A molecular marker combination for sex identification of the black-spotted catfish and its application
By screening and validating sex-specific molecular markers of the black-spotted catfish, early sex identification and asexual breeding of the black-spotted catfish have been achieved, solving the problem of unclear sex determination mechanism and promoting its fully artificial breeding and conservation aquaculture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF FISHERIES SCIENCES ACADEMY OF AGRICULTURAL & ANIMAL HUSBANDRY SCIENCES OF TIBET AUTONOMOUS REGION
- Filing Date
- 2025-07-25
- Publication Date
- 2026-07-17
AI Technical Summary
In the existing technology, the sex determination mechanism of the black-spotted catfish is not clear, which makes it difficult to achieve early sex identification and asexual breeding, thus affecting its breeding efficiency and germplasm resource optimization.
Through high-throughput sequencing and bioinformatics analysis, 53 SNP/INDEL loci closely linked to sex were screened out, and a sex-specific molecular marker combination for the black-spotted catfish was developed. Using multiplex PCR technology and magnetic bead purification steps, early sex identification of male and female individuals was achieved.
The successful identification of the XX/XY sex determination system of the black-spotted catfish provides technical support for early sex identification and asexual breeding, and promotes the fully artificial breeding and conservation aquaculture of the black-spotted catfish.
Smart Images

Figure CN120866504B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquatic organism technology, specifically fish genetic sex identification technology, and relates to a molecular marker combination for sex identification of the black-spotted catfish. Background Technology
[0002] The black-spotted catfish (Glyptosternum maculatum) is a unique cold-water economic fish species, mainly distributed in the middle and upper reaches of the Yarlung Tsangpo River and its tributaries, adapted to the extreme environment of high altitudes. Genomic studies have revealed that it enhances its hypoxia tolerance and metabolic regulation capabilities through gene mutations, demonstrating an adaptation mechanism to high-altitude environments. Furthermore, the gut microbiota of the black-spotted catfish also shows adaptation to the plateau environment; for example, copper-containing bacteria help it maintain normal physiological functions in high-altitude environments. Due to its delicious meat and high nutritional value, the black-spotted catfish is listed as one of China's top ten excellent aquatic germplasm resources. However, its survival is threatened by habitat degradation and human activities. The black-spotted catfish is listed as a national second-class protected animal, but its population is still threatened by habitat degradation. Genomic and molecular marker studies indicate low genetic diversity, particularly in the Lhasa River and Nyang River populations.
[0003] Research on the sex determination mechanism in fish is of great value to aquaculture. The main sex determination systems in fish include two sex chromosome systems: XX / XY and ZZ / ZW. In the channel catfish (Ictalurus punctatus), sex determination is associated with a male-specific SNP in the zbtb38 gene. In the swimming crab (Portunus trituberculatus), two sex-linked SNPs were identified through simplified genome sequencing, and a PCR identification method was developed. Currently, the sex determination mechanism in scad remains unknown. The black-spotted catfish exhibits significant sexual dimorphism, and in artificial breeding, sex-specific growth differences are important factors affecting germplasm resource optimization and improved aquaculture efficiency. Studies show that sexually mature male black-spotted catfish are significantly larger than females in total length, weight, body width, and body length. During the breeding season, females show a consistent rate of development in body length and weight, while males show inconsistent development rates. Among scad, males and females typically exhibit significant differences in body size, with males potentially being larger or smaller than females. This difference may be related to reproductive strategies and sexual selection. However, early sexing of juvenile black-spotted scad is difficult based on morphology alone. Therefore, achieving early sexing of juvenile black-spotted scad provides technical support for parthenogenesis breeding and is of great significance for the fully artificial breeding of this species. Summary of the Invention
[0004] To fill the gap in the sex determination mechanism of croaker fish, this invention provides a molecular marker combination for sex identification of black-spotted croaker, which is beneficial to promoting the asexual culture of black-spotted croaker and accelerating the breeding process.
[0005] The technical solution adopted in this invention is:
[0006] A molecular marker combination for sex identification of the black-spotted catfish, the molecular marker combination comprising at least one of the following molecular markers:
[0007]
[0008] The molecular marker combination of the present invention includes the molecular marker LG01_27671222.
[0009] The application of the molecular marker combination described in this invention in identifying the sex of the black-spotted catfish.
[0010] Preferably, the method for determining the sex of the black-spotted catfish includes the following steps:
[0011] A. Extract genomic DNA from the black-spotted catfish to be tested;
[0012] B. Multiplex PCR amplification was performed using 53 molecular markers as a template and the extracted genomic DNA as a template.
[0013] C. Sequencing the PCR products to determine the sample genotype and sex: if the base at the locus is heterozygous, the sample is male; if it is homozygous, the sample is female.
[0014] More preferably, the forward and reverse primer pairs corresponding to the sequences SEQ ID NO:1-53 are SEQ ID NO:54-159 respectively; an upstream universal sequence ACACGACGCTCTTCCGATCT is added to the 5' end of each upstream primer, and a downstream universal sequence CTTGGCACCCGAGAATTCCA is added to the 5' end of each downstream primer.
[0015] More preferably, the extracted genomic DNA is subjected to a first round of multiplex PCR using the aforementioned forward and reverse primer pairs; the product of the first round of multiplex PCR is then purified using magnetic beads, and the purified product is used as a template for a second round of PCR using Illumina universal primer pairs; the product of the second round of PCR is then purified using magnetic beads to obtain a mixture of sequencing fragments of 53 molecular markers, and this mixture is used as a sample to construct a sequencing library and perform sequencing analysis.
[0016] Given that multiplex PCR is more likely to produce nonspecific products and impurities, the addition of magnetic beads for purification can remove unused primers, dNTPs, impurities and byproducts, increase the concentration of the target fragment, protect sensitive components in downstream experiments, reduce background noise, and improve DNA purity.
[0017] The beneficial effects of this invention are as follows:
[0018] 1. This invention, through genome resequencing data of *Protoplasma molluscica*, screened 53 SNP / INDEL loci closely linked to sex, identifying for the first time an XX / XY sex determination system in *Protoplasma molluscica*, filling a gap in the understanding of sex determination mechanisms in mollusc fish. Furthermore, using sex-linked molecular marker amplicon capture sequencing technology for *Protoplasma molluscica*, sex-specific SNP / INDEL molecular markers were developed, providing technical support for early sex identification of juvenile fish and asexual breeding, and promoting the fully artificial breeding and conservation aquaculture of *Protoplasma molluscica*.
[0019] 2. Employing multiplex PCR technology, 53 pairs of primers are added to a single reaction system to simultaneously amplify 53 nucleic acid fragments. This enables the identification of test samples at a lower cost, with higher detection efficiency, sensitivity, and specificity. The multiplex PCR reaction utilizes two rounds of magnetic bead purification steps, resulting in high DNA purity. Attached Figure Description
[0020] Figure 1 The density distribution of SNPs (A) and Indels (B) on each chromosome of the black-spotted protozoan.
[0021] Figure 2 The relationship between principal component analysis results and SNP-based ML phylogenetic trees. A: PCA scatter plot based on screened SNPs; B: PCA scatter plot of gene-screened indels; C: ML tree based on SNP data from male and female populations. Note: Yellow indicates the male population, and blue indicates the female population.
[0022] Figure 3 For the identification and localization of sex-linked variants. A: Fst values of male and female populations in ChrLG01; B: Fst values of mixed male and female populations in the approximately 27Mb-28Mb range of ChrLG01; C: SNP distribution analysis; D: PSASS results diagram.
[0023] Figure 4 The number of SNPs and Indels on chromosome LG01 for male and female fish.
[0024] Figure 5 This is a flowchart of amplicon targeted sequencing.
[0025] Figure 6The model consists of 53 SNP / Indel genotypes. Detailed Implementation
[0026] To more clearly and in detail illustrate the objective and technical solution of this invention, the invention will be further described below through relevant embodiments. These embodiments are merely illustrative of the implementation methods of this invention and do not limit the scope of protection of this invention.
[0027] This invention primarily relies on high-throughput sequencing technology and bioinformatics analysis to identify genomic differences between male and female *Procambarus molluscica*. The *Procambarus molluscica* samples used in the experiment were collected from the Yarlung Tsangpo River Fishery Resource Breeding Base, consisting of 46 females and 49 males. After anesthesia with ethyl m-aminobenzoate methanesulfonate (MS-222), gonadal anatomy confirmed individual phenotypic sex. Muscle tissue was collected, preserved in anhydrous ethanol, and stored at -80°C for later use in genomic DNA extraction.
[0028] 100 mg of tissue sample was placed in a mortar filled with liquid nitrogen and thoroughly ground into powder. Genomic DNA was extracted using the CTAB method. The extracted DNA was analyzed for fragment integrity by agarose gel electrophoresis, and DNA purity was determined using a NanoDrop spectrophotometer. 100 ng each of DNA from 20 female individuals (C1-C20), 20 male individuals (X1-X20), and a mixed sample (CH) of 100 ng each from individuals C1-C20, and a mixed sample (XH) of 100 ng each from individuals X1-X20 were used for resequencing. DNA from the remaining 26 female and 29 male samples was used for multiplex PCR targeted capture sequencing.
[0029] Genome resequencing and variant detection
[0030] Qualified DNA samples were used to construct genomic DNA libraries, and then the standard operating procedures of the Illumina NovaSEQ6000 sequencing platform were followed. After sonication of gDNA using Bioruptor Pic, fragments of 300-350 bp were selected using VAHTS DNA CleanBeads. Whole-genome sequencing libraries were constructed using the ND607 kit, including DNA end repair / phosphorylation, dA tail addition, adapter ligation, and two Beads purification processes. PCR amplification was followed by quantification using Qubit. The double-stranded library was then denatured and circularized, and DNA nanospheres (DNBs) were generated through rolling circle amplification. After passing quality control, DNB was loaded into a microarray chip, and sequencing was performed using combined probe anchoring (cPAS) technology. Through multiple rounds of probe anchoring, fluorescence signal acquisition, and base identification, the acquired raw data underwent quality control and filtering using FastP v023.4 software. Reads with a quality value Q ≤ 15 accounting for 40% of the total bases were removed; reads containing more than 5 Ns were removed; reads shorter than 15 bp were removed; and adapter sequences at both ends of the reads were removed to obtain clean data. BWA v0.7.17 was used to align the clean data to the genome of male *Procambarus mellea* individuals.
[0031] Whole-genome resequencing of male and female populations of *Protozoa spp.* yielded 74.876 Gb and 73.154 Gb of raw data for male and female populations, respectively, and 20.261 Gb and 18.904 Gb of raw data for mixed male and female samples, respectively (Table 1). After quality control filtering, clean data of 74.309 Gb and 72.658 Gb were obtained for male and female populations, respectively, and 20.133 Gb and 18.763 Gb of clean data were obtained for mixed male and female samples, respectively (Table 1). The Q30 ratio of clean data ranged from 93.46% to 95.04%, and the GC content ranged from 38.25% to 39.36%, with an average of 38.22%, indicating good sequencing quality (Table 1). The alignment rate of clean data to the reference genome using BWA was 99.05% to 99.73%, with the alignment rate after removing duplicate reads ranging from 97.23% to 98.48%. After alignment, the average coverage depth of the reference genome for male and female populations and the average coverage depth of the reference genome for mixed male and female samples were 3.02× to 5.45× and 23.98× to 25.83×, respectively (Table 1).
[0032]
[0033] Reads with duplication were filtered using GATK MarkDuplicates; SNPs and indels were detected using GATKHaplotypeCaller, and SNPs / indels were filtered using default parameters. A total of 1,914,203 SNPs and 814,577 indels were obtained from male and female black-spotted catfish. After rigorous filtering, 1,611,790 SNPs and 631,791 indels were ultimately retained. Figure 1 ).
[0034] Based on the filtered SNP and Indel data, principal component analysis (PCA) was performed using VCF2PCACluster v1.38. The results showed that no obvious genetic clustering was formed in the male and female populations of *Prorocentrum niger*. Figure 2 A, 2B). A maximum likelihood (ML) phylogenetic tree was constructed using IQ-TREE v2.25 and visualized using iTOL v6.8. The maximum likelihood (ML) phylogenetic tree also did not show male-female population differentiation. Figure 2 C). PCA can reveal information about population clusters and outliers.
[0035] Sex chromosome identification and candidate marker screening
[0036] Based on the filtered SNP data, high-quality SNPs were selected from samples C1-C20 and X1-X20 using vcftools software, and the Fst intervals of female and male fish were analyzed. The results showed that the Fst value of ChrLG01 was greater than 0.25 (…). Figure 3 A) indicates that the male and female populations have significant genetic differentiation on chromosome LG01.
[0037] Sex chromosome identification was performed on the BAM files of mixed male and female samples (CH, XH) using PSASS software. The Fst (FrLG01) in the approximately 27Mb-28Mb region was analyzed. Figure 3 B) SNP distribution analysis Figure 3 C) and PSASS result circle diagram ( Figure 3 D) shows that ChrLG01 is the candidate sex chromosome of the black-spotted catfish, and its sex-determining region is located at ChrLG01:2,700,000–2,800,000 bp.
[0038] Based on the SNP results obtained from GATK, SNPs with mutations occurring in more than 80% of male individuals and less than 20% of female individuals were identified as male-specific SNPs. Similarly, SNPs with mutations occurring in more than 80% of female individuals and less than 20% of male individuals were identified as female-specific SNPs. SNPs with mutations occurring in more than 80% of both groups were considered shared SNPs. Based on the above analysis, the sex chromosome localization and candidate regions for sex determination in *Procambarus mollusc* were determined. According to the SNP and Indel statistics obtained from GATK, the number of male-specific SNPs on ChrLG01 were 2 and 195, respectively, and the number of female-specific Indels were 1 and 20, respectively. Figure 4 ).
[0039] Multiplex PCR targeted capture sequencing to validate candidate markers
[0040] To further verify whether the LG01_27399813-28190114 (790301bp) region is associated with sex determination in *Prorocentrum leuciscus*, 47 male-specific SNPs and 6 indels were selected using amplicon targeted sequencing for multiplex PCR amplification. Primers used are shown in Table 2, and sequence information for 53 molecular markers is shown in Table 3. An upstream universal sequence (5'ACACGACGCTCTTCCGATCT3') was added to the 5' end of each upstream primer, and a downstream universal sequence (5'CTTGGCACCCGAGAATTCCA3') was added to the 5' end of each downstream primer. The upstream and downstream universal sequences are partial sequences from the 3' ends of the upstream and downstream adapter sequences on the Illumina sequencing platform. Amplicon libraries were subjected to next-generation sequencing and bioinformatics analysis. Genome-wide association analysis was performed between genotype and sex to determine the correlation between this region and sex in *Prorocentrum leuciscus*. The flowchart is shown below. Figure 5 .
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049] DNA samples from 26 female and 29 male fish were used for multiplex PCR targeted capture sequencing. The average sequencing depth of the samples was above 5000X, and all 53 molecular markers in each sample were sequenced with a sequencing depth of above 100X, indicating high sequencing quality for each molecular marker.
[0050] The genotypes of the 47 SNPs and 6 Indel markers obtained were statistically analyzed in association with the previous 29 male and 26 female fish. Figure 6 This indicates that the genotypes of these molecular markers are highly correlated with fish sex. Of the 29 male fish, 27 (93.1%) were heterozygous for the 53 markers mentioned above, 2 males were homozygous for 18 markers within the LG01_27399813-27649471 interval (249658 bp), and 35 markers within the LG01_27671222-28190114 interval (518892 bp) were heterozygous. Of the 26 female fish, 25 (96.2%) were homozygous for all 53 marker genotypes listed above. One female was homozygous for 19 markers within the LG01_27399813-27671222 interval (271409 bp) and heterozygous for 34 markers within the LG01_27743066-28190114 interval (447048 bp). Figure 6 Furthermore, all of these markers are located on chromosome LG01, and the genetic characteristics, genotype patterns, and sex determination system correspond to the XX / XY sex determination system.
[0051] This invention resequencing male and female *Procambarus molluscica* (black-spotted catfish) identified chromosome LG01 as the candidate sex chromosome. Its sex-determining region is located at ChrLG01: 2,700,000–2,800,000 bp. Two female-specific SNPs and one indel were identified on chromosome LG01, while 195 male-specific SNPs and 20 indels were identified. Multiplex PCR validation showed that 93.1% of male *Procambarus molluscica* had 53 markers that were heterozygous, indicating that males possess two different chromosomes, exhibiting XY-type heteromorphic gametes. One chromosome carries the male-determining factor (Y), while the other is of autosomal origin (X). These markers are located in or near Y-chromosome-specific regions, causing males to exhibit heterozygosity at these loci. 96.2% of females had 53 marker genotypes that were homozygous, indicating that females possess two identical chromosomes, exhibiting XX-type homomorphic gametes, both chromosomes originating from an autosomal ancestor. These markers are located on the X chromosome and are homozygous in females. LG01 contains 53 markers in a specific region known as the sex determination region (SDR), which differentiates on the Y chromosome, resulting in heterozygous males and homozygous females in this region. This supports a male-specific XX / XY sex determination system. This invention is the first to identify an XX / XY sex determination system in the black-spotted catfish, filling a gap in the sex determination mechanism of catfish.
[0052] This invention utilizes whole-genome resequencing of 20 male and 20 female *Procambarus molluscica* and one mixed-pond sample of male and female fish, validated using amplicon targeted sequencing technology. The results revealed that chromosome LG01 is a candidate sex chromosome for *Procambarus molluscica*. Figure 3 Of the 47 male-specific SNPs and 6 indels selected, 93.1% of the males were heterozygous for all 53 markers, and 6.9% of the males were homozygous for 18 markers within the LG01_27399813-27649471 interval, and 35 markers within the LG01_27671222-28190114 interval; 96.2% of the females were homozygous for all 53 markers, and 3.8% were heterozygous for... Nineteen markers in female fish within the LG01_27399813-27671222 range were homozygous, while 34 markers within the LG01_27743066-28190114 range were heterozygous. Further analysis of the genotypic characteristics of 53 molecular markers in 6.9% of males and 3.8% of females revealed a key sex-determining gene within the LG01_27649471-27743066 range (93595 bp), particularly near the 27671222 locus. Figure 6The genotype of LG01_27671222 (nucleotide sequence see SEQ ID NO.1) was 100% heterozygous (T / C) in the verified male fish and 100% homozygous (C / C) in the female fish, and can be used as the optimal molecular marker for sex identification of the black-spotted catfish.
[0053] In summary, the black-spotted catfish exhibits an XX / XY sex determination system, with the sex chromosome LG01 and the core sex-determining region located at 27.0–28.0 Mb. This invention successfully screened and validated 53 sex-specific SNP / Indel markers. Among them, the SNP molecular marker LG01_27671222 can serve as the optimal candidate site, providing technical support for asexual breeding. The developed molecular markers can promote the fully artificial breeding and conservation aquaculture of the black-spotted catfish.
[0054] Example 1
[0055] The method for sexing the black-spotted catfish described in this invention includes the following steps:
[0056] A. Extract genomic DNA from the black-spotted catfish to be tested;
[0057] B. Multiplex PCR amplification was performed using 53-site forward and reverse primer pairs with extracted genomic DNA as a template.
[0058] C. Sequencing the PCR products to determine the sample genotype and sex: if the base at the locus is heterozygous, the sample is male; if it is homozygous, the sample is female.
[0059] The forward and reverse primer sequence pairs for the 53 sites are shown in Table 2.
[0060] Example 2
[0061] The method for sexing the black-spotted catfish described in this invention includes the following steps:
[0062] A. Extract genomic DNA from the black-spotted catfish to be tested;
[0063] B. The extracted genomic DNA was subjected to a first round of multiplex PCR using the aforementioned forward and reverse primer pairs. The product of the first round of multiplex PCR was then purified using magnetic beads. The purified product was used as a template for the second round of PCR using Illumina universal primer pairs. The product of the second round of PCR was then purified using magnetic beads to obtain a mixture of sequencing fragments at 53 sites. This mixture was used as a sample to construct a sequencing library and to perform sequencing analysis.
[0064] C. When the base at the site is heterozygous, the sample is male; when it is homozygous, the sample is female.
[0065] Construction of amplicon libraries (sequencing libraries)
[0066] according to Figure 5 The experimental procedure involved constructing amplicon libraries from the gDNA of 55 fish.
[0067] 1. First round of multiplex PCR reaction
[0068] The reaction system is shown in Table 4: EM808 DNA polymerase premix was purchased from Aijitaikang Biotechnology (Beijing) Co., Ltd.; the template was gDNA extracted from fish blood samples at a concentration of 5 ng / μl; the reaction conditions are shown in Table 5.
[0069]
[0070]
[0071] 2. First round of magnetic bead purification
[0072] 1) Add 27 μl (0.9X) purified magnetic beads (purchased from Beijing Aijitaikang) to 30 μl of multiplex PCR product, mix well by pipetting 15 times, and incubate at room temperature for 4 min;
[0073] 2) Place the PCR tube on the magnetic rack and let it stand for 3 minutes until all the magnetic beads are adsorbed onto the PCR tube wall. Then, use a pipette to remove the supernatant.
[0074] 3) Add 180 μl of ethanol (80%) to the PCR reaction tube, let stand for 30 seconds, and then discard the supernatant with a pipette.
[0075] 4) Add 180 μl of ethanol (80%) to the PCR reaction tube, let stand for 30 seconds, and then discard the supernatant with a pipette.
[0076] 5) After standing for 5 minutes, add 26 μl of ddH2O to the PCR reaction tube, then mix the magnetic beads and ddH2O with a pipette, let stand at room temperature for 3 minutes, and then transfer to a magnetic rack.
[0077] 6) Let stand for 4 minutes until all the magnetic beads are adsorbed onto the PCR tube wall, then use a pipette to transfer 20 μl of supernatant to a new PCR reaction tube. The liquid in the tube is the pure multiplex PCR product.
[0078] 7) Second round of adapter PCR reaction
[0079] The reaction system is shown in Table 6: EM808 DNA polymerase premix was purchased from Aijitech Biotechnology (Beijing) Co., Ltd.; adapter sequence premix was purchased from Aijitech Biotechnology (Beijing) Co., Ltd. (Table 2). The reaction conditions are shown in Table 7.
[0080]
[0081]
[0082] 3. Second round of magnetic bead purification
[0083] 1) Add 27 μl (0.9X) purified magnetic beads (purchased from Beijing Aijitaikang) to 30 μl of adapter PCR reaction product, mix well by pipetting 15 times, and incubate at room temperature for 4 min;
[0084] 2) Place the PCR tube on the magnetic rack and let it stand for 4 minutes until all the magnetic beads are adsorbed onto the PCR tube wall. Then, use a pipette to remove the supernatant.
[0085] 3) Add 180 μl of ethanol (80%) to the PCR reaction tube, let stand for 30 seconds, and then discard the supernatant with a pipette.
[0086] 4) Add 180 μl of ethanol (80%) to the PCR reaction tube, let stand for 30 seconds, and then discard the supernatant with a pipette.
[0087] 5) After standing for 3 minutes, add 30 μl of ddH2O to the PCR reaction tube, then mix the magnetic beads and ddH2O with a pipette, let stand at room temperature for 3 minutes, and then transfer to a magnetic rack.
[0088] 6) Let stand for 3 minutes until all the magnetic beads are adsorbed onto the PCR tube wall, then use a pipette to transfer 24 μl of supernatant to a new PCR reaction tube. The liquid in the tube is a pure amplicon library.
[0089] 4. The concentration of the purified amplicon libraries was quantified using qubit 3.0. The concentration of all libraries was greater than 10 ng / μl, indicating that all amplicon libraries were qualified.
Claims
1. A molecular marker combination for sex identification of the black-spotted catfish, characterized in that, The molecular marker combination includes the following molecular markers: Wherein, "Sequence" is the nucleotide sequence of the molecular marker; "[]" marks the position of the molecular marker site, and the bases therein represent the polymorphism of that site.
2. The application of the molecular marker combination of claim 1 in identifying the sex of the black-spotted catfish.
3. The method for sex identification of the black-spotted catfish using the molecular marker combination of claim 1, characterized in that, Includes the following steps: A. Extract genomic DNA from the black-spotted catfish to be tested; B. Multiplex PCR amplification was performed using the extracted genomic DNA as a template, with the 53 molecular markers described as forward and reverse primer pairs. C. Sequencing the PCR products to determine the sample genotype and sex: if all polymorphic bases are heterozygous, the sample is male; if all polymorphic bases are homozygous, the sample is female.
4. The method for sex identification of the black-spotted catfish according to claim 3, characterized in that, The forward and reverse primer pairs corresponding to the sequences SEQ ID NO:1-53 are SEQ ID NO:54-159, respectively; an upstream universal sequence ACACGACGCTCTTCCGATCT is added to the 5' end of each upstream primer, and a downstream universal sequence CTTGGCACCCGAGAATTCCA is added to the 5' end of each downstream primer.
5. The method for sex identification of the black-spotted catfish according to claim 4, characterized in that, The extracted genomic DNA was subjected to a first round of multiplex PCR using the aforementioned forward and reverse primer pairs. The product of the first round of multiplex PCR was then purified using magnetic beads. The purified product was used as a template for a second round of PCR using Illumina universal primer pairs. The product of the second round of PCR was then purified using magnetic beads to obtain a mixture of sequencing fragments containing 53 molecular markers. This mixture was used as a sample to construct a sequencing library and to perform sequencing analysis.