Use of metrnl as a marker and preventive drug for cisplatin-induced kidney injury

Abstract

The application relates to the field of biological medicine, and particularly discloses the use of Metrnl as a marker and a prevention and treatment drug for cisplatin-induced kidney injury. The application studies the change of Metrnl level in a cisplatin-induced acute and chronic kidney injury model, and shows that the blood Metrnl protein level of the model animal is increased, and the kidney tissue Metrnl expression is decreased. It is first proved that METRNL can be used as a diagnostic marker for cisplatin-induced kidney injury. Through Metrnl knockout and overexpression experiments, it is proved that the decrease of Metrnl reduces the proliferation activity of HK-2 cells under the stimulation of cisplatin and aggravates cell apoptosis, and aggravates cisplatin-induced kidney injury; Metrnl overexpression can reduce the injury and inflammation level of HK-2 cells under the stimulation of cisplatin, and reduce cisplatin-induced kidney injury. Metrnl has the effects of preventing and / or treating cisplatin-induced kidney injury.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically the use of Metrnl as a biomarker and preventive drug for cisplatin-induced kidney injury. Background Technology

[0002] Cisplatin is a cytotoxic chemotherapeutic agent widely used to treat various solid tumors, such as testicular cancer, ovarian cancer, head and neck cancer, bladder cancer, lung cancer, cervical cancer, melanoma, and lymphoma. In current combination chemotherapy regimens, cisplatin is one of the most commonly used drugs. Its anticancer mechanism is mainly related to the ability of cisplatin to bind to purine groups on DNA. Nephrotoxicity is one of the most common side effects of cisplatin during chemotherapy for solid tumors. It is mainly characterized by kidney damage, manifested as decreased renal excretion of endogenous metabolites such as blood urea nitrogen and serum creatinine, severely limiting the widespread clinical application of cisplatin.

[0003] METRNL is a secreted protein belonging to the same secreted protein family as Meteorin, also known as Meteorin-like, Cometin, Subfatin, Interleukin-41, and Meteorin-β. Its amino acid sequence shows high similarity across different species. METRNL is distributed throughout various tissues and organs, particularly highly expressed in white adipose tissue, barrier tissues such as the intestinal and respiratory epithelium, and vascular endothelium. Since its discovery, METRNL has had numerous reported functions, involving lipid metabolism, atherosclerosis, neurotrophic factors, damage repair, and immune inflammation. The inventors' research group has conducted several studies on METRNL in recent years, including its effects on lowering blood lipids and blood sugar, protecting the endothelium, combating atherosclerosis, and improving cognitive impairment. However, there are currently no reports on the application of Metrnl in the diagnosis and treatment of cisplatin-induced kidney injury. Summary of the Invention

[0004] The first objective of this invention is to address the shortcomings of the prior art by providing the use of the Metrnl gene or protein or their synergists.

[0005] A second objective of this invention is to address the shortcomings of the prior art by providing the use of the Metrnl gene or protein or their detection reagents.

[0006] To achieve the first objective mentioned above, the technical solution adopted by the present invention is as follows:

[0007] The use of Metrnl protein or gene, or their potentiators, in the preparation of drugs for the prevention and treatment of cisplatin-induced kidney injury.

[0008] Furthermore, kidney injury refers to cisplatin-induced acute kidney injury.

[0009] Furthermore, kidney injury refers to cisplatin-induced chronic kidney injury.

[0010] Preferably, the synergist is a Metrnl gene overexpressing adenovirus.

[0011] To achieve the second objective mentioned above, the technical solution adopted by the present invention is as follows:

[0012] The use of the Metrnl gene or protein as a diagnostic biomarker for cisplatin-induced kidney injury.

[0013] The use of the Metrnl gene or protein or their detection reagents for the preparation of diagnostic reagents or kits for cisplatin-induced kidney injury.

[0014] Furthermore, kidney injury refers to cisplatin-induced acute kidney injury.

[0015] Furthermore, kidney injury refers to cisplatin-induced chronic kidney injury.

[0016] Preferably, the detection reagent is a specific antibody against the Metrnl protein.

[0017] A third aspect of the invention provides the use of the Metrnl gene or protein or an enhancer thereof in the preparation of a cisplatin-protective agent for renal tubular cell cisplatin-induced kidney injury, wherein cisplatin-induced kidney injury refers to cisplatin-induced acute / chronic kidney injury.

[0018] Preferably, the synergist is a Metrnl gene overexpressing adenovirus.

[0019] This invention investigated changes in Metrnl levels in cisplatin-induced acute and chronic kidney injury models, showing elevated Metrnl protein levels in the blood and decreased Metrnl expression in kidney tissue. This provides the first evidence that METRNL can serve as a diagnostic biomarker for cisplatin-induced kidney injury.

[0020] Metrnl knockout and overexpression experiments confirmed that knocking down Metrnl reduced the proliferation of HK-2 cells stimulated by cisplatin and aggravated apoptosis, thus exacerbating cisplatin-induced kidney injury; while overexpression of Metrnl alleviated HK-2 cell damage and inflammation levels stimulated by cisplatin, thus mitigating cisplatin-induced kidney injury. Metrnl has a preventive and / or therapeutic effect on cisplatin-induced kidney injury. Attached Figure Description

[0021] Appendix Figure 1 To illustrate the changes in renal function and Metrnl after a single high-dose cisplatin injection. A. Serum creatinine levels in mice were measured using an automated biochemical analyzer. B. Serum urea nitrogen levels in mice were measured using an automated biochemical analyzer. C. A standard curve for mouse serum Metrnl protein was obtained using ELISA. R 2=0.9993. D. ELISA detection of serum Metrnl protein level. E. Western blot detection of Metrnl protein expression in mouse kidney tissue. F. Statistical graph of Metrnl protein expression in mouse kidney tissue. n=4~5, ** P<0.01, *** P<0.001, **** P<0.0001. veh: solvent control group; cis: cisplatin-treated group.

[0022] Appendix Figure 2 This study describes the changes in renal function and Metrnl protein 28 days after multiple low-dose cisplatin injections. A. Serum creatinine levels in mice were measured using an automated biochemical analyzer. B. Serum urea nitrogen levels in mice were measured using an automated biochemical analyzer. C. Serum Metrnl protein levels were detected using ELISA. D. Metrnl protein expression in mouse kidney tissue was detected using Western blot. E. Statistical graph of Metrnl protein expression in mouse kidney tissue. n = 3–5. * P<0.05, ** P<0.01. veh: solvent control group; cis: cisplatin-treated group.

[0023] Appendix Figure 3 The changes in renal function 28 days after repeated administration of low-dose cisplatin in Metrnl knockout mice with renal tubular epithelium specificity. A. Serum creatinine measured by a fully automated biochemical analyzer. B. Serum urea nitrogen measured by a fully automated biochemical analyzer. C. Serum uric acid measured by a fully automated biochemical analyzer. n = 4–6, ** P<0.01, **** P < 0.0001. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0024] Appendix Figure 4 The 24-hour urinary microalbumin content in Metrnl knockout mice with renal tubular epithelium specificity 28 days after multiple administrations of low-dose cisplatin. A. Standard curve, R 2 =0.9987. B. ELISA detection of urinary microalbumin content. n=5, * P<0.05. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0025] Appendix Figure 5H&E staining of paraffin sections of kidney tissue from Metrnl knockout mice 28 days after multiple administrations of low-dose cisplatin. A. Representative image of H&E staining of kidney tissue. B. Statistical graph of renal tubular injury score. n = 5–6. * P<0.05, **** P < 0.0001. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0026] Appendix Figure 6 TUNEL staining of kidney tissue in Metrnl knockout mice 28 days after multiple administrations of low-dose cisplatin. A. Representative image of TUNEL staining in kidney tissue under a 200x microscope. B. Fluorescence statistics plot obtained from ImageJ software. n=5. * P<0.05, **** P < 0.0001. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0027] Appendix Figure 7 Changes in NGAL protein levels in blood and urine 28 days after repeated administration of low-dose cisplatin in Metrnl knockout mice with renal tubular epithelium specificity. A. ELISA assay to measure blood NGAL protein levels, standard curve R. 2 =0.98719. B. ELISA assay to measure 24-hour urinary NGAL protein levels, standard curve R 2 =0.99743. n = 4~6, * P<0.05, ** P<0.01. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0028] Appendix Figure 8 This study investigated the expression of renal tissue damage markers 28 days after repeated administration of low-dose cisplatin in Metrnl knockout mice with renal tubular epithelium specificity. A. Representative image of NGAL protein expression in renal tissue. B. ImageJ analysis of NGAL protein bands. C. Changes in NGAL mRNA expression in renal tissue. D. Changes in Kim-1 mRNA expression in renal tissue. n = 3–6 * P<0.05, ** P<0.01, *** P<0.001, ****P < 0.0001. veh: solvent control group; cis: cisplatin-treated group; WT: wild-type normal control mice; TE-Metrnl - / - Metrnl knockout mice specific to renal tubular epithelium.

[0029] Appendix Figure 9 To investigate the state and proliferation activity of HK-2 cells after low-dose cisplatin stimulation under Metrnl knockdown (Metrnl shRNA) conditions. A. Microscopic observation of HK-2 cell state after low-dose cisplatin stimulation. B. Cell proliferation activity detected using CCK8 assay. n=24. ** P<0.01, **** P<0.0001. veh: solvent control group; cis: cisplatin-treated group.

[0030] Appendix Figure 10 To investigate apoptosis in HK-2 cells stimulated with low-dose cisplatin under Metrnl knockdown (Metrnl shRNA) conditions. A. Flow cytometry was used to measure HK-2 cell apoptosis. B. The percentage of HK-2 cells undergoing apoptosis was calculated. C. Expression of the apoptosis protein Cleavedcapase 3 was measured. n=3. ** P<0.01, **** P<0.0001. veh: solvent control group; cis: cisplatin-treated group.

[0031] Appendix Figure 11 METRNL overexpression mice (R26-L-METRNL) + / - Mortality and renal function changes in mice 28 days after repeated administration of low-dose cisplatin. A. Survival curve analysis of the two groups of mice. B. Comparison of mortality rates between the two groups of mice. C. Comparison of kidney weight / body weight ratio between the two groups of mice. D. Serum creatinine measured by an automated biochemical analyzer. E. Serum urea nitrogen measured by an automated biochemical analyzer. n = 4–9, *P < 0.05.

[0032] Appendix Figure 12 To investigate the expression of injury markers and inflammation levels in HK-2 cells after low-dose cisplatin stimulation under Metrnl overexpression conditions. A. Real-time PCR was used to detect Metrnl mRNA levels in HK-2 cells. B. Real-time PCR was used to detect Kim-1 mRNA levels, a kidney injury marker, in HK-2 cells. C. Real-time PCR was used to detect IL-6 mRNA levels, an inflammatory cytokine, in HK-2 cells. n=3, *P<0.05, ***P<0.001, ****P<0.0001. veh: solvent control group; cis: cisplatin-treated group. Detailed Implementation

[0033] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the description of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0034] Metrnl protein and gene

[0035] The Metrnl protein used in this article can be naturally occurring, for example, it can be isolated and purified from mammals.

[0036] Furthermore, the Metrnl protein can also be artificially prepared, for example, using conventional genetic engineering techniques. Any suitable Metrnl protein is applicable to this invention. The Metrnl protein includes the full-length Metrnl protein or its bioactive fragment. As a specific embodiment, the Metrnl protein can be a human Metrnl protein, approximately 30 kDa in size, with its amino acid sequence shown in NP_001004431.1.

[0037] The amino acid sequence of the Metrnl protein, formed by the substitution, deletion, or addition of one or more amino acid residues, is also included in this invention. The Metrnl protein or its biologically active fragment includes a sequence of substitutions for a portion of conserved amino acids, the substitutions of which do not affect its activity or retain a portion of its activity. Appropriate amino acid substitutions are well-known techniques in the art, which can be readily implemented and ensure that the biological activity of known molecules is not altered. These techniques have made it clear to those skilled in the art that, generally, changing a single amino acid in a non-essential amino acid region of a polypeptide does not change its biological activity.

[0038] Any bioactive fragment of the Metrnl protein can be used in this invention. Here, a bioactive fragment of the Metrnl protein means a polypeptide that retains all or part of the function of the full-length Metrnl protein. Typically, the bioactive fragment retains at least 50%, 60%, and up to 99% or 100% of the activity of the full-length Metrnl protein.

[0039] This invention can also utilize modified or altered Metrnl proteins, comprising all or some of their amino acids. For example, Metrnl proteins can be modified or altered to improve half-life, efficacy, metabolism, and / or protein potency. The modified or altered Metrnl protein can be a conjugate of a Metrnl protein, or a substitute or artificial amino acid thereof. The modified or altered Metrnl protein or gene may differ from the natural Metrnl protein or gene to some extent, but still possess the functions described in this invention without causing other adverse reactions or toxicity. In other words, any variation that does not affect the biological activity of the Metrnl protein or the biological function of the gene can be used in this invention.

[0040] Metrnl enhancer and its uses

[0041] The term "Metrnl enhancer" includes agonists, upregulators, stabilizers, etc., and refers to any substance that can increase the activity and stability of Metrnl, upregulate Metrnl expression, or increase the effective duration of Metrnl action. These substances can all be used in this invention. They can be compounds, small chemical molecules, biomolecules, etc. The biomolecules can be at the nucleic acid level (including DNA and RNA), at the protein level, or can be viral products that upregulate Metrnl expression, etc.

[0042] Experimental methods not specifically described in the following examples were generally performed according to conventional conditions and methods in the art, including routine experimental techniques in molecular biology, microbiology, recombinant DNA, and immunology, all of which are well known to those skilled in the art. Related techniques are fully described in the following literature: for example, *Molecular Cloning: A Laboratory Manual*, 2nd edition; *DNA Cloning*, Volumes I and II; *Oligonucleotide Synthesis*; *Nucleic Acid Hybridization*; *Protein Purification: Principles and Practice*, 2nd edition; and *Handbook of Laboratory Immunology*, Volumes I-IV. Furthermore, reagents and viral products purchased in the examples were used according to the manufacturer's instructions, unless otherwise specified.

[0043] Example

[0044] 1. Experimental Materials

[0045] 1.1. Experimental Reagents

[0046] Cisplatin: Manufactured by Shanghai Sigma-Aldrich Co., Ltd., Specification: 250mg, Batch No.: MKCM2435.

[0047] Human Metrnl gene overexpression adenovirus: Shandong Weizhen Biotechnology Co., Ltd.

[0048] The coding region sequence of the human METRNL gene was constructed into the pADM-CMV-C-FH-mCMV-copGFP vector, with the kozak sequence GCCACC added before ATG and SfaAII / RsrII restriction sites at both ends. The coding region sequence is:

[0049] ATGCGGGGCGCGGCGCGGGCGGCCTGGGGGCGCGCGGGGCAGCCGTGGCCGCGACCCCCCGCCCCGGGCCCGCCCCCGCCGCCGCTCCCGCTGCTGCTCCTGCTCCTGGCCGGGCTGCTGGGCGGCGCGGGCGCGCAGTACTCCAGCGACCGGTGCAGCTGGAAGGGGAGCGGGCTGACGCACGAGGCACACAGGAAGGAGGTGGAGCAGGTGTATCTGCGCTGTGCGGCGGGTGCCGTGGAGTGGATGTACCCAACAGGTGCTCTCATCGTTAACCTGCGGCCCAACACCTTCTCGCCTGCCCGGCACCTGACCGTGTGCATCAGGTCCTTCACGGACTCCTCGGGGGCCAATATTTATTTGGAAAAAACTGGAGAACTGAGACTGCTGGTACCAGACGGGGACGGCAGGCCCGGCCGGGTGCAGTGTTTTGGCCTGGAGCAGGGCGGCCTGTTCGTGGAGGCCACGCCGCAGCAGGATATCGGCCGGAGGACCACAGGCTTCCAGTACGAGCTGGTTAGGAGGCACAGGGCGTCGGACCTGCACGAGCTGTCTGCGCCGTGCCGTCCCTGCAGTGACACCGAGGTGCTCCTAGCCGTCTGCACCAGCGACTTCGCCGTTCGAGGCTCCATCCAGCAAGTTACCCACGAGCCTGAGCGGCAGGACTCAGCCATCCACCTGCGCGTGAGCAGACTCTATCGGCAGAAAAGCAGGGTCTTCGAGCCGGTGCCCGAGGGTGACGGCCACTGGCAGGGGCGCGTCAGGACGCTGCTGGAGTGTGGCGTGCGGCCGGGGCATGGCGACTTCCTCTTCACTGGCCACATGCACTTCGGGGAGGCGCGGCTCGGCTGTGCCCCACGCTTCAAGGACTTCCAGAGGATGTACAGGGATGCCCAGGAGAGGGGGCTGAACCCTTGTGAGGTTGGCACGGACTGA。

[0050] Human Metrnl gene knockdown lentivirus: Shanghai Hanheng Biotechnology Co., Ltd.

[0051] The siRNA sequence of the shMetrnl group is 5'-CAGGTGCTCTCATCGTTAACC-3', and the siRNA sequence of the shScr group is 5'-TTCTCCGAACGTGTCACGTAA-3'. The constructed lentiviral vector (pHBLV-U6-MCS-PGK-PURO) contains a puromycin resistance gene, which can endow cells successfully transfected with lentivirus with puromycin resistance.

[0052] Pentobarbital sodium: Produced by Merck, Germany, imported and repackaged.

[0053] Mouse neutrophil gelatinase lipocalin-related protein (NGAL) ELISA detection kit: Produced by Wuhan Boster Biological Engineering Co., Ltd., product number: EK0854, batch number: 50419128407.

[0054] NGAL antibody: Produced by Abcam, UK, product number: ab216462, batch number: 1007365-13.

[0055] 1.2. Experimental animals

[0056] C57BL / 6J mice, SPF grade, male, selling unit: Shanghai Bikai Keyi Biotechnology Co., Ltd., production license number: SYXK (Shanghai) 2023-0039.

[0057] Cdh16-cre tool mice, SPF grade, selling unit: Shanghai Model Organisms Center, Inc., production license number: SYXK (Shanghai) 2023-0005.

[0058] Metrnl loxp / loxp Mice: Constructed by this research group.

[0059] Renal tubular epithelial Metrnl-specific knockout mice (TE-Metrnl - / - mice) and their littermate WT mice (Metrnl loxp / loxp mice): Obtained by breeding Cdh16-cre tool mice with Metrnl loxp / loxp mice.

[0060] Mice with overexpression of human METRNL gene in the whole body (R26-L-METRNL + / - mice), and their littermate control WT mice (R26-WT mice): Constructed by this research group. The specific construction method and genotype verification of mice with overexpression of human METRNL gene in the whole body have been published in the paper "Construction and Verification of a Mouse Model with Overexpression of Human METRNL Gene in the Whole Body".

[0061] 1.3. Experimental Cells

[0062] Human renal tubular epithelial HK-2 cells: Shanghai Meiwan Biotechnology Co., Ltd.

[0063] 1.4. Experimental Apparatus

[0064] qPCR instrument: Roche, Switzerland, model: LightCycler 96.

[0065] Rapid wet transfer instrument: Nanjing Genscript Biotech Co., Ltd., Model: eBlot TM L1 type

[0066] Fully automated biochemical analyzer: manufactured by Hitachi High Technology Co., Ltd., Japan, model: HITACHI 7180.

[0067] 2. Experimental Methods

[0068] 2.1. Dosage setting, grouping, and administration

[0069] (1) In the cisplatin-induced acute kidney injury model constructed in C57 mice, the experiment was divided into:

[0070] Solvent control group (veh): Intraperitoneal injection of an equal volume of 1×PBS.

[0071] Cisplatin-treated group (cisplatin group): cisplatin dose 25 mg / kg.

[0072] The experiment employed a single intraperitoneal injection administration method. Cisplatin powder should be stored in a cool, dark place at 4°C. Weighing should be done meticulously to avoid concentration variations that could increase experimental error. Personal protective equipment should be worn during use. Cisplatin powder should be dissolved in 1×PBS solution to prepare a 1 mg / mL concentration. Dissolve the powder on a shaker at 37°C for 1 hour until no precipitate forms. Prepared cisplatin is effective for one month when stored at room temperature in the dark. If precipitation occurs due to temperature drops or other factors, it must be re-dissolved before use.

[0073] (2) In the cisplatin-based chronic kidney injury model constructed in C57 mice, the experiment was divided into:

[0074] Solvent control group (veh): Intraperitoneal injection of an equal volume of 1×PBS.

[0075] Cisplatin dosing group (cisplatin group): cisplatin dose 7.5 mg / kg / dose.

[0076] The experiment used a low-dose, multiple-intraperitoneal-injection method, with intraperitoneal injections administered on days 0, 7, and 21.

[0077] (3) In TE-Metrnl - / -In a cisplatin-based chronic kidney injury model constructed from mice and their littermates (WT mice), the experiment was divided into:

[0078] Solvent control group (veh): Intraperitoneal injection of an equal volume of 1×PBS.

[0079] Cisplatin dosing group (cisplatin group): cisplatin dose 7.5 mg / kg / dose.

[0080] The experiment used a low-dose, multiple-intraperitoneal-injection method, with intraperitoneal injections administered on days 0, 7, and 21.

[0081] (4) In R26-L-METRNL + / - In a cisplatin-based chronic kidney injury model constructed on mice and their littermate control R26-WT mice, the experiment was divided into:

[0082] Solvent control group (veh): Intraperitoneal injection of an equal volume of 1×PBS.

[0083] Cisplatin dosing group (cisplatin group): cisplatin dose 7.5 mg / kg / dose.

[0084] The experiment used a low-dose, multiple-intraperitoneal-injection method, with intraperitoneal injections administered on days 0, 7, and 21.

[0085] (5) In the in vitro cisplatin-simulated stimulation experiment of renal tubular epithelial cells (HK-2 cells), it was divided into:

[0086] Solvent control group (veh): 1×PBS.

[0087] Cisplatin-treated group (cisplatin group): cisplatin concentration 2 μmol / L.

[0088] A 1 mg / mL cisplatin stock solution was filtered through a 0.22 μm filter, and 1 mL was added to 0.67 mL of culture medium to obtain a 2 mmol / L cisplatin working solution. HK-2 cells were seeded in six-well plates at 150,000 cells per well, with 1.5 mL of culture medium added. After 12 hours of normal culture to allow cell attachment, 1.5 μL of cisplatin working solution was added to each well in the cisplatin-treated group to achieve a cisplatin concentration of 2 μmol / L, while the control group received 1.5 μL of PBS solution.

[0089] 2.2. Experimental Procedure

[0090] (1) Changes in Metrnl levels in cisplatin-induced acute and chronic kidney injury models

[0091] C57 mice aged 10-12 weeks were selected and weighed. The cisplatin-treated group received an intraperitoneal injection of 1 mg / mL cisplatin solution at a dose of 25 mg / kg, while the solvent control group received an equal volume of 1×PBS solution intraperitoneally. After 72 hours, the mice were weighed and anesthetized with an intraperitoneal injection of 1% pentobarbital at a dose of 10 mL / kg. Blood was collected from the heart. A small incision was made in the right atrial appendage, and the left ventricle was perfused with ice-cold saline for 2-5 minutes until the kidneys turned white. The collected blood was allowed to stand at room temperature for 1-2 hours, then centrifuged at 3000 rpm for 20 minutes. The supernatant was collected and frozen at -80°C. The kidneys were carefully removed, the renal capsule was peeled off, and the kidneys were frozen at -80°C.

[0092] C57 mice aged 10-12 weeks were selected and weighed. The cisplatin-treated group received intraperitoneal injections of 1 mg / mL cisplatin solution at a dose of 7.5 mg / kg / dose on days 0, 7, and 21. The solvent control group received an equal volume of 1×PBS solution intraperitoneally. On day 28, the mice were weighed and anesthetized by intraperitoneal injection of 1% sodium pentobarbital at a dose of 10 mL / kg. Blood was collected from the heart. A small incision was made in the right atrial appendage, and the left ventricle was perfused with ice-cold saline for 2-5 minutes until the kidneys turned white. The collected blood was allowed to stand at room temperature for 1-2 hours, then centrifuged at 3000 rpm for 20 minutes. The supernatant was collected and frozen at -80°C. The kidneys were carefully removed, the renal capsule was peeled off, and the kidneys were frozen at -80°C.

[0093] The changes in Metrnl expression in cisplatin-induced acute and chronic kidney injury models in mice were observed. Serum creatinine and urea levels were detected using an automated biochemical analyzer. Serum Metrnl protein content was detected by ELISA, and Metrnl protein expression in mouse kidney tissue was detected by Western blot.

[0094] (2) Effects of Metrnl knockout of renal tubular epithelium on cisplatin-induced chronic kidney injury model

[0095] Select TE-Metrnl for 10-12 weeks of age. - / -Mice and their littermates were weighed. The cisplatin-treated group received intraperitoneal injections of 1 mg / mL cisplatin solution at a dose of 7.5 mg / kg / dose on days 0, 7, and 21. The solvent control group received an equal volume of 1×PBS solution intraperitoneally. On day 27, mice were placed in metabolic cages, fasted but allowed free access to water, and 24-hour urine was collected. After centrifugation at 3000 rpm for 20 min, the supernatant was collected and stored at -80°C. On day 28, mice were weighed and anesthetized by intraperitoneal injection of 1% sodium pentobarbital at a dose of 10 mL / kg. Blood was collected from the heart. A small incision was made in the right atrial appendage, and the left ventricle was perfused with ice-cold saline for 2-5 min until the kidneys turned white. The collected blood was allowed to stand at room temperature for 1-2 h, then centrifuged at 3000 rpm for 20 min. The supernatant was collected and stored at -80°C. The kidneys were carefully removed, and the renal capsule was peeled off. The left kidney was stored at -80°C, and the right kidney was fixed in 4% paraformaldehyde.

[0096] Observation of TE-Metrnl - / - The study investigated the differences in the degree of chronic kidney injury between mice and their littermates (WT mice). Serum creatinine and urea levels were measured using an automated biochemical analyzer. Serum and urinary NGAL protein levels (a marker of kidney injury) were detected using ELISA. Urinary microalbumin levels were also detected using ELISA. NGAL expression in mouse kidney tissue was detected using Western blot and qPCR. HE staining was used to detect pathological changes in renal tubules, and TUNEL staining was used to detect renal tissue apoptosis.

[0097] (3) Effects of Metrnl knockdown on proliferation and damage of HK-2 cells under cisplatin stimulation

[0098] After HK-2 cells were plated, they were transfected with human Metrnl gene RNA interference virus at 80% confluency. The vector was resistant to puromycin. The transfected group with the virus in the vector was designated the Metrnl shRNA group, and the group transfected with only the vector was designated the Scramble shRNA group. After cell digestion, the viral load was counted using a counter, and the viral load was calculated based on an MOI of 10. 24 hours after viral transfection, the cells were washed twice with PBS and the culture medium was changed. Puromycin was added to the culture medium to a final concentration of 3 μg / mL. After 48 hours of selection, HK-2 cells with Metrnl knockdown and control cells were obtained. Cells in the Metrnl shRNA group and the Scramble shRNA group were seeded in 6-well and 96-well plates and cultured normally for 12 hours until cell attachment, and then stimulated with cisplatin 2 μmol / L for 72 hours.

[0099] Cell proliferation and apoptosis were observed. The CCK8 assay was used to detect changes in cell proliferation, and Annexin V-FITC staining was followed by flow cytometry to detect apoptosis.

[0100] (4) Effects of systemic overexpression of human Metrnl on a cisplatin-based chronic kidney injury model

[0101] Select R26-L-METRNL for 10-12 week old infants. + / - Mice and their littermate control R26-WT mice were weighed. The cisplatin-treated group received intraperitoneal injections of 1 mg / mL cisplatin solution at a dose of 7.5 mg / kg / dose on days 0, 7, and 21, while the solvent control group received an equal volume of 1×PBS solution intraperitoneally. On day 28, mice were weighed and anesthetized with intraperitoneal injection of 1% sodium pentobarbital at a dose of 10 mL / kg. Blood was collected from the heart, and a small incision was made in the right atrial appendage. The left ventricle was perfused with ice-cold saline for 2-5 minutes until the kidneys turned white. The collected blood was allowed to stand at room temperature for 1-2 hours, then centrifuged at 3000 rpm for 20 minutes. The supernatant was collected and frozen at -80°C. The kidneys were carefully removed, and the renal capsule was peeled off. The left kidney was frozen at -80°C, and the right kidney was fixed in 4% paraformaldehyde.

[0102] (5) Effect of Metrnl overexpression on cisplatin-stimulated HK-2 cells

[0103] After HK-2 cells were plated, they were transfected with a human Metrnl gene-overexpressing adenovirus at 80% confluency. The transfection group with the virus-carrying vector was designated the Metrnl overexpression group, and the group transfected only with the vector was designated the Vector group. After cell digestion, the cells were counted using a cell counter, plated in six-well plates, and after approximately 12 hours of complete cell adhesion, the viral load was calculated based on an MOI of 10. 24 hours after transfection, the cells were washed twice with PBS, and the culture medium was changed. The cells were then cultured for another 24 hours, followed by stimulation with 2 μmol / L cisplatin for 72 hours.

[0104] 3. Experimental Results

[0105] (1) Elevated serum Metrnl levels in cisplatin-induced acute and chronic kidney injury models in mice

[0106] Figure 1 As shown, after intraperitoneal injection of cisplatin 25 mg / kg for 3 days, serum creatinine and blood urea nitrogen in C57 mice increased significantly, indicating a sharp decline in renal function. At the same time, the level of Metrnl protein in the blood increased and the expression of Metrnl in the renal tissue decreased.

[0107] Figure 2 As shown, after three intraperitoneal injections of cisplatin 7.5 mg / kg / time, C57 mice showed elevated serum creatinine and blood urea nitrogen levels on day 28, indicating decreased renal function. At the same time, blood Metrnl protein levels increased, and Metrnl expression in renal tissue decreased.

[0108] It is evident that the level of Metrnl protein in the blood is elevated in cisplatin-induced acute and chronic kidney injury models in mice, suggesting that Metrnl may serve as a biomarker for cisplatin-induced kidney injury.

[0109] (2) Metrnl knockout of renal tubular epithelium exacerbates cisplatin-induced chronic kidney injury.

[0110] Low-dose, multiple-dose administration of cisplatin better aligns with clinically relevant cyclical treatment protocols. Following three intraperitoneal injections of cisplatin 7.5 mg / kg / dose, on day 28, compared to WT mice, TE-Metrnl... - / - Elevated serum creatinine and blood urea nitrogen in mice ( Figure 3 ); elevated levels of microalbumin in urine ( Figure 4 HE staining showed increased renal tubular damage. Figure 5 TUNEL staining showed more pronounced apoptosis in the kidney tissue. Figure 6 The expression of NGAL and Kim-1, markers of kidney injury, was significantly higher in blood, urine, and kidney tissue. Figure 7 and Figure 8 ).

[0111] It is evident that in a mouse model of chronic kidney injury induced by repeated low-dose cisplatin administration, the loss of Metrnl in the renal tubular epithelium exacerbated the consequences of cisplatin-induced kidney injury.

[0112] (3) Knockdown of Metrnl expression reduced the proliferation of HK-2 cells stimulated by cisplatin and aggravated apoptosis.

[0113] like Figure 9 As shown, after cisplatin administration, the state of HK-2 cells was observed under a microscope. Control group cells exhibited a normal cobblestone-like morphology, were firmly adhered to the cell wall, grew actively, and had clear cell membrane boundaries. In contrast, cell growth in the cisplatin-treated group was significantly inhibited, morphological changes occurred, cell membrane edges became blurred, and floating and dying occurred. Compared to the Scramble shRNA control group, the Metalnl shRNA group showed significantly worse cell growth and more floating and dying cells. Cell proliferation activity was detected using the CCK8 assay, revealing that HK-2 cell proliferation was significantly inhibited under low-dose cisplatin stimulation. Compared to the Scramble shRNA group, the Metalnl shRNA group showed a more pronounced decrease in cell proliferation activity. These results indicate that knocking down Metalnl exacerbated cisplatin-induced HK-2 cell death and decreased proliferation activity.

[0114] Phosphatidylserine residues on the inner cell membrane evert to the cell surface during apoptosis. Annexin V, a phospholipid-binding protein, selectively binds to phosphatidylserine. After labeling Annexin V with the fluorescent probe FITC, apoptosis can be detected by flow cytometry. This section uses this method to detect apoptosis in HK-2 cells. Figure 10 As shown, after 72 hours of stimulation with 2 μM cisplatin, the number of apoptotic HK-2 cells significantly increased. Metrnl knockdown exacerbated apoptosis, with statistically significant differences in the percentage of apoptotic cells. Western blot analysis revealed higher expression of cleaved capase 3 protein in cisplatin-stimulated HK-2 cells in the Metrnl shRNA group. These results indicate that Metrnl knockdown intensifies apoptosis in HK-2 cells under low-dose cisplatin stimulation.

[0115] (4) Systemic Metrnl overexpression reduced cisplatin-induced death and chronic kidney injury in mice.

[0116] Following three intraperitoneal injections of cisplatin 7.5 mg / kg per dose, two R26-WT mice died on day 27, and three died on day 28. (R26-L-METRNL) + / - No mice died, and the survival curves indicate that systemic Metrnl overexpression can reduce the mortality rate of mice with cisplatin-induced chronic kidney injury. Figure 11 A, B). Compared with R26-WT mice, R26-L-METRNL + / - The kidney weight of mice showed an increasing trend (P = 0.0567), indicating that kidney atrophy was more severe in R26-WT mice. Figure 11 C) ; R26-L-METRNL + / - Mice had decreased serum creatinine and blood urea nitrogen levels. Figure 11 (D, E). It can be seen that in a mouse model of chronic kidney injury induced by low-dose, repeated cisplatin administration, systemic overexpression of Metrnl alleviated the consequences of cisplatin-induced kidney injury, indicating that Metrnl has an anti-cisplatin-induced kidney injury effect.

[0117] (5) Metrnl overexpression reduces cisplatin-stimulated HK-2 cell damage and inflammation.

[0118] After transfection of HK-2 cells with Metrnl overexpressing virus, the level of Metrnl mRNA was significantly increased, and the level of Metrnl mRNA was further increased after cisplatin stimulation. Figure 12 A); Metrnl overexpression reduced the level of Kim-1 mRNA, a marker of kidney injury under cisplatin stimulation. Figure 12B); Compared with the solvent control group, the cisplatin-treated group showed a significant increase in the level of the inflammatory cytokine IL-6, and Metrnl overexpression reduced the IL-6 mRNA level under cisplatin stimulation. Figure 12 C). The results showed that, at the cellular level, Metrnl overexpression also played a role in counteracting cisplatin-induced kidney injury.

[0119] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. Application of the Metrnl gene or protein or Metrnl gene overexpressing virus in the preparation of drugs for the prevention and treatment of cisplatin-induced chronic kidney injury.

2. The use of a reagent for detecting the Metrnl gene or protein, characterized in that, Diagnostic reagents or kits for cisplatin-induced chronic kidney injury.

3. The use according to claim 2, characterized in that, The detection reagent for the Metrnl protein is a specific antibody against the Metrnl protein.

4. Application of the Metrnl gene or protein or Metrnl gene overexpressing virus in the preparation of a protective agent against cisplatin-induced proximal tubule epithelial cell damage.

Images