A method to improve peanut plant regeneration and genetic transformation efficiency through GRF-GIF chimeric genes

Abstract

This invention belongs to the field of plant genetic engineering and genetic breeding technology, specifically relating to a method for improving peanut plant regeneration and genetic transformation efficiency through GRF-GIF chimeric genes. This invention provides a method for improving peanut tissue regeneration efficiency and genetic transformation success rate through GRF-GIF chimeric genes. The method involves constructing AhGRF5-AhGIF2 and AhGRF5-AhGIF2 chimeric gene expression vectors, transforming peanut explants, and then obtaining transgenic plants via somatic embryo regeneration or direct organ regeneration. This invention overcomes the technical bottlenecks in peanut genetic transformation, such as low regeneration efficiency, low transformation success rate, and strong genotype dependence. The somatic embryo induction rate can reach 100%, and the transformation efficiency is increased to 84.85%, providing a highly efficient technical platform for peanut gene function research and molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and genetic breeding technology, specifically relating to a method for improving the regeneration and genetic transformation efficiency of peanut plants through GRF-GIF chimeric genes. Background Technology

[0002] Peanuts (Arachis hypogaea L.) are an important global oilseed and economic crop, playing a vital role in agricultural production. However, the development of their genetic transformation technology is relatively lagging, severely restricting the progress of molecular breeding. Currently, the main technical bottlenecks include low transformation efficiency (usually less than 5%), strong genotype dependence (transformation efficiency differences between different varieties can reach more than 5 times), and an imperfect regeneration system (long cycle, many chimeras). Traditional transformation methods, such as Agrobacterium-mediated transformation, are easily limited by genotype, gene gun methods are costly, and pollen tube pathway methods have poor stability. Although some improvements have been made, such as optimizing culture media and adding antioxidants, the effects are limited, with transformation efficiency only increasing by 2-3 percentage points, which is insufficient to meet the needs of modern molecular breeding. Especially against the backdrop of the rapid development of gene editing technology, inefficient transformation systems have become a major obstacle to peanut functional genomics research and molecular design breeding. Taking the improvement of important traits such as aflatoxin resistance and high oleic acid as examples, the low transformation efficiency significantly prolongs the cycle from gene identification to variety breeding. Therefore, developing efficient, stable, and universally applicable peanut genetic transformation technologies and breaking through existing technological bottlenecks is of great significance for promoting peanut molecular breeding and industrial upgrading.

[0003] GRFs (Growth-regulating factors) and GIFs (GRF-interaction factors) are key transcription factors regulating plant cell proliferation and organ regeneration, playing crucial roles in plant growth, development, and regeneration. In recent years, numerous studies in molecular biology and plant biotechnology have confirmed that GRF-GIF chimeric proteins constructed through genetic engineering exhibit significant biological effects in plant in vitro regeneration systems and crop genetic transformation. For example, in wheat transgenic technology research, genetic transformation using a chimera composed of TaGRF4 and TaGIF1 significantly improved the regeneration efficiency and speed of wheat and expanded the range of transformable wheat genotypes. Furthermore, research in watermelon showed that transforming wild watermelon material TC using the ClGRF4-ClGIF1 chimeric gene successfully increased the transformation efficiency to 47.02%. In soybean, an ectopic expression of the GmGRF3-GmGIF1 chimeric gene increased the average transformation efficiency of soybean by 2.74 times. In peanut, researchers identified 20 AhGRF genes and 7 AhGIF genes in the cultivated peanut genome. However, there are currently no reports on applying GRF-GIF chimeric genes to peanuts to improve their tissue regeneration and genetic transformation efficiency. Studying the effects of GRFs and GIFs genes in peanuts on plant regeneration and genetic transformation efficiency, and utilizing this technology to improve peanut genetic transformation efficiency, is of great significance for constructing an efficient peanut transformation system. Summary of the Invention

[0004] The purpose of this invention is to address the problems of weak regeneration capacity, low efficiency of genetic transformation systems, and genotype limitations in existing peanut plants by providing a method to improve the regeneration and genetic transformation efficiency of peanut plants through GRF-GIF chimeric genes.

[0005] This invention is achieved through the following technical solution:

[0006] A method for improving peanut plant regeneration and genetic transformation efficiency through GRF-GIF chimeric genes includes the following steps:

[0007] (1) Cloning the CDS sequences of the AhGRF5 and AhGIF2 genes;

[0008] (2) Construct an expression vector containing the chimeric genes AhGRF5-AhGIF2 and AhrGRF5-AhGIF2;

[0009] (3) The expression vector was transformed into peanut explants;

[0010] (4) Culture the transformed explants and induce tissue regeneration;

[0011] (5) Select transgenic plants.

[0012] Furthermore, the sequence of the AhGRF5 gene is shown in SEQ ID NO.1, and the sequence of the AhGIF2 gene is shown in SEQ ID NO.2.

[0013] SEQ ID NO.1:

[0014] 5’-ATGCACCCCACGTGTTTGATTTTTGGTCTGGAAGCCTTAAATAGCACTGGTGGAGGCGGTGGAGTTGGAGTTGGTGTTGGTGGTGGTGGTGGTGGTGGTTGTAGTGGTGGTGGGGCAGGGATGATGAGTAGTACTAGCAGGTCGCCATTCACAGTGTCTCAGTGGCAGGAACTGGAGCACCAAGCTCTGATTTACAAGTACATGGTGGCTGGTCTTCCTGTTCCTCCTGATCTTGTTATCCCCATTCAGAAGAGCTTTGACTCTATTTCCCATTCCTTCTTCCACCACCCTGCTCTGAGTTATTGTTCTTTCTATGGGAAGAAGGTGGACCCGGAGCCAGGACGATGCAGGAGAACTGATGGGAAAAAGTGGAGGTGCTCTAAGGAAGCATACCCGGACTCCAAGTACTGTGAGCGACACATGCACCGTGGCCGCAACCGTTCAAGAAAGCCTGTGGAATCACAATCTATGACACAGTCATCATCCACTGTGACATCACTGACTGCTACAACTGGTGGCAGCAGTGGAACTGGAAGTTACCAGAACCTTAACACAATTACCTTTGCTAATCCTCAAGGCACTGGTTCTGGAGCTGAACAGACACATTATCATTTGGATTCTATCCCCTATGGGATTCCAAGCAGAGAGTACAGGTATCTTCAGGGAAATAAATCAGAGGGTGGCGAACAGAGTTTCTTTTCCAAAGCTTTAGGAAGCAACAAGGAACTTCGGATCGAAACGCAGCTGGAAAACACTTTGATGCCAACCAGAGTTGCCTCCTTCTCAACATCAAGATCAAACAACAACTCCATTTTGCCGGGTGATTATCTGCAGAATTCATATTTATCCGACGAGCATGCATCGGGTGAATCTGTGAAGCATGAGGGTCAGTCTCTTCGACCTTTCTTTGATGAATGGCCTAGGAGCAGGGATTCATGGTCTGGTCTGGAAGCAACTCAGCTGTCCATGTCCATTCCTATGTCGGCGTCGAACTTCTCTACAGCCAGCTCTCAATCCTCGCATGGCGAGACTAAATAA-3’

[0015] SEQ ID NO.2:

[0016] 5'-ATGCAGCAGCACCTGATGCAGATGCAGGCCATGATGGCAGCTTACT -3'

[0017] Furthermore, the AhGRF5 in the chimeric gene is a mutant AhGRF5, whose miR396 target site is mutated, resulting in ACAGGTGGTCAGACCGATTGCG.

[0018] Furthermore, the expression vector is pBWA(V)BVE, and the chimeric gene is expressed by a β-estradiol-induced XVE promoter.

[0019] Furthermore, the explant is an embryonic leaflet or a mesocotyl.

[0020] Furthermore, the culture described in step (4) adopts either the somatic embryo regeneration pathway or the direct organ regeneration pathway.

[0021] Furthermore, the somatic embryo regeneration pathway includes the following steps:

[0022] 1) The transformed embryonic leaflets were cultured in somatic embryo induction medium;

[0023] 2) The induced somatic embryos were cultured in somatic embryo regeneration medium to produce buds;

[0024] 3) Select the buds for resistance in the selection medium.

[0025] Furthermore, the direct organ regeneration pathway includes the following steps:

[0026] 1) The transformed mesocotyl was cultured in a bud induction medium to produce buds;

[0027] 2) Elongate the buds in an elongation medium;

[0028] 3) Resistance screening is performed in the screening medium;

[0029] 4) Induce rooting in the rooting medium.

[0030] An expression vector for improving peanut regeneration efficiency comprises the AhGRF5-AhGIF2 and AhrGRF5-AhGIF2 chimeric genes, the chimeric genes being expressed by an XVE promoter.

[0031] The present invention has the following advantages over the prior art:

[0032] 1. This invention found that overexpression of the AhGRF5-AhGIF2 and AhGRF5-AhGIF2 chimeric genes significantly improved the somatic embryo induction rate, shoot induction rate, and genetic transformation efficiency of peanuts. In the somatic embryo induction experiment, the explant induction rate of the chimeric gene treatment group was close to 100%, the average number of somatic embryos reached 7.4 per explant, and the transgenic positivity rate increased to 84.85%. In the mesocotyl shoot induction experiment, overexpression of the chimeric gene significantly improved the mesocotyl shoot induction efficiency, and the transgenic resistant shoot screening rate reached a maximum of 72.21%.

[0033] 2. This invention provides a method for improving peanut tissue regeneration efficiency and genetic transformation success rate using GRF-GIF chimeric genes. This method involves constructing AhGRF5-AhGIF2 and AhrGRF5-AhGIF2 chimeric gene expression vectors, transforming peanut explants, and then obtaining transgenic plants via somatic embryo regeneration or direct organ regeneration. This invention overcomes the technical bottlenecks in peanut genetic transformation, such as low regeneration efficiency, low transformation success rate, and strong genotype dependence. The somatic embryo induction rate can reach 100%, and the transformation efficiency is increased to 84.85%, providing a highly efficient technical platform for peanut gene function research and molecular breeding. Attached Figure Description

[0034] Figure 1 This is a diagram showing AhGRF phylogenetic analysis and protein sequence alignment.

[0035] Figure 2 This is a phylogenetic analysis and protein sequence alignment diagram of AhGIF;

[0036] Figure 3 A diagram illustrating the gene expression patterns of AhGRFs;

[0037] Figure 4 A diagram illustrating the AhGIFs gene expression pattern;

[0038] Figure 5 This is a schematic diagram illustrating the construction of the chimeric gene vector of the present invention;

[0039] Figure 6 This is a diagram showing the results of somatic embryo induction in this invention;

[0040] Figure 7 This is a statistical chart showing the detection of GFP fluorescence in somatic embryos and the positive rate of transgenes in this invention;

[0041] Figure 8 This is a statistical chart showing the induction efficiency of hypocotyl buds and the screening of resistant buds in this invention. AC represents "Yueyou 901" and DF represents "Hanghua 2".

[0042] Figure 9 The expression of GFP fluorescent protein in the positive buds of the "Yueyou 901" peanut transgenic variety. Detailed Implementation

[0043] To further explain the present invention, the following specific embodiments are described.

[0044] Example 1

[0045] Construction of chimeric gene vectors

[0046] 1.1 Extraction of total RNA from peanuts and synthesis of cDNA first strand

[0047] Fresh peanut leaves, stems, and seeds were collected and quickly placed in liquid nitrogen. A plant tissue homogenizer was used to thoroughly grind the materials into powder. Total RNA was extracted according to the instructions of the RNAsimple Total RNA Extraction Kit, followed by agarose gel electrophoresis and concentration detection. Based on the determined RNA concentration in different tissues, appropriate amounts of RNA were taken for reverse transcription experiments according to the instructions of the reverse transcription kit.

[0048] 1.2 Gene amplification and vector construction

[0049] CDS sequences of peanut AhGRF5 (Loc_112801311) and AhGIF2 (Loc_112695408) were obtained from the NCBI database, and primers were designed for gene fragment amplification. Using peanut seed cDNA as a template, the gene fragment was amplified using the high-fidelity enzyme KOD FXneo. The reaction program was 94℃ pre-denaturation for 2 min, followed by 98℃ denaturation for 10 s and 68℃ extension for 1 min, repeated 40 times. The results were then detected by agarose gel electrophoresis. The target band was excised using a blue light scanning gel analyzer for gel recovery and purification, and sent to the company for sequencing. If the alignment results were correct, the concentration was determined and the sample was stored at -20℃ for later use. The overexpression vector pBWA(V)BVE was digested with restriction endonucleases BasI / Eco31I according to the manufacturer's instructions. Then, the digested vector and the target gene fragment were recombined using 2×EasyClone Mix and transformed into *E. coli* DH5α. Positive clones were selected for sequencing, and successful construction was confirmed after sequencing results were verified. The constructed overexpression vector was transformed into *Agrobacterium* GV3101 and colony PCR was performed for verification. After successful verification, the bacterial culture was mixed with 50% glycerol at a 1:1 ratio and stored at -80℃ for later use.

[0050] Table 1 shows the primer design.

[0051]

[0052] 1.3 Phylogenetic analysis and protein sequence alignment of AhGRF and AhGIF

[0053] Figure 1 - Figure 2GRF and GIF protein sequences from wheat (Triticum aestivum L.), rice (Oryza sativa L.), Arabidopsis thaliana L., and soybean (Glycine max L.) were downloaded from the NCBI website. BLAST analysis identified 20 GRF homologous genes and 7 GIF homologous genes in the peanut Tifrunner genome. Subsequent phylogenetic tree construction using MEGA 11 revealed that AhGRF5 (AH05G15010) and AhGRF14 (AH15G07920) showed the highest homology with TaGRF4 (TraesCS6A01G269600), while AhGIF2 (AH06G08490) and AhGIF6 (AH16G11960) showed the highest homology with TaGIF1 (TraesCS4A01G250600). Sequence alignment analysis of protein sequences from GRF and GIF homologs in other species revealed that the protein sequences encoded by AhGRF5 and AhGRF14 are completely identical, and they also show high similarity (52%) to the TaGRF4 sequence. Both contain QLQ and WRC domains, suggesting that AhGRF5 and AhGRF14 may perform similar functions to TaGRF4, acting as regulators of stem cell activity and organ regeneration in peanuts. AhGIF2 and AhGIF6 sequences are identical, showing high similarity to TaGIF1 and GmGIF1 (59.83% and 63%, respectively), and both contain the SSXT domain, suggesting that AhGIF2 and AhGIF6 perform similar functions to TaGIF1 and GmGIF1.

[0054] 1.4 Expression profiling of AhGRFs and AhGIFs genes

[0055] Figure 3 - Figure 4The expression profiles of AhGRFs and AhGIFs genes were analyzed using an online database (http: / / peanutgr.fafu.edu.cn / Transcriptome.php). The results showed that AhGRFs were primarily expressed at high levels in seed embryos, leaves, roots, and shoot tips, with AhGRF4 and AhGRF13 showing the highest expression in seed embryos. AhGRF5 and AhGRF14, which are closest homologs to TaGRF4, were also expressed in seed embryos, leaves, and shoot tips, with little difference in expression levels. AhGIF1 and AhGIF5 showed the highest expression in seed embryos. AhGIF2 and AhGIF6, as homologs of TaGIF1, were highly expressed in peanut seed embryos, shoot tips, and cotyledons, while AhGIF3, AhGIF4, and AhGIF7 showed weak expression in all tissues. To further investigate the expression patterns of AhGRF5 and AhGIF2 in different tissues of peanut, real-time quantitative PCR was used to detect the expression of AhGRF5 in 11 different parts of peanut, including closed leaves, young leaves, mature leaves, stems, taproots, and flowers. The results showed that AhGRF5 was expressed at relatively high levels in seeds and somatic embryos, while AhGIF2 was expressed at higher levels in somatic embryos and at the highest level in seeds.

[0056] Example 2

[0057] Genetic transformation of peanuts

[0058] 2.1 Preparation of culture medium

[0059] 2.1.1 Pre-culture medium (EM):

[0060] (1) For somatic embryo regeneration: 4.33g MS plant salt mixture (without vitamins), 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust the pH to 5.6-5.8, add 3g Gellan gum, make up to 1L, then put it in an autoclave, sterilize at 121℃ for 30min, when the temperature drops to about 50℃, add 0.1% PPM in a laminar flow hood, then turn it over and store it in a refrigerator at 4℃ for later use.

[0061] (2) For direct organogenesis pathway: 4.33g of Ms plant salt mixture (without vitamins), 1mL of 1000×B5 vitamin solution, 30g of sucrose, add 900mL of ddH2O, adjust the pH to 5.6-5.8, add 3g of Gellan gum, bring the volume to 1L, and then put it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 0.1% PPM, 100mg / L Tim and 3mg / L 6-BA in a clean bench, then turn it over and store it in a refrigerator at 4℃ for later use.

[0062] 2.1.2 Liquid Co-culture Medium (LCCM):

[0063] (1) For somatic embryo regeneration pathway: 2.165g MS plant salt mixture (without vitamins), 500μL 1000×B5 vitamin solution, 15g sucrose, add ddH2O to make up to 500mL, adjust the pH to 5.6-5.8, then put it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 100μmol / L AS and 1mmol / L DTT in a clean bench and store at 4℃ for later use.

[0064] (2) For direct organogenesis pathway: 2.165g of Ms plant salt mixture (without vitamins), 500μL of 1000×B5 vitamin solution, 15g of sucrose, add ddH2O to make up to 500mL, adjust the pH to 5.6-5.8, make up to 500mL, then put it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / L 6-BA and 100mMAs in a clean bench and store in a refrigerator at 4℃ for later use.

[0065] 2.1.3 Co-culture medium (CCM):

[0066] (1) For somatic embryo regeneration pathway: 4.33g MS plant salt mixture (without vitamins), 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust the pH to 5.6-5.8, add 3g Gellan gum, make up to 1L, then put it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / LPIC, 100μmol / L AS and 1mmol / L DTT in a clean bench, then unplate and store at 4℃ for later use.

[0067] (2) For direct organogenesis pathway: 4.33g of Ms plant salt mixture (without vitamins), 1mL of 1000×B5 vitamin solution, 30g of sucrose, add 900mL of ddH2O, adjust the pH to 5.6-5.8, add 3g of Gellan gum, bring the volume to 1L, then place it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / L of 6-BA and 100mMAs in a clean bench, then unplate and store at 4℃ for later use.

[0068] 2.1.4 Somatic Embryo Induction Medium (SEIM):

[0069] MS plant salt mixture (vitamin-free) 4.33g, 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust pH to 5.6-5.8, add 3g Gellan gum, bring volume to 1L, then place in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / L PIC, 2mg / L Gln (glutamine), 2mg / L AgNO3, 100mg / L Tim and 200mg / L Cef in a clean bench, then plate and store at 4℃ for later use.

[0070] 2.1.5. Somatic Embryo Regeneration Medium (SERM):

[0071] MS plant salt mixture (vitamin-free) 4.33g, 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust the pH to 5.6-5.8, add 3g Gellan gum, and bring the volume to 1L. Then place it in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / L 6-BA, 0.5mg / L NAA, 100mg / L Tim and 200mg / L Cef in a clean bench. Then unplate and store at 4℃ for later use.

[0072] 2.1.6 Rooting medium (RM):

[0073] MS plant salt mixture (vitamin-free) 2.165g, 1000× B5 vitamin solution 500μL, sucrose 15g, add 400mL ddH2O, adjust pH to 5.6-5.8, add 1.5g Gellan gum, bring volume to 500mL, then place in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 0.8mg / L NAA, 100mg / L Tim and 200mg / L Cef in a clean bench, then unplate and store at 4℃ for later use.

[0074] 2.1.7 Shoot Induction Medium (SIM):

[0075] MS plant salt mixture (vitamin-free) 4.33g, 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust pH to 5.6-5.8, add 3g Gellan gum, bring volume to 1L, then place in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 3mg / L 6-BA, 100mg / L Tim and 200mg / L Cef in a clean bench, then unplate and store at 4℃ for later use.

[0076] 2.1.8 Elongation Medium (ECM):

[0077] MS plant salt mixture (vitamin-free) 4.33g, 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust pH to 5.6-5.8, add 3g Gellan gum, bring volume to 1L, then place in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 0.5mg / L 6-BA, 0.1mg / L IBA, 0.5mg / L GA3, 100mg / L Tim and 200mg / L Cef in a clean bench, then plate and store at 4℃ for later use.

[0078] 2.1.9 Screening medium (SM):

[0079] MS plant salt mixture (vitamin-free) 4.33g, 1mL 1000×B5 vitamin solution, 30g sucrose, add 900mL ddH2O, adjust pH to 5.6-5.8, add 3g Gellan gum, bring volume to 1L, then place in an autoclave and sterilize at 121℃ for 30min. When the temperature drops to about 50℃, add 0.5mg / L 6-BA, 0.1mg / L IBA, 0.5mg / L GA3, 3mg / L Basta, 100mg / L Tim and 200mg / L Cef in a clean bench, then plate and store at 4℃ for later use.

[0080] 2.2 Genetic transformation via somatic embryo regeneration pathway

[0081] (1) Preparation of experimental materials: Take mature seeds of "Yueyou 901", disinfect them, take the embryonic leaflets of the seeds, and pre-culture them on EM medium for 0.5-1 day.

[0082] (2) Activation of bacterial strain: Take out the Agrobacterium tumefaciens culture of the constructed vector from -80℃ and add it to LB liquid medium containing Kan and Rif antibiotics. Incubate at 28℃ and 200rpm for 24-48h until the OD600 of the bacterial culture reaches 0.6-0.8.

[0083] (3) Agrobacterium infection: After centrifuging the bacterial culture, add 15 mL of LCCM and mix well to resuspend the bacteria. Then add the embryo leaflets, sonicate for 1 min, and place on a shaker for 30 min. Discard the infection solution, spread the embryo leaflets flat on sterile filter paper to air dry, and then place them on CCM medium and incubate in the dark at 25℃ for 2 days.

[0084] (4) Subculture and regeneration: After co-culturing for 2 days, the embryonic leaflets were transferred to SEIM medium and cultured in the dark at 25°C. The medium was changed to a new SEIM medium every half month. The induced somatic embryos were subcultured for 4 months and then transferred to SERM medium. The embryos were cultured in alternating light and dark (16h / 8h) for 2-3 months to induce buds. After buds were induced, they were transferred to SM medium for screening.

[0085] (5) Data statistics: The number of somatic embryos was counted one month after being transferred to SEIM medium, and the induction rate of callus was observed. The number of buds induced and the screening rate were also counted.

[0086] 2.3 Genetic transformation through the direct organ regeneration pathway

[0087] (1) Preparation of experimental materials: Take mature seeds of “Yueyou 901” and “Hanghua No. 2”, disinfect them, take the middle segment of the embryo of the seeds, and pre-culture them on EM medium for 0.5-1 day.

[0088] (2) Strain activation: The strain activation steps are the same as those in the somatic embryo regeneration pathway.

[0089] (3) Agrobacterium infection: the Agrobacterium infection step in the same somatic embryo regeneration pathway.

[0090] (4) Bud induction and elongation: After co-culturing for 2 days, the mid-embryo segment was transferred to SIM medium and cultured in the dark at 25°C for about one week. Then, it was transferred to light and dark (16h / 8h) alternating culture for about half a month to induce buds. After bud induction, it was transferred to ECM medium for elongation, and then transferred to SM medium for selection. After two months of selection, it was transferred to RM medium for rooting.

[0091] (5) Data statistics: The germination rate was statistically analyzed half a month after being transferred to SIM medium, and then the screening rate was statistically analyzed.

[0092] Example 3

[0093] Effect verification

[0094] 3.1 Verification of the transformation effect of somatic cell embryo regeneration pathway

[0095] (1) Somatic embryo induction efficiency: After 30 days of somatic embryo induction culture, stereomicroscopic observation showed that the induction rate of somatic embryos in the AhGRF5-AhGIF2 and AhGRF5-AhGIF2 chimeric gene treatment groups was close to 100%. This indicates that overexpression of the AhGRF5-AhGIF2 and AhGRF5-AhGIF2 chimeric genes can improve the induction efficiency of peanut somatic embryos to a certain extent. Figure 6 ).

[0096] (2) Average number of somatic embryos: Statistical results showed that, compared with the control group, the average somatic embryo yield of explants treated with AhGRF5-AhGIF2 and AhGRF5-AhGIF2 was significantly increased (p<0.0001), reaching 7.4 per explant. This further confirms the promoting effect of chimeric genes on somatic embryogenesis.

[0097] (3) Somatic embryo morphology: The induced somatic embryos mainly exhibited typical torpedo-shaped and spherical morphological characteristics, which were consistent with the morphology of normally developing somatic embryos, indicating that the expression of chimeric genes did not have an adverse effect on the morphology of somatic embryos.

[0098] (4) Transgenic positivity rate: The induced somatic embryos were transferred to selection medium supplemented with Basta for selection culture. GFP fluorescence signal was observed at an excitation wavelength of 488 nm, and the transgenic positivity rate was calculated. The results showed that the transgenic positivity rate of the AhGRF5-AhGIF2 overexpression group supplemented with β-estradiol reached 84.85%, significantly higher than that of the control group without β-estradiol (p<0.05). This indicates that the expression of the AhGRF5-AhGIF2 chimeric protein can significantly improve the genetic transformation efficiency of peanut somatic embryos. Figure 7 ).

[0099] 3.2 Verification of the conversion effect of the direct mesocotyl regeneration pathway

[0100] 3.2.1 Bud induction rate and number of buds per explant

[0101] After culturing in SIM medium supplemented with 3.0 mg / L 6-BA for 28 days, the budding of the embryonic midsection was observed. The results showed significant differences in mesocotyl regeneration ability among different peanut genotypes. Among them, 'Hanghua 2' exhibited superior bud regeneration potential, inducing 3.47–5.52 clustered buds per mesocotyl, while 'Yueyou 901' induced only 1.28–3.37 clustered buds per explant. Figure 8 In the genetic transformation experiments of two peanut varieties, “Yueyou 901” and “Hanghua 2”, due to the large scale of the experiments, the transformation experiments of AhGRF5-AhGIF2 and AhrGRF5-AhGIF2 were completed independently in two separate experiments. Notably, there was a significant difference in shoot induction efficiency between the two control groups (without β-estradiol) (p<0.05). This batch effect prevented accurate assessment of the impact of site-directed mutations at the miR396 binding site on transformation efficiency. Nevertheless, independent analysis based on existing data showed that overexpression of both the AhGRF5-AhGIF2 and AhrGRF5-AhGIF2 chimeric genes significantly improved the shoot induction efficiency of the mesocotyl compared to their respective control groups (p<0.05). Figure 8 B, Figure 8 E). This result preliminarily confirms that the GRF-GIF growth regulator has a positive regulatory effect on shoot induction during direct organ regeneration in peanuts.

[0102] 3.2.2 Screening rate of transgenic resistant buds

[0103] The induced shoot clusters were transferred to a Basta-supplemented elongation medium for selection culture. After 60 days of selection culture, the seedling survival rate was counted and the selection rate of resistant shoots was calculated. The results showed that in the two peanut varieties "Yueyou 901" and "Hanghua 2", the selection rate of transgenic resistant shoots of AhGRF5-AhGIF2 was slightly higher than that of the control group, while the selection rate of transgenic resistant shoots of AhrGRF5-AhGIF2 was more than 20% higher than that of the control group. In the "Yueyou 901" peanut variety, the total number of resistant shoots obtained after screening in the AhrGRF5-AhGIF2 overexpression experimental group was significantly higher than that in the AhGRF5-AhGIF2 experimental group, about 3.15 times that of the latter. In the "Hanghua 2" peanut variety, the total number of resistant shoots obtained after screening in the AhrGRF5-AhGIF2 overexpression experimental group was about 4.88 times that of the AhGRF5-AhGIF2 experimental group. Further analysis revealed that the resistant bud screening rate in the "Hanghua 2" peanut variety with AhrGRF5-AhGIF2 overexpression treatment was significantly higher than that in the "Yueyou 901" peanut variety (p<0.05). Among them, the AhrGRF5-AhGIF2 chimeric gene treatment group induced by β-estradiol showed the highest screening efficiency, reaching 60.89% and 72.21% in the two varieties, respectively (Tables 2 and 3).

[0104] Table 2. Screening results of resistant buds for "Yueyou 901"

[0105]

[0106] Table 3. Screening of resistant buds for "Hanghua No. 2"

[0107]

[0108] 3.3.3 Expression of GFP fluorescent protein in transgenic positive buds

[0109] The resistant seedlings obtained through screening were placed in a dark room and GFP fluorescence was detected using 488nm excitation light. Figure 9 The results showed that most positive plants exhibited chimeric characteristics, and their GFP fluorescence signals showed obvious regional distribution in tissues such as hypocotyl, stem segments, and leaves.

[0110] In summary, through the effect verification of Case 3, the overexpression of AhGRF5-AhGIF2 and AhGRF5-AhGIF2 chimeric genes can significantly improve the somatic embryo induction rate, mesocotyl shoot induction rate and genetic transformation efficiency of peanut, providing an efficient technical means for the genetic transformation and molecular breeding of peanut.

[0111] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method of... GRF-GIF A method for improving peanut plant regeneration and genetic transformation efficiency using chimeric genes, characterized by... Includes the following steps: (1) Cloning AhGRF5 and AhGIF2 CDS sequence of the gene; The AhGRF5 The CDS sequence of the gene is shown in SEQ ID NO.

1. AhGIF2 The CDS sequence of the gene is shown in SEQ ID NO.2; The site-directed mutagenesis primers miR396Fr and miR396Rr shown in SEQ ID NO.1 were used. AhGRF5 of miR396 Base substitutions were performed at the target site to obtain a mutant carrying the mutated sequence ACAGGTGGTCAGACCGATTGCG. AhrGRF5 ; The miR396Fr: CGCAATCGGTCTGACCACCTGTTTGCGGCCACGGTGCAT; miR396Rr:ACAGGTGGTCAGACCGATTGCGTCACAATCTATGACACAGTCATCAT; (2) Constructing a system containing AhrGRF5-AhGIF2 Expression vectors for chimeric genes; The AhrGRF5 for AhGRF5 mutants, AhGRF5 of miR396 The target site was mutated, and the mutated sequence is ACAGGTGGTCAGACCGATTGCG; In the chimeric gene, AhrGRF5 and AhGIF2 They are connected by 4×Ala flexible linker peptides; The chimeric gene is induced by β-estradiol. XVE Promoter-driven expression; (3) Transform the expression vector into peanut explants; The explant is an embryonic leaflet or a mesocotyl; (4) Culture the transformed explants and induce tissue regeneration; The culture is performed using either a somatic cell embryo regeneration pathway or a direct organ regeneration pathway. (5) Screening to obtain transgenic plants.

2. The method according to claim 1 GRF-GIF A method for improving peanut plant regeneration and genetic transformation efficiency using chimeric genes, characterized by... The somatic embryo regeneration pathway includes the following steps: 1) The transformed embryonic leaflets were cultured in somatic embryo induction medium; 2) The induced somatic embryos were cultured in somatic embryo regeneration medium to produce buds; 3) Select the buds for resistance in the selection medium.

3. The method according to claim 1 GRF-GIF A method for improving peanut plant regeneration and genetic transformation efficiency using chimeric genes, characterized by... The direct organ regeneration pathway includes the following steps: 1) The transformed mesocotyl was cultured in a bud induction medium to produce buds; 2) Elongate the buds in an elongation medium; 3) Resistance screening is performed in the screening medium; 4) Induce rooting in the rooting medium.

Images