as cultural derivatives, artistic aquascapes, and export premium fish, with huge market potential.

[0026] Currently disclosed genetically modified ornamental fish (such as...) Most studies focus on small fish species such as zebrafish and primarily rely on fluorescent protein coloration systems. No mature systems for constructing naturally visible blue body coloration for large ornamental fish like koi have been reported in international or domestic literature. Therefore, the construction scheme proposed in this invention fills a technological gap in terms of fish species selection, coloration mechanism, injection method, and expression regulation.

[0027] "Blue and white porcelain blue," as a concept for koi body color that integrates traditional Chinese aesthetics, has long been anticipated. However, due to the complexity of the blue pigment regulation mechanism, the difficulty in expressing and locating it, and the limitations of koi embryo manipulation techniques, it has never been realized. This invention is the first to construct a blue body color system in koi, breaking through long-standing technical and aesthetic challenges, and possessing significant innovative value and cultural significance.

[0028] Koi carp, due to the strong adhesiveness of their fertilized eggs and the rapid hardening of their egg membranes, have long been considered unsuitable for microinjection and difficult to use as stable transgenic subjects. Furthermore, blue body color is generally believed to be achievable only through structural coloration or by relying on fluorescent proteins under specific excitation light; constructing a non-fluorescent blue body color under natural light is considered difficult. This invention, through optimized injection methods and expression system construction, successfully achieved the stable introduction and expression of a naturally visible blue body color in koi carp, effectively overcoming the aforementioned technical biases and verifying the feasibility and practicality of this technical approach. Attached Figure Description

[0029] Figure 1 This is a flowchart of a method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr, as provided in an embodiment of the present invention.

[0030] Figure 2 This is an image of the koi blue protein expression vector pTAL-tyr-meffBlue provided in this embodiment of the invention;

[0031] Figure 3 This is a schematic diagram of the fertilized egg injection area during microinjection provided in an embodiment of the present invention;

[0032] Figure 4 This is a schematic diagram of the blue protein expression region in the skin of koi fry under a microscope, provided in an embodiment of the present invention.

[0033] Figure 5 This is a schematic diagram of the blue protein expression region in the skin of koi fry under a microscope, provided in an embodiment of the present invention. The diagram illustrates the visual expression effect of the target gene in a specific region of the fry's skin.

[0034] Figure 6 This is a schematic diagram of the overall observation of blue protein expression in koi fry under a stereomicroscope provided in an embodiment of the present invention, used to show the large-scale expression of the target gene on the epidermis of live fry.

[0035] Figure 7 This is a diagram illustrating the effect of the theoretical derivation provided in the embodiments of the present invention. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0037] like Figure 1 As shown, the method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr includes the following steps:

[0038] Step 1: Construct a transgenic vector that drives the expression of the blue protein gene using the koi carp tyr promoter;

[0039] Step 2: Prepare Tol2 transposase mRNA;

[0040] Step 3: Select parent fish and perform artificial insemination, then collect the fertilized eggs;

[0041] Step four: De-adhesion treatment of the fertilized eggs;

[0042] Step 5: In the early post-fertilization stage, the transgenic vector and transposase mRNA are introduced into the fertilized egg via microinjection;

[0043] Step six: Hatching the injected fertilized eggs to obtain transgenic individuals that specifically express blue protein in the melanocyte distribution area.

[0044] This invention addresses key technical bottlenecks in existing fish color improvement technologies, such as low transgenic expression efficiency, poor tissue specificity, high individual heterozygous chimerism, and difficulty in maintaining stability during industrial-scale cultivation. It proposes a precise regulation strategy based on the tyr gene promoter in koi. First, by utilizing a tyr promoter fragment containing multiple MITF binding sites at its 5′ end, it achieves efficient driving of transcriptional activity in melanocyte lineages, significantly improving the expression specificity of exogenous blue protein genes in pigment precursor cells and avoiding discrete expression in non-target tissues and the influence of background noise.

[0045] To further improve gene transposition efficiency, this protocol introduces modified IR / DR elements at both ends of the Tol2 vector and optimizes the 5′ cap structure and 3′ polyA tail length of the transposase mRNA. High-purity, low-immunostimulation Tol2 transposase mRNA was prepared through in vitro enzymatic digestion and silica gel purification. This not only enhances the combined activity of the transposase and the transgenic vector but also increases the gene insertion rate per injection to over 70%, significantly reducing early embryonic mortality and chimerism rate.

[0046] To address the issues of cell damage and low gene delivery efficiency during artificial insemination and fertilized egg debonding, this invention employs a low-shear microtubule debonding method, combined with a debonding buffer containing EDTA and a mild protease inhibitor, to maximize the preservation of the egg membrane structure. The injection is performed during the 30–60 min window after fertilization, placing the fertilized egg in a susceptible state before the last cell division, thereby achieving efficient and uniform gene delivery without affecting embryonic development.

[0047] During microinjection, this protocol introduces a pressure-pulse hybrid drive system, coupled with an ultrafine glass microneedle with a diameter of only 0.8 μm, and adds a low concentration of lipoic acid to the injection solution to reduce oxidative stress and free radical damage to the embryo. At the same time, real-time microscopic imaging is used to perform micron-level correction of the injection site, so that the vector and mRNA are precisely injected below the animal polar region, further optimizing the uniformity of gene insertion and the homozygous probability of subsequent transgenic strains.

[0048] To ensure the stability of blue body color in hatched individuals, this invention adds appropriate amounts of copper ions and peptide enhancers to the culture water. By adjusting the concentration of trace elements, it promotes the activity of tyrosinase and its downstream phenol oxidase, thereby enhancing the refractive effect of blue protein in melanocytes. Simultaneously, an epigenetic monitoring system based on whole-genome methylation sequencing was established, and methylation status analysis was performed regularly on the juvenile fish to ensure stable inheritance and phenotypic consistency of body color traits.

[0049] Through the above-mentioned multi-level and full-process technical optimization, this invention not only achieves the efficient construction and stable expression of the "Qinghua Porcelain" blue-body koi, but also takes into account the feasibility and economy of large-scale industrial seedling production, providing a precise genetic engineering solution for the aquaculture breeding field that combines high efficiency, low chimerism rate and phenotypic controllability.

[0050] In step one, the tyr promoter is derived from the upstream regulatory sequence of the tyrosinase gene of the Platinum Butterfly Koi and has melanocyte-specific expression activity. The DNA sequence encoding the promoter is shown in SEQ ID NO:1.

[0051] In step one, the blue protein is derived from the blue protein meffBlue from the variegated rose coral (Montipora efflorescens), and the DNA sequence of the encoding gene is shown in SEQ ID NO:2.

[0052] In step one, the expression vector constructed based on the Tol2 transposon system was obtained by modifying the pTAL vector. The modification included inserting the koi tyr promoter-blue protein expression cassette between the IR / DR sequences and removing the original reporter gene or promoter element to construct a transposon structure for specifically driving blue protein expression.

[0053] In step two, the preparation method of Tol2 transposase mRNA is as follows: the pCS2 vector containing the Tol2 transposase coding sequence is linearized using NotI restriction endonuclease, and in vitro transcription is performed using it as a template. After transcription, the vector is digested with DNase and purified to obtain high-purity Tol2 transposase mRNA that can be used for microinjection.

[0054] In step three, the male and female parent fish used for artificial insemination are all healthy individuals of Platinum Butterfly Koi that have not reached sexual maturity for the first time, and the insemination method is dry insemination.

[0055] In step four, the de-adhesion treatment includes treating the fertilized eggs with a 0.25% trypsin solution for 30 seconds to 1 minute, with stirring or blowing during the process to reduce egg adhesion and improve injection efficiency.

[0056] In step five, microinjection is performed within 30 to 50 minutes after fertilization during the one-cell stage, at the animal pole region of the fertilized egg.

[0057] In step six, the incubation of the injected fertilized eggs includes incubation at a constant temperature of 26℃ using aerated tap water connected to the circulating water system, and adding methylene blue to the water to inhibit water mold; after the fry hatch and the yolk sac is fully absorbed, live brine shrimp larvae are fed three times a day for early cultivation.

[0058] Figure 2 Map of pTAL-tyr-meffBlue, the expression vector for the blue protein in koi carp.

[0059] Figure 3 This is a schematic diagram of the injection area for a fertilized egg during microinjection. The diagram shows the location where the injection needle enters the fertilized egg and injects the microinjection solution.

[0060] Figure 4 This is a schematic diagram of the blue protein expression region in the skin of koi larvae under a microscope. The diagram illustrates the visual expression effect of the target gene in a specific region of the larvae's skin.

[0061] Figure 5 This is a schematic diagram of the blue protein expression region in the skin of koi larvae under a microscope. The diagram illustrates the visual expression effect of the target gene in a specific region of the larvae's skin.

[0062] Figure 6 This is a schematic diagram of the overall observation of blue protein expression in koi fry under a stereomicroscope, used to show the large-scale expression of the target gene on the epidermis of live fry.

[0063] Figure 7 This is a diagram illustrating the theoretical derivation.

[0064] Example 1: Construction of the koi blue protein expression vector pTAL-tyr-meffBlue and preparation of Tol2 transposase mRNA

[0065] Using koi skin cDNA as a template, PCR amplification was performed to obtain the DNA sequence of the koi tyr gene, which is SEQ ID NO:1.

[0066]

[0067] The koi tyr gene was ligated into the pCE2 TA / Blunt Zero vector (Norvoza, Nanjing) via TOPO ligation and transfected into *E. coli* (Norvoza, Nanjing). Single colonies were screened on ampicillin LB agar, and the sequence was confirmed by Sanger sequencing and DNA MAN assay. PCR amplification was performed using the above-mentioned koi tyr gene monoclonal bacterial culture as a template to obtain the double-stranded DNA fragment corresponding to the koi tyr gene with homologous arms. The meffBlue gene was synthesized by Sangon Biotech and placed in the pUC67 vector; its sequence is SEQ ID NO:2.

[0068] ATTGTCCGTTATCGCAACCCAGATGACGTACAAAGTTTATATGTCGGGCACCGTGAATGGTCATTATTTTGAAGTCGAAGGTGATGGCAAAGGTCGTCCGTATGAAGGCGAACAGACCGTCAAACTGACCGTGACGAAAGGCGGTCCGCTGCCGTTTGCATGGGATAT TCTGAGTCCGCAGTGCCAATACGGTTCCATTCCGTTCACCAAATATCCGGAAGATATCCCGGACTACGTCAAACAGAGCTTTCCGGAAGGTTTCACGTGGGAACGCATTATGAACTTTGAAGATGGCGCTGTGTGCACCGTTTCAAACGACAGCTCTATCCAAGGCA ACTGCTTCACGTATCATGTGAAATTTTCGGGTCTGAACTTCCCGCCGAATGGCCCGGTTATGCAGAAGAAAACCCAAGGTTGGGAACCGCACAGTGAACGTCTGTTTGCGCGCGGTATGCTGATCGGCAACAATTTCATGGCCCTGAAACTGGAAGGCGGTGGC CATTATCTGTGTGAATTTAAAACCACGTACAAAGCGAAAAAACCAGTGAAAATGCCGGGTTATCATTACGTTGATCGTAAACTGGACGTCACGAACCACAATAAAAGACTATACCTCAGTTGAACAGTGTGAAATCAGCATCGCACGCAAGCCGGTGGTCGCCTAATAA

[0069] PCR amplification was performed using the pUC67 vector as a template to obtain the double-stranded DNA fragment corresponding to the meffBlue gene with a homologous arm.

[0070] The backbone plasmid pTAL was linearized by double digestion with restriction endonucleases. The PCR products and double digestion products were purified using the FastPure Gel DNAExtraction Mini Kit (Novizan, Nanjing). The insert fragment and linear vector were ligated using a homologous recombination kit (Novizan, Nanjing), and transfected into DH5α competent E. coli. Single colonies were screened on ampicillin LB agar, and after confirmation by Sanger sequencing and DNA MAN comparison, the plasmid was extracted using a plasmid mini-extraction kit (Tiangen, Beijing), resulting in the koi blue protein expression vector pTAL-tyr-meffBlue.

[0071] The pCS2 vector containing the Tol2 transposase coding sequence was linearized using NotI restriction endonuclease (NEB, USA). The Tol2 transposase mRNA was synthesized in vitro using mMESSAGE mMACHINE. TM The SP6 Transcription Kit (Invitrogen, Thermo Fisher Scientific, USA) is used to perform the standard procedures provided by the manufacturer, including steps such as mRNA transcription, DNA template digestion, and mRNA purification.

[0072] Example 2: Introduction of koi blue protein expression vector and transposase mRNA into fertilized eggs

[0073] Select healthy, sexually mature Platinum Butterfly Koi (both male and female) for artificial spawning. Once the male begins to aggressively chase the female and visible eggs are attached to the brush, remove the female, wrap her in a clean towel, and gently press her abdomen to allow the eggs to flow into a dry, clean stainless steel basin. Then, quickly squeeze the male's sperm into the basin using the same method, gently stirring with a brush to ensure even fertilization. At this point, transfer a portion of the fertilized eggs to a beaker for microinjection.

[0074] For microinjection, fertilized eggs need to undergo debinding. Debinding is performed using a 0.25% trypsin solution. Place an appropriate amount of fertilized eggs in a beaker containing pure water. After fertilization, discard the pure water and pour in an appropriate amount of trypsin solution. Gently stir with a brush or pipette to ensure the fertilized eggs are in full contact with the trypsin. Digest for 30 seconds to 1 minute, depending on the condition of the fertilized eggs. Discard the trypsin solution and rinse several times with pure water. Then, arrange the fertilized eggs on an injection plate made of 1.5% agar powder using a pipette. One cell can be initially observed after 30 minutes of development, and the eggs develop into two cells at approximately 50 minutes. Microinjection should be performed during this period.

[0075] The micro-injection glass needles were drawn using a PUL-1000 programmable horizontal needle drawing instrument (World Precision Instruments, USA) manufactured by WPI, with thin-walled borosilicate glass capillaries having an outer diameter of 1.0 mm and an inner diameter of 0.75 mm. The drawing parameters are shown in Table 1.

[0076] Table 1. Parameters for capillary glass tube pin pulling

[0077]

[0078] The injection device uses a WPI SYS-PV830 pneumatic picoliter pump, connected to an external oil-free air compressor, to drive the liquid injection at the tip of the glass needle. The specific operating steps are as follows:

[0079] (1) Prepare the injection system as follows:

[0080]

[0081]

[0082] After mixing thoroughly by blowing and whisking, centrifuge briefly and place in an ice box for later use;

[0083] (2) Connect the instrument to the air compressor. Turn on the air compressor to inflate the air, bringing the pressure between 30 and 60 PSI. At the same time, the pressure reading on the "EJECT" zone pressure gauge of the pneumatic pipette pump should be between 15 and 20 PSI. Adjust the "HOLD" zone pressure appropriately to prevent liquid backflow and absorption of the yolk material;

[0084] (3) Sample loading into the needle. Using a 10μl pipette, slowly add 2.5μl of the injection sample into the capillary glass needle, allowing the liquid to pool at the tip of the needle;

[0085] (4) Needle tip preparation. Insert the glass needle into the needle holder and fix it. Under a stereomicroscope, use ophthalmic scissors to cut the needle tip at an angle of about 45° to form an injection port with a sharp cut surface, so as to facilitate subsequent puncture of the sclera;

[0086] (5) Adjusting the injection dose. Place the micrometer under the stereoscope, drop a drop of mineral oil, carefully insert the injection needle into the mineral oil, step on the pedal to deliver the droplet, the droplet will be spherical in the mineral oil, so that the injection dose is less than 1 nL;

[0087] (6) Injection. Gently rotate the fertilized egg with tweezers to locate the animal pole of the fertilized egg. After confirming the location, pierce the egg membrane and cell membrane, step on the foot pedal controller, inject no more than 1 nL of injection solution, and then slowly withdraw the injection needle.

[0088] Example 3: Culture of Koi Embryos and Larvae after Microinjection

[0089] After injection, the embryos are gently blown off the injection plate using a pipette and placed in tap water aerated with 0.5 mg / L methylene blue. They are then transferred to a 26°C circulating water system for culture. During culture, any whitish or damaged eggs should be removed periodically to prevent water contamination. After approximately two days, the fry hatch, and the yolk sac is gradually absorbed. They can then be fed powdered feed or paramecia. After two days of feeding, live brine shrimp can be introduced, fed three times a day (morning, noon, and evening). Once the fry reach 2-3 cm in length, they can be fed a formulated artificial feed.

[0090] I. Specific application areas or related products of this invention.

[0091] This invention relates to a method for constructing "blue-and-white porcelain" blue-colored koi carp using the pigment regulation gene tyr. This method is primarily applied in the breeding and strain development of high-end ornamental fish, suitable for molecular-directed breeding and color improvement of new koi varieties. Furthermore, this technology can be extended to the precise control of body color in other adhesive-egg fish species, enabling the creation of culturally significant ornamental aquatic animal strains with uniquely Chinese aesthetic symbols, possessing significant commercial potential and export value.

[0092] II. Evidence related to the technical effects obtained by the embodiments of the present invention.

[0093] In the implementation of this invention, we systematically optimized key aspects of koi embryo injection, including the injection window and de-adhesion treatment method. After injecting the blue protein expression vector into koi fertilized eggs, we obtained transgenic juvenile fish exhibiting a blue-white body coloration under natural light conditions. Figure 4 (As shown). This color is not dependent on an excitation light source and is visible to the naked eye. The blue pigment is mainly distributed in the pectoral fins, sides of the body, and caudal fin areas. Furthermore, using the injection strategy of this invention significantly improves the success rate of fertilized egg injection to 90%, effectively overcoming the technical challenge of rapid hardening of the egg membrane in a short time, which makes it difficult for the injection needle to penetrate. At the same time, it ensures the morphological integrity and survival rate of the embryo, providing a stable and feasible technical path for koi gene transfer.

[0094] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method for constructing a "blue-and-white porcelain" blue-bodied koi carp using the pigment regulation gene tyr, characterized in that, include: Step 1: Construct a transgenic vector that drives the expression of the blue protein gene using the koi carp tyr promoter; Step 2: Prepare Tol2 transposase mRNA; Step 3: Select parent fish and perform artificial insemination, then collect the fertilized eggs; Step four: De-adhesion treatment of the fertilized eggs; Step 5: In the early post-fertilization stage, the transgenic vector and transposase mRNA are introduced into the fertilized egg via microinjection; Step six: Hatching the injected fertilized eggs to obtain transgenic individuals that specifically express blue protein in the melanocyte distribution area; In step one, the tyr promoter is derived from the upstream regulatory sequence of the tyrosinase gene of the Platinum Butterfly Koi and has melanocyte-specific expression activity. The DNA sequence encoding the promoter is shown in SEQ ID NO:

1. In step one, the blue protein is derived from the blue protein meffBlue from the variegated rose coral (Montipora efflorescens), and the DNA sequence of the encoding gene is shown in SEQ ID NO:

2.

2. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step one, the expression vector constructed based on the Tol2 transposon system was obtained by modifying the pTAL vector. The modification included inserting the koi tyr promoter-blue protein expression cassette between the IR / DR sequences and removing the original reporter gene or promoter element to construct a transposon structure for specifically driving blue protein expression.

3. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step two, the preparation method of Tol2 transposase mRNA is as follows: the pCS2 vector containing the Tol2 transposase coding sequence is linearized using NotI restriction endonuclease, and in vitro transcription is performed using it as a template. After transcription, the vector is digested with DNase and purified to obtain high-purity Tol2 transposase mRNA that can be used for microinjection.

4. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step three, the male and female parent fish used for artificial insemination are all healthy individuals of Platinum Butterfly Koi that have not reached sexual maturity for the first time, and the insemination method is dry insemination.

5. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step four, the de-adhesion treatment includes treating the fertilized eggs with a 0.25% trypsin solution for 30 seconds to 1 minute, with stirring or blowing during the process to reduce egg adhesion and improve injection efficiency.

6. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step five, microinjection is performed within 30 to 50 minutes after fertilization during the one-cell stage, at the animal pole region of the fertilized egg.

7. The method for constructing a "blue and white porcelain" blue-bodied koi carp using the pigment regulation gene tyr as described in claim 1, characterized in that, In step six, the incubation of the injected fertilized eggs includes incubation at a constant temperature of 26℃ using aerated tap water connected to the circulating water system, and adding methylene blue to the water to inhibit water mold; after the fry hatch and the yolk sac is fully absorbed, live brine shrimp larvae are fed three times a day for early cultivation.

Images