Sample processing device and detection system

Abstract

This application provides a sample processing apparatus and a detection system. The sample processing apparatus includes a push rod, a cylinder, and a target substance enrichment layer. The push rod includes a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part. The inner wall of the cylinder is sealably fitted with the distal sealing part, and the inner wall of the cylinder and the push rod are movable relative to each other. One end of the cylinder has a push rod inlet, and the other end of the cylinder has a collection part outlet. A sealing layer is provided at the collection part outlet, and the sealing layer can be penetrated by the collection part. The target substance enrichment layer is located inside the cylinder and adjacent to the collection part outlet. The end of the collection part away from the proximal operating part has a peeling part, which can peel off the target substance enrichment layer and carry it out of the cylinder. Alternatively, the target substance enrichment layer is located on the side of the collection part away from the proximal operating part, and the target substance enrichment layer can be carried out of the cylinder by the collection part when it penetrates the sealing layer.

Description

Technical Field

[0001] This application relates to the fields of biological, medical, environmental, and food testing. Specifically, this application relates to sample processing devices and testing systems. Background Technology

[0002] Currently, in fields such as food safety testing, environmental analysis, and biological or medical research, the samples to be tested often have characteristics such as complex composition, low content of target substances, and many interfering factors. In order to achieve accurate and efficient detection of target substances, it is often necessary to perform corresponding pretreatment steps on the original samples, including one or more of the following: pretreatment, sample concentration (enrichment), and waste liquid collection and treatment.

[0003] Common sample pretreatment methods include liquid-liquid extraction (LLE), solid-phase extraction (SPE), membrane enrichment techniques, and magnetic bead separation. These techniques can achieve the separation and enrichment of target substances to a certain extent. However, the operation steps of existing devices and methods are usually cumbersome, involving multiple sample or device transfers. To reduce manual operation and simplify the multi-step, multi-component sample purification and enrichment functions involving liquid and solid phase transfers, existing technologies often require external mechanical devices or benchtop instruments, which are not only expensive but also have requirements on the operating environment. Therefore, it is essential to develop a sample pretreatment device that is simple to operate and can overcome the shortcomings of traditional sample pretreatment techniques, such as complex processes and low sample utilization efficiency. Summary of the Invention

[0004] In a first aspect of this application, a sample processing apparatus is provided, comprising:

[0005] A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part;

[0006] A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and

[0007] A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling section at one end away from the proximal operating section. The peeling section is configured to peel off the target substance enrichment layer and carry it out of the cylinder when the collection section penetrates the sealing layer by pushing the push rod. Alternatively, the target substance enrichment layer is disposed on the side of the collection section away from the proximal operating section, and is configured to be carried out of the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod.

[0008] The sample processing device of this application may have one or more of the following technical effects: it can be used for sample processing or pre-processing steps to facilitate subsequent operations or detection requirements; it can be used to enrich the analyte in a large volume of sample liquid, or to enrich the components of a large volume of sample liquid from which the analyte can be obtained, so as to improve the sensitivity of subsequent operations or detection; it can simultaneously perform sample (pre)processing and enrichment of the target substance.

[0009] In a second aspect of this application, a detection system is provided, including the sample processing device provided in the first aspect of this application. This provides one or more advantages, such as improved detection efficiency, detection sensitivity, detection accuracy, and reliability of detection results.

[0010] As a non-limiting example, this application provides the following implementation scheme:

[0011] 1. A sample processing apparatus, comprising:

[0012] A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part;

[0013] A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and

[0014] A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling section at one end away from the proximal operating section. The peeling section is configured to peel off the target substance enrichment layer and carry it out of the cylinder when the collection section penetrates the sealing layer by pushing the push rod. Alternatively, the target substance enrichment layer is disposed on the side of the collection section away from the proximal operating section, and is configured to be carried out of the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod.

[0015] 2. The sample processing apparatus as described in embodiment 1, wherein the distance between the outer peripheral wall of the collection section and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing section and the axis of the push rod; and / or,

[0016] The sealing layer is a waterproof layer or a first waterproof and breathable layer; and / or,

[0017] The push rod is also provided with a breakable part, which is located between the collection part and the remote sealing part.

[0018] 3. The sample processing apparatus as described in embodiment 1 or 2, wherein the push rod further comprises a breakable portion, and the distance between the outer peripheral wall of the breakable portion and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the collection portion and the axis of the push rod; and / or,

[0019] The breakable portion includes a first fracture.

[0020] 4. The sample processing apparatus as described in embodiment 2 or 3, wherein the breakable portion includes one or more of the first fracture surfaces, which are continuously or intermittently arranged along the circumference of the push rod.

[0021] 5. The sample processing apparatus according to any one of embodiments 1-4, wherein the target substance enrichment layer is a porous layer; and / or,

[0022] The target substance enrichment layer includes filter materials and / or adsorption materials; and / or,

[0023] The target substance enrichment layer is configured to allow the retention of natural biological carriers of nucleic acids in biological samples; and / or,

[0024] The pore size of the target material enrichment layer is 0.1 μm to 5 μm; and / or,

[0025] The target substance enrichment layer includes an adsorbent material adapted to specifically bind to the target substance; and / or,

[0026] The target material enrichment layer includes one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, glass fiber layer, and polyethersulfone (PES) layer; and / or,

[0027] The distal sealing portion is an elastic sealing portion; and / or,

[0028] The distal sealing portion includes a sealing ring and / or a piston; and / or,

[0029] A pressing part is provided on the side of the proximal operating part away from the distal sealing part.

[0030] 6. The sample processing apparatus according to any one of embodiments 1-5, wherein a pressing part is provided on the side of the proximal operating part away from the distal sealing part, and the distance from the outer peripheral wall of the pressing part to the axis of the push rod is greater than the distance from the outer peripheral wall of the distal sealing part to the axis of the push rod.

[0031] 7. The sample processing apparatus according to any one of embodiments 1-6, wherein the end of the collection part away from the proximal operation part is provided with a peeling part, and the side of the peeling part away from the proximal operation part is provided with a protrusion.

[0032] 8. The sample processing apparatus as described in embodiment 7, wherein the protrusion has a tip; and / or,

[0033] The peeling portion includes a plurality of protrusions, with adjacent protrusions spaced apart, and / or,

[0034] The plurality of protrusions form a groove on one side facing the proximal operating part, the groove being adapted to hold the target material enrichment layer.

[0035] 9. The sample processing device according to any one of embodiments 1-8, wherein the cylinder includes an outer cylinder and an inner cylinder, the outer cylinder is sleeved on the inner cylinder, a first waste liquid chamber is provided between the outer cylinder and the inner cylinder, the side of the inner cylinder near the outlet of the collection section is communicatively connected to the first waste liquid chamber, the inner wall of the inner cylinder is sealably fitted with the distal sealing part, and the inner wall of the inner cylinder is relatively movable with the push rod.

[0036] 10. The sample processing apparatus as described in embodiment 9, wherein,

[0037] The inner cylinder is connected to the outer cylinder by thread, snap-fit, riveting, welding, or bonding; and / or,

[0038] The first waste liquid chamber is equipped with a first waste liquid detection device; and / or,

[0039] The first waste liquid chamber is provided with a first vent, and a second waterproof and breathable layer is provided at the first vent; and / or,

[0040] The target substance enrichment layer is disposed within the inner cylinder, and is located at the communication point between the inner cylinder and the first waste liquid chamber, or at the communication point between the inner cylinder and the first waste liquid chamber on the side near the push rod inlet; and / or,

[0041] The inner cylinder has a flow channel on the side near the outlet of the collection section. The inner cylinder is connected to the first waste liquid chamber through the flow channel. The target substance enrichment layer is disposed in the inner cylinder and is located at the flow channel or on the side of the flow channel near the push rod inlet; and / or,

[0042] The target material enrichment layer is bonded to the inner cylinder, welded together, connected through a plastic structure, or connected through a sealing ring.

[0043] 11. The sample processing apparatus as described in embodiment 9 or 10, wherein the inner cylinder is provided with a flow channel on the side near the outlet of the collection section, the flow channel including a first flow channel, the first flow channel being disposed on the side wall of the inner cylinder and penetrating the side wall of the inner cylinder in the radial direction of the inner cylinder; and / or,

[0044] The first waste liquid chamber is equipped with a first waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or,

[0045] The first waste liquid chamber is equipped with a first waste liquid detection device, and the outer cylinder is equipped with a first viewing window, which is configured to display the detection result of the first waste liquid detection device; and / or,

[0046] The first waste liquid chamber is equipped with waste liquid absorption material.

[0047] 12. The sample processing device according to any one of embodiments 9-11, wherein the inner cylinder is provided with a first flow channel on the side facing the outlet of the collection section, the outer peripheral wall of the inner cylinder is provided with a first thread on the side facing the outlet of the collection section, the inner peripheral wall of the outer cylinder is provided with a second thread on the side near the outlet of the collection section, the second thread is screwed into the first thread, the first thread and / or the second thread are provided with a second flow channel, and the first flow channel is connected to the first waste liquid chamber through the second flow channel.

[0048] 13. The sample processing apparatus according to any one of embodiments 9-12, wherein the inner cylinder is provided with a first flow channel and a stepped portion on the side facing the outlet of the collection section, the stepped portion is connected to the inner wall of the inner cylinder in the radial direction of the inner cylinder and extends into the inner cylinder, the stepped portion is located on the side of the first flow channel near the push rod inlet and is permeable to the collection section, and satisfies one of the following conditions:

[0049] (1) The target material enrichment layer is bonded to the step surface of the step portion;

[0050] (2) The target material enrichment layer is fixed to the step surface of the step portion by a sealing ring;

[0051] (3) The target material enrichment layer is fixed between the step portion and the first flow channel by a sealing ring. One side of the sealing ring along its thickness direction abuts against the step surface of the step portion, and the other side abuts against the inner wall of the outer cylinder. The sealing ring is provided with a third flow channel penetrating its radial side wall, and the third flow channel is connected to the first flow channel.

[0052] 14. The sample processing apparatus as described in embodiment 13, wherein the target substance enrichment layer is fixed to the step surface of the step portion or between the step portion and the first flow channel by a sealing ring, and the sealing ring is an elastic sealing ring.

[0053] 15. The sample processing apparatus according to any one of embodiments 1-14, wherein the push rod has a cavity, the cavity including a second waste liquid cavity extending along the length direction of the push rod and an open inner cavity, the open inner cavity being disposed on the side of the second waste liquid cavity away from the proximal operating part and communicating with the second waste liquid cavity, the opening of the open inner cavity being disposed on the side of the collection part away from the proximal operating part, and the target substance enrichment layer being disposed on the push rod and located at the opening of the open inner cavity or disposed within the open inner cavity.

[0054] 16. The sample processing apparatus as described in embodiment 15, wherein a one-way valve is provided between the second waste liquid chamber and the open inner cavity, the one-way valve being adapted to open when the pressure in the open inner cavity is greater than that in the second waste liquid chamber; and / or,

[0055] The push rod also has a breakable portion, which is located on the outer wall of the open inner cavity and on the side of the target material enrichment layer near the proximal operating part; the second waste liquid chamber is located on the side of the breakable portion near the proximal operating part; and / or

[0056] The second waste liquid chamber is equipped with a second waste liquid detection device; and / or,

[0057] The second waste liquid chamber is provided with a second vent, and the second vent is provided with a third waterproof and breathable layer; and / or,

[0058] The target material enrichment layer is bonded to the push rod, welded together, connected through a plastic structure, or connected through a sealing ring.

[0059] 17. The sample processing apparatus as described in embodiment 15 or 16, wherein the second waste liquid chamber is provided with a second waste liquid detection device, the second waste liquid detection device comprising one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or,

[0060] The second waste liquid chamber is equipped with a second waste liquid detection device, and the push rod is equipped with a second viewing window, which is configured to display the detection result of the second waste liquid detection device; and / or,

[0061] The second waste liquid chamber is equipped with waste liquid absorption material.

[0062] 18. The sample processing apparatus as described in any one of embodiments 1-17, wherein,

[0063] The push rod also includes a deformable portion extending between the proximal operating portion and the distal sealing portion, the outer peripheral wall of the deformable portion having a snap fastener that protrudes radially along the push rod;

[0064] The cylinder has a sliding groove at the push rod inlet, which includes a circumferential rotating groove and an inclined groove. The circumferential rotating groove is recessed from the inner wall of the cylinder in a direction away from the axis of the cylinder. The inclined groove is connected to the circumferential rotating groove and is inclined towards the inside of the cylinder and extends towards the outlet of the collection section. The circumferential rotating groove has an inlet end, which is connected to the push rod inlet. The circumferential rotating groove is configured to rotate and engage with the circumferential rotating groove when the push rod is pushed to extend the buckle from the inlet end into the circumferential rotating groove. The inclined groove is configured to press and engage with the buckle when the buckle passes through the inclined groove to push the buckle and the push rod downward.

[0065] 19. The sample processing apparatus as described in embodiment 18, wherein the deformable part includes a deformable beam and the buckle, the deformable beam extending along the length direction of the push rod, and the buckle being disposed on the outer peripheral wall of the deformable beam; and / or,

[0066] The distance between the outer peripheral wall of the inlet end and the axis of the cylinder is greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove and the axis of the cylinder; and / or,

[0067] The distance from the connection point between the inclined groove near the push rod inlet and the cylinder to the cylinder axis gradually decreases in the direction away from the circumferential rotation groove; and / or,

[0068] The distance from the connection point between the inclined groove and the cylinder near the outlet of the collecting section to the axis of the cylinder is the same as the distance from the inner wall of the cylinder to the axis of the cylinder; and / or,

[0069] The height of the circumferential rotating groove is 0.02mm-1mm greater than the extension distance of the buckle along the length of the push rod; and / or,

[0070] The inclined groove is disposed on one side of the circumferential rotating groove extending circumferentially along the inner wall of the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder and near the outlet of the collecting part and in a direction away from the circumferential rotating groove in the circumferential direction of the cylinder; and / or,

[0071] The deformable portion includes one or more of the aforementioned latches, with the plurality of latches spaced apart along the circumferential and / or length direction of the push rod; and / or,

[0072] The buckle is a deformable buckle.

[0073] 20. The sample processing apparatus as described in embodiment 18 or 19, wherein the deformable part includes a deformable beam and the buckle:

[0074] The distance between the outer peripheral wall of the deformable beam and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; the distance between the outer peripheral wall of the buckle and the axis of the push rod is greater than the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; and / or

[0075] The deformable beam includes a cantilever beam, and the latch located on the cantilever beam is disposed at the free end of the cantilever beam; and / or,

[0076] The deformable beam includes a double-ended fixed beam, and the buckle located on the double-ended fixed beam is disposed between the two ends of the double-ended fixed beam; and / or

[0077] The deformable beam includes a double-ended fixed beam, and the double-ended fixed beam has a second break on the side near the distal sealing part.

[0078] 21. The sample processing apparatus according to any one of embodiments 18-20, wherein the deformable part includes a plurality of deformable beams spaced apart circumferentially along the push rod, and each deformable beam is independently provided with at least one of the buckles.

[0079] 22. The sample processing apparatus according to any one of embodiments 18-21, wherein the push rod includes one or more layers of the buckles, the multiple layers of buckles are spaced apart along the length direction of the push rod, each layer has one or more buckles, the multiple buckles located in the same layer are spaced apart along the circumferential direction of the push rod, and the distance between the buckles located in the same layer and the distal sealing portion is equal in the length direction of the push rod.

[0080] 23. The sample processing device according to any one of embodiments 18-22, wherein the push rod includes multiple layers of the buckles, each layer has multiple buckles, the number of buckles in different layers is the same, and in two adjacent layers of buckles, the arc corresponding to two adjacent buckles in one layer is the same as the arc corresponding to two adjacent buckles in the other layer.

[0081] 24. The sample processing apparatus as described in embodiment 22 or 23, wherein the number of the snaps in each layer is two; and / or,

[0082] Among the buckles located on the same layer, the arc of two adjacent buckles is 100°-180°.

[0083] 25. A detection system, comprising a sample processing device according to any one of embodiments 1-24.

[0084] 26. The detection system as described in embodiment 25, wherein a detection unit is included, and the sample inlet of the detection unit is configured to cooperate with the collection section outlet of the sample processing device.

[0085] 27. The detection system as described in embodiment 25 or 26, wherein the detection unit includes one or more of a test strip detection device, an electrochemical detection device, and an optical detection device. Attached Figure Description

[0086] Figure 1 This is a schematic diagram of the sample processing device according to one embodiment of the present application, wherein... Figure 1 In Figure 'a', the sample processing device is an assembly drawing, and in Figure 'b', it is an exploded view of the sample processing device.

[0087] Figure 2 This is a schematic diagram of the structure of the cylinder in one embodiment of this application.

[0088] Figure 3 This is a schematic diagram of the internal structure of the cylinder in one embodiment of this application.

[0089] Figure 4 This is a schematic diagram of the internal structure of the cylinder in another embodiment of this application.

[0090] Figure 5 This is a schematic diagram of the push rod in one embodiment of this application, wherein... Figure 5 In the image, b is a magnified view of a local region B within a.

[0091] Figure 6 This is a schematic diagram of the structure of the cylinder in another embodiment of this application, wherein... Figure 6 In the diagram, 'a' is an isometric view of the cylinder, and 'b' is an exploded view of 'a'.

[0092] Figure 7 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in one embodiment of this application.

[0093] Figure 8 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in another embodiment of this application.

[0094] Figure 9 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in another embodiment of this application.

[0095] Figure 10 For this application Figure 9 This is a structural diagram after rotating the structure by an appropriate angle in the direction indicated by the arrow.

[0096] Figure 11 This is a schematic diagram illustrating the movement and disassembly of a liquid sample processed using the sample processing device according to one embodiment of this application. Figure 11 ① is a schematic diagram of adding a sample; ② is a schematic diagram of pressing down the push rod; ③ is a schematic diagram of pushing the push rod out of the cylinder; ④ is a schematic diagram of breaking the push rod to obtain the collection part.

[0097] Figure 12 This is a schematic diagram of the sample processing apparatus in another embodiment of this application, wherein... Figure 12 In Figure 'a', the sample processing device is an assembly drawing, and in Figure 'b', it is an exploded view of the sample processing device.

[0098] Figure 13 This is a schematic diagram of the push rod in another embodiment of this application, wherein... Figure 13 In diagram b, we see a cross-sectional view along the DD direction in diagram a. Diagram c1 is an enlarged view of a local region E in diagram b after the check valve is opened. Diagram c2 is an enlarged view of a local region E in diagram b when the check valve is not opened.

[0099] Figure 14 This is a schematic diagram of the assembly structure of the push rod in another embodiment of this application, wherein... Figure 14 In the diagram, 'a' is an isometric view of the push rod, and 'b' is an exploded view of 'a'.

[0100] Figure 15This is a schematic diagram illustrating the movement and disassembly of a liquid sample being processed using the sample processing apparatus according to another embodiment of this application. Figure 15 ① is a schematic diagram of adding a sample; ② is a schematic diagram of pressing down the push rod; ③ is a schematic diagram of pushing the push rod out of the cylinder; ④ is a schematic diagram of breaking the push rod to obtain the collection part.

[0101] Figure 16 This is a schematic diagram of the sample processing device in another embodiment of this application, wherein... Figure 16 In diagram a, the push rod is inserted into the cylinder, and in diagram b, the push rod is not inserted into the cylinder.

[0102] Figure 17 This is a schematic diagram of the structure of the cylinder and the slide groove in one embodiment of this application, wherein... Figure 17 In Figure a, it is a schematic diagram of the cylinder structure, and in Figure b, it is an enlarged view of the structure of the sliding groove in a local area of ​​the cylinder shown in Figure a.

[0103] Figure 18 This is a schematic diagram illustrating the matching relationship between the push rod with a latch and the slide groove in a sample processing device according to one embodiment of this application, wherein... Figure 18 Figure b is a schematic diagram of the push rod being inserted into the cylinder, and figure a is an enlarged view of a local area G in figure b.

[0104] Figure 19 This is a schematic diagram of the push rod in one embodiment of this application.

[0105] Figure 20 for Figure 19 A schematic diagram of the structure rotated 90° clockwise along the axis of the push rod.

[0106] Figure 21 This is a schematic diagram of the push rod in another embodiment of this application.

[0107] Figure 22 This is a schematic diagram of the push rod in another embodiment of this application. Figure 22 In the diagram, a, b, and c are structural schematic diagrams of the push rod from three different perspectives. b is a schematic diagram of the push rod in a rotating 90° clockwise along the direction of the black arrow. c is a side view of a.

[0108] Figure 23 This is a schematic diagram of the push rod in another embodiment of this application. Figure 23 In the diagram, a, b, and c are structural schematic diagrams of the push rod from three different perspectives. b is a schematic diagram of a rotated 90° clockwise along the axis of the push rod, and c is a side view of a.

[0109] Figure 24 This is a schematic diagram of the push rod having a second break in one embodiment of this application.

[0110] Figure 25This is a schematic diagram showing the irreversible deformation of the deformable beam at the second fracture point after use, as described in one embodiment of this application.

[0111] Figure 26 This is a step-by-step disassembly diagram of the push rod with two layers of buckles and the cylinder in one embodiment of this application, where the black arrows represent the movement mode of the push rod.

[0112] Figure 27 The results are the LAMP test results from Experiment Example 1, demonstrating that the sample extracted using the device of this application can achieve effective LAMP amplification.

[0113] Figure 28 The results of the LAMP test in Experiment Example 2 demonstrate that the sample extracted using the device of this application can achieve effective LMAP amplification.

[0114] Figure 29 The results of the qPCR test in Experiment Example 3 demonstrate that the sample extracted using the device described in this application can achieve effective qPCR amplification.

[0115] Figure 30 The electrochemical test results of the LAMP product in Experiment Example 4 demonstrate that the sample extracted using the device of this application can achieve specific LMAP amplification.

[0116] Figure 31 The results of the chromatography test strip for the LAMP product in Experiment Example 5 demonstrate that the sample extracted using the device of this application can achieve specific LMAP amplification.

[0117] Explanation of reference numerals in the attached figures:

[0118] 10-Push rod; 11-Collection section; 11a-Peeling section; 11a1-Protrusion on peeling section; 11a2-Groove on peeling section; 12-Distant sealing section; 13-Proximal operating section; 13a-Pressing section; 14-Breakable section; 14a-First fracture; 15-Cavity; 15a-Open inner cavity; 15b-Second waste liquid chamber; 15c-One-way valve; 15d-Second waste liquid detection device; 16-Second viewing window; 17-Second vent; 18-Deformable section; 18a-Snap; 18a1-First snap; 18a2-Second snap; 18b-Deformable beam; 18c-Second fracture; 20-Cylinder; 20a-Outer cylinder; 20b-Inner cylinder Body; 20c-First waste liquid chamber; 20d-First waste liquid detection device; 20e-First viewing window; 20f-Slide groove; 20f1-Circumferential rotation groove; 20f2-Inclined groove; 20f3-Inlet end of slide groove; 21-Push rod inlet; 22-Collection part outlet; 23-Sealing layer; 24-Flow channel; 24a-First flow channel; 24b-Second flow channel; 24c-Third flow channel; 25a-Second thread; 25b-First thread; 26-Stepped part; 27-Sealing ring; 27a-First sealing ring; 27b-Second sealing ring; 27b1-Flanged edge; 27c-Third sealing ring; 28-Second stepped part; 29-Third stepped part; 30-Target material enrichment layer. Detailed Implementation

[0119] The present application will be further described below with reference to specific embodiments. It should be understood that these specific embodiments are for illustrative purposes only and are not intended to limit the scope of the present application.

[0120] In this application, the following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art.

[0121] As used herein, the term "comprising" should be interpreted as inclusive and open-ended, not exclusive. Specifically, when used in the specification and claims, the term "comprising" and its variations mean including the specified features, steps, or components. These terms should not be construed as excluding the presence of other features, steps, or components.

[0122] As used herein, the term “optional” means that the events or circumstances described below may, but are not required to, occur, including both when they occur and when they do not.

[0123] In this document, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first," "second," or "third" may explicitly or implicitly include at least one of that feature. In this document, as described in the application, "multiple" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0124] Wherever a range of values ​​is given herein, the range includes its endpoints, as well as all individual integers and fractions within the range, and also includes each narrower range formed by all the various possible combinations of those endpoints and internal integers and fractions, to form a subgroup of a larger group of values ​​within the same extent as each of those narrower ranges is explicitly given.

[0125] In a first aspect of this application, a sample processing apparatus is provided, with reference to Figure 1-5 or Figure 12-13 It is understood that it includes: push rod 10, cylinder 20, and target material enrichment layer 30. Specifically:

[0126] refer to Figure 1 or Figure 12 Understandably, the push rod 10 includes a proximal operating part 13, a distal sealing part 12, and a collection part 11 located on the side of the distal sealing part 12 away from the proximal operating part 13.

[0127] refer to Figure 1-2 or Figure 2 and Figure 12 Understandably, the inner wall of the cylinder 20 and the distal sealing part 12 can be sealed together, and the inner wall of the cylinder 20 and the push rod 10 can move relative to each other. One end of the cylinder 20 is provided with a push rod inlet 21, and the other end of the cylinder 20 is provided with a collection part outlet 22. A sealing layer 23 is provided at the collection part outlet 22. The sealing layer 23 is configured to push the push rod 10 until the collection part 11 contacts the sealing layer 23, and then continue to push the push rod 10 so that the collection part 11 can penetrate the sealing layer 23.

[0128] Depending on the location of the target substance enrichment layer 30, this sample processing device can be used in combination with two different schemes:

[0129] For scheme 1: the target material enrichment layer 30 is set on the cylinder 20.

[0130] refer to Figure 1-5 Understood, the target material enrichment layer 30 is located inside the cylinder 20 and adjacent to the collection section outlet 22 (reference). Figure 3 or Figure 4 (Understanding), the end of the collecting unit 11 furthest from the proximal operating unit 13 is provided with a peeling part 11a (refer to...). Figure 1or Figure 5 (Understanding) The peeling section 11a is configured such that when the push rod 10 pushes the collection section 11 through the sealing layer 23, the peeling section 11a can peel off the target material enrichment layer 30 and carry it out of the cylinder 20. Thus, the enrichment and transfer of the target material can be achieved through the cooperation of the push rod 10, the cylinder 20 and the target material enrichment layer 30.

[0131] Regarding Scheme 1, in actual operation, the liquid sample can be transferred into the cylinder 20, so that the liquid sample comes into contact with the target substance enrichment layer 30 and the target substance in the liquid sample is enriched by the target substance enrichment layer 30. The collection part 11 of the push rod 10 is inserted into the cylinder 20 through the push rod inlet 21. During the enrichment of the target substance, the peeling part 11a located at the end of the collection part 11 away from the proximal operation part 13 can be selectively controlled to contact or not contact the target substance enrichment layer 30 (e.g., not contact can be selected). After the enrichment of the target substance is completed, the push rod 10 is pushed to make the peeling part 11a contact with the target substance enrichment layer 30 and peel it off and carry it out, until the collection part 11 penetrates the sealing layer 23, extends out of the cylinder 20 and carries out the target substance enrichment layer 30, thus realizing the enrichment and transfer of the target substance.

[0132] For scheme 2, the target material enrichment layer 30 is set on the push rod 10.

[0133] refer to Figure 2 and Figure 12-13 Understood, the target material enrichment layer 30 is located on the side of the collection unit 11 away from the proximal operation unit 13 (see reference). Figure 13 (Understanding) The target material enrichment layer 30 is configured to be carried out of the cylinder 20 by the collection unit 11 when the push rod 10 pushes the collection unit 11 through the sealing layer 23. Thus, the enrichment and transfer of the target material can be achieved through the cooperation of the push rod 10, the cylinder 20 and the target material enrichment layer 30.

[0134] Regarding Scheme 2, in actual operation, the liquid sample can be transferred into the cylinder 20, and the collection part 11 of the push rod 10 can be inserted into the cylinder 20 through the push rod inlet 21, so that the liquid sample comes into contact with the target substance enrichment layer and the target substance enrichment layer 30 is used to enrich the target substance in the liquid sample. After the operation of enriching the target substance is completed, the push rod 10 is pushed until the collection part 11 penetrates the sealing layer 23, extends out of the cylinder 20 and takes out the target substance enrichment layer 30, thereby realizing the enrichment and transfer of the target substance.

[0135] It is understood that the liquid sample can be an untreated sample or a pretreated sample. The pretreatment operation can be flexibly selected according to actual needs. For example, for biological samples, the pretreatment operation can include, but is not limited to, one or more of the conventional treatment methods such as dilution, reaction, and lysis.

[0136] It is understood that the target substance can be the original component of the liquid sample, or it can be obtained from the original component of the liquid sample through reaction, pyrolysis or other treatment methods. The process of treating the liquid sample can be flexibly selected to be carried out in the cylinder 20 according to actual needs.

[0137] The sample processing devices of Scheme 1 and Scheme 2 of this application can each independently have one or more of the following technical effects: they can be used for sample processing or pre-processing steps to facilitate subsequent operations or detection requirements; they can be used to enrich the analyte in a large volume of sample liquid, or to enrich the components of a large volume of sample liquid from which the analyte can be obtained, so as to improve the sensitivity of subsequent operations or detection; they can simultaneously perform sample (pre)processing and enrichment of the target substance.

[0138] It should be noted that in this application, in the terms "outer peripheral wall of the collecting part 11", "outer peripheral wall of the distal sealing part 12", "outer peripheral wall of the pressing part 13a", "outer peripheral wall of the push rod 10", "outer peripheral wall of the deformable part 18", "outer peripheral wall of the deformable beam 18b", and "outer peripheral wall of the buckle 18a", "outer" refers to the direction away from the axis of the push rod 10. Additionally, in the terms "inner wall of the cylinder 20", "outer cylinder 20a", "inner cylinder 20b", "inner wall of the cylinder 20 recessed outwards", "inner part of the cylinder 20", "outer peripheral wall of the inlet end 20f3", and "outer peripheral wall of the circumferential rotation groove 20f1", "inner" refers to the direction close to the axis of the cylinder 20, and "outer" refers to the direction away from the axis of the cylinder 20.

[0139] Furthermore, Scheme 1 and Scheme 2 can each independently satisfy one or more of the following additional technical features:

[0140] In some embodiments of this application, reference is made to Figure 1 or Figure 12 It is understood that the distance between the outer peripheral wall of the collecting section 11 and the axis of the push rod 10 can be less than or equal to the distance between the outer peripheral wall of the distal sealing section 12 and the axis of the push rod 10. Optionally, the distance between the outer peripheral wall of the collecting section 11 and the axis of the push rod 10 can be less than the distance between the outer peripheral wall of the distal sealing section 12 and the axis of the push rod 10. This further facilitates the collecting section 11 penetrating the sealing layer 23 to carry the target material enrichment layer 30 out of the cylinder 20.

[0141] In some embodiments of this application, the sealing layer 23 may be a waterproof layer or a first waterproof and breathable layer. The specific type or material may be flexibly selected according to actual needs. For example, the waterproof layer may include, but is not limited to, an aluminum film, and the first waterproof and breathable layer may include, but is not limited to, a permeable membrane.

[0142] In some embodiments of this application, reference is made to Figure 1 or Figure 5It is understood that the push rod 10 may also be provided with a breakable part 14, which can be located between the collection part 11 and the distal sealing part 12. When the collection part 11 penetrates the sealing layer 23, extends out of the cylinder 20, and carries the target substance enrichment layer 30 out of the cylinder 20, the push rod can be broken at the breakable part 14, so that the target substance enrichment layer 30 can be transferred with the collection part 11 (e.g., it can be directly transferred to the subsequent detection instrument). Existing sample (pre)processing methods are usually quite cumbersome, such as involving multiple transfers between samples or devices. These transfer processes often rely on manual operation, such as sampling and transfer using tools like pipettes and tweezers. During the operation, errors and loss of target substances are prone to occur, leading to reduced detection accuracy. Moreover, the process is cumbersome, time-consuming, and labor-intensive. In addition, cross-contamination is easily generated during manual transfer operations, resulting in low reliability of the detection results. By incorporating a breakable section, contactless transfer of the target substance can be achieved, reducing contact between the enriched target substance and materials such as tweezers. This reduces the risk of target substance loss and / or cross-contamination during transfer, which could lead to decreased detection accuracy.

[0143] In some embodiments of this application, reference is made to Figure 1 or Figure 12 It is understood that the distance between the outer peripheral wall of the breakable portion 14 and the axis of the push rod 10 can be less than or equal to the distance between the outer peripheral wall of the collecting portion 11 and the axis of the push rod 10. It should be noted that the breakable portion 14 can achieve the breakable effect through material selection, structural design (such as forming a fracture on the push rod surface), or both material selection and structural design, as long as it can break the push rod 10 to separate the collecting portion 11 and the push rod 10. Optionally, the distance between the outer peripheral wall of the breakable portion 14 and the axis of the push rod 10 can be less than the distance between the outer peripheral wall of the collecting portion 11 and the axis of the push rod 10, thereby further facilitating the breaking of the push rod 10 and achieving the separation of the collecting portion 11 and the push rod 10.

[0144] In some embodiments of this application, reference is made to Figure 1 and Figure 12 It is understood that the distance between the outer peripheral wall of the push rod 10 and the axis of the push rod 10 on the side of the distal sealing part 12 away from the proximal operating part 13 can be less than the distance between the outer peripheral wall of the distal sealing part 12 and the axis of the push rod 10. In this structural design, when the push rod 10 is pushed to move within the cylinder 20, a liquid sample can also be accommodated between the push rod 10 and the cylinder 20 within the space formed by the distal sealing part 12, the inner wall of the cylinder 20, and the sealing layer 23.

[0145] In some embodiments of this application, reference is made to Figure 5It is understood that the breakable portion 14 may include a first fracture 14a. This facilitates the separation of the collecting portion 11 and the push rod 10 by breaking the push rod 10. It should be noted that the specific structure and depth of the first fracture 14a are not particularly limited, and those skilled in the art can flexibly choose according to actual needs. For example, the first fracture 14a may include, but is not limited to, one or more of notches, notches, and grooves. Optionally, the notch may include, but is not limited to, one or more of V-shaped notches, U-shaped notches, etc. Optionally, the notch may extend along the circumferential direction of the push rod 10. Optionally, the groove may extend along the circumferential direction of the push rod 10; for example, in the circumferential direction of the push rod 10, the groove may extend along the entire outer peripheral wall of the push rod 10 (e.g., an annular groove) or be provided along a portion of the outer peripheral wall of the push rod 10. Further optionally, the groove may be an annular groove.

[0146] In some embodiments of this application, the breakable portion 14 may include one or more first breaks 14a, which may be continuous or spaced apart along the circumference of the push rod 10. For example, the breakable portion 14 may include only one first break 14a, which may be continuous along the circumference of the push rod 10, such as an annular groove (see reference). Figure 5 (Understanding). For example, the breakable portion 14 may include multiple first breaks 14a, which may be spaced apart circumferentially along the push rod 10. For instance, the breakable portion 14 may include two first breaks 14a, which may be symmetrically spaced along the circumferential surface of the push rod 10. Providing multiple first breaks 14a or annular first breaks 14a facilitates breaking the push rod 10 from multiple directions and / or reduces the radial distance of the breakable portion 14, further facilitating the separation of the collecting unit 11 and the push rod 10 by breaking the push rod 10.

[0147] It is understandable that, based on the purpose of separating the collection part 11 and the push rod 10 by breaking the push rod 10, the length of the collection part 11 can be set as follows: when the push rod 10 is pushed to the point where the distal sealing part 12 abuts against the inner wall of the cylinder 20 on the side away from the push rod inlet 21, the breakable part 14 extends out of the cylinder 20, or the breakable part 14 is located at the collection part outlet 22.

[0148] It is understood that, in some embodiments of this application, the composition, type or structure of the target material enrichment layer 30 can be flexibly selected according to the actual needs such as the target material to be enriched.

[0149] Optionally, the target substance enrichment layer 30 can be a porous layer. Using a porous layer is beneficial to ensure that the liquid sample is in full contact with the target substance enrichment layer, thereby achieving the enrichment and separation of the target substance.

[0150] It is understandable that when the target material enrichment layer 30 is a porous layer, the specific type of the porous layer can be flexibly selected according to actual needs. For example, the porous layer may include, but is not limited to, one or more of the following: sponge, porous adsorption membrane, porous microsphere.

[0151] It is understood that when the target material enrichment layer 30 is a porous layer, the pore size of the porous layer is not particularly limited. Those skilled in the art can flexibly select according to actual needs. For example, the pore size of the target material enrichment layer can be from 0.1μm to 5μm, such as 0.1μm, 0.5μm, 1μm, 1.5μm, 2μm, 2.5μm, 3μm, 3.5μm, 4μm, 4.5μm or 5μm, or it can be any range of the above values.

[0152] Optionally, the target substance enrichment layer 30 may include filter materials and / or adsorption materials. It is understood that the materials of the filter materials and adsorption materials are not particularly limited, and those skilled in the art can flexibly select them according to actual needs. For example, when it is necessary to enrich the target substance through filtration, the target substance enrichment layer 30 may include filter materials, and the specific material of the filter materials can be flexibly selected according to the specific type, size, etc. of the target substance; when it is necessary to enrich the target substance through adsorption (such as physical adsorption and / or chemical adsorption), the target substance enrichment layer 30 may include adsorption materials, and the specific material of the adsorption materials can be flexibly selected according to the specific type, etc. of the target substance; furthermore, the target substance enrichment layer 30 may also have both filtration and adsorption functions, which can be achieved through conventional technical means such as material selection and structural design of the target substance enrichment layer.

[0153] Optionally, the target substance enrichment layer 30 can be configured to allow the retention of nucleic acid natural biological carriers (e.g., cells or viruses) in biological samples. For example, a porous layer with a suitable pore size can be selected as the target substance enrichment layer according to the molecular size or dimensions of the nucleic acid natural biological carriers that allow the retention of nucleic acid in biological samples. For example, the pore size of the porous layer can be from 0.1 μm to 5 μm.

[0154] Optionally, the target material enrichment layer 30 may include, but is not limited to, one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, glass fiber layer, and polyethersulfone (PES) layer.

[0155] Optionally, the target substance enrichment layer 30 may include an adsorbent material adapted to specifically bind to the target substance. This allows for the specific enrichment of the desired target substance (such as nucleic acids or proteins). For example:

[0156] In some embodiments, the adsorbent material of the target substance enrichment layer 30 can be a hydrophobic silicon-based material to specifically capture and adsorb hydrophobic molecules in the sample, such as various lipid-soluble drugs and their metabolites.

[0157] In other embodiments, the adsorbent material of the target substance enrichment layer 30 may be an immunoaffinity membrane modified with specific antibodies to specifically capture specific antigens or pathogenic microorganisms in the sample, such as surface protein antigens of Streptococcus pneumoniae and Staphylococcus aureus.

[0158] In some other embodiments, the adsorbent material of the target substance enrichment layer 30 may be a combination of a silicon-based membrane and magnetic nanobeads as a highly efficient nucleic acid enrichment material to capture RNA or DNA in the sample to be tested.

[0159] In some embodiments of this application, reference is made to Figure 1 or Figure 12 It is understood that the specific type of the distal sealing part 12 is not particularly limited, and those skilled in the art can choose flexibly according to actual needs. For example, the distal sealing part 12 can be an elastic sealing part. As another example, the distal sealing part 12 can include, but is not limited to, a sealing ring and / or a piston. It should be noted that the specific materials of the elastic sealing part, sealing ring, and piston are not particularly limited, and those skilled in the art can choose flexibly according to actual needs. For example, common elastic sealing materials in the field can be selected, as long as they can achieve a sealing fit between the inner wall of the cylinder 20 and the distal sealing part 12 and allow relative movement.

[0160] In some embodiments of this application, reference is made to Figure 1 It is understood that a pressing part 13a may be provided on the side of the proximal operating part 13 away from the distal sealing part 12. This further facilitates the pressing operation of the push rod 10.

[0161] In some embodiments of this application, reference is made to Figure 1 It is understood that the distance from the outer peripheral wall of the pressing part 13a to the axis of the push rod 10 can be greater than the distance from the outer peripheral wall of the distal sealing part 12 to the axis of the push rod 10. This further facilitates the push-pull operation of the push rod 10 within the cylinder 20.

[0162] Furthermore, for Scheme 1, one or more of the following additional technical features may also be satisfied:

[0163] In some embodiments of this application, reference is made to Figure 5It is understood that the end of the collection unit 11 away from the proximal operation unit 13 is provided with a peeling part 11a, and the side of the peeling part 11a away from the proximal operation unit 13 may be provided with a protrusion 11a1. Protrusion 11a1 is provided to facilitate the peeling part 11a to pierce the target material enrichment layer 30 when the push rod 10 is pushed to make the collection unit 11 penetrate the sealing layer 23, and further facilitates the peeling part 11a to peel off the target material enrichment layer 30 and bring it out of the cylinder 20.

[0164] Optionally, refer to Figure 5 It is understood that the protrusion 11a1 may have a pointed tip, which further facilitates the peeling part 11a to peel off and attach the target material enrichment layer 30 when the push rod 10 is pushed to make the collection part 11 penetrate the sealing layer 23.

[0165] Optionally, refer to Figure 5 It is understood that the peeling section 11a may include multiple protrusions 11a1, and adjacent protrusions 11a1 may be spaced apart. Therefore, when the push rod 10 is pushed to make the collection section 11 penetrate the sealing layer 23, the push rod 10 can be rotated when the peeling section 11a pierces the target material enrichment layer 30, which further facilitates the peeling section 11a to peel off and smoothly bring the target material enrichment layer 30 out of the cylinder 20.

[0166] Optionally, refer to Figure 5 It is understood that the peeling section 11a may include multiple protrusions 11a1, and the protrusions 11a1 can form a groove 11a2 on the side facing the proximal operating section 13. The groove 11a2 is suitable for clamping the target material enrichment layer 30. Thus, when the push rod 10 is pushed to make the collection section 11 penetrate the sealing layer 23, the push rod 10 can be rotated when the peeling section 11a pierces the target material enrichment layer 30, so that the target material enrichment layer 30 is peeled off and attached to the groove 11a2. This not only further facilitates the collection section 11 to smoothly bring the target material enrichment layer 30 out of the cylinder 20, but also facilitates the discharge of the liquid between the target material enrichment layer 30 and the peeling section 11a.

[0167] In some embodiments of this application, reference is made to Figure 1 and Figure 3It is understood that the cylinder 20 may include an outer cylinder 20a and an inner cylinder 20b. The outer cylinder 20a is fitted onto the inner cylinder 20b, forming a first waste liquid chamber 20c between the outer cylinder 20a and the inner cylinder 20b. The side of the inner cylinder 20b near the collection section outlet 22 is communicatively connected to the first waste liquid chamber 20c. The inner wall of the inner cylinder 20b is sealed to the distal sealing section 12, and the inner wall of the inner cylinder 20b is movable relative to the push rod 10. Thus, when the push rod 10 is pushed to allow the collection section 11 to penetrate the sealing layer 23, the liquid in the inner cylinder 20b can enter the first waste liquid chamber 20c under pressure after passing through the target substance enrichment layer 30. Current sample enrichment devices generally do not have effective integrated waste liquid treatment or real-time monitoring functions, and the waste liquid is usually directly discarded, which not only wastes sample resources that have not been fully utilized, but may also cause unnecessary pollution and risks to the environment. The above-mentioned setup of this application can integrate sample pretreatment, target substance enrichment and waste liquid collection into one device. Not only is the device compact and easy to operate, but the addition of a breakable part 14 on the push rod 10 also enables contactless transfer of the enriched target substance, reducing the risk of target substance loss and / or cross-contamination during the transfer process, which could lead to a decrease in detection accuracy. This facilitates a more efficient, safe and pollution-free process, overcoming the shortcomings of traditional technologies such as complex processing, easy cross-contamination, and low sample utilization efficiency.

[0168] In some implementations, reference Figure 1 or Figure 3 It is understood that the outer cylinder 20a and the inner cylinder 20b can be integrally formed or fixedly connected by welding or other methods, or they can be detachably connected. For example, the inner cylinder 20b and the outer cylinder 20a can be connected by threads, snap-fit, riveting, welding, or bonding. The welding method can be flexibly selected from one or more methods according to actual needs. For example, mating threads can be provided on the outer surface of the inner cylinder 20b and the inner surface of the outer cylinder 20a, and ultrasonic lines can be provided at the threads to achieve a fusion connection between the inner cylinder 20b and the outer cylinder 20a using ultrasonic welding. For example, refer to... Figure 3 It is understood that the inner cylinder 20b is connected to the outer cylinder 20a on the side near the push rod inlet 21, and / or the inner cylinder 20b is connected to the outer cylinder 20a on the side near the collection section outlet 22.

[0169] In some implementations, reference Figure 4 and Figure 6It is understood that a first waste liquid detection device 20d may be provided within the first waste liquid chamber 20c. Taking a chromatographic test strip as an example, when liquid enters the waste liquid chamber, the liquid will contact the sample pad of the chromatographic test strip to trigger detection. By setting the first waste liquid detection device 20d in the first waste liquid chamber 20c, necessary detection of the waste liquid can be performed before it is discarded, to assess and analyze the waste liquid condition in real time, and / or test the sample condition. This not only improves the overall sample information acquisition rate but also allows for determination of whether the waste liquid needs appropriate treatment before disposal, reducing the potential unnecessary pollution and risks to the environment. It should be noted that the specific type of the first waste liquid detection device 20d is not particularly limited; those skilled in the art can flexibly choose according to actual needs. For example, the first detection device 20d may include, but is not limited to, one or more of pH test strips, chromatographic test strips, and electrochemical detection devices. Optionally, the electrochemical detection device may include, but is not limited to, an electrochemical electrode.

[0170] In some implementations, reference Figure 6 It is understood that a first viewing window 20e may be provided on the outer cylinder 20a, and the first viewing window 20e is configured to display the detection results of the first waste liquid detection device 20d. This allows for a more intuitive understanding of the waste liquid detection results.

[0171] In some embodiments, the first waste liquid chamber 20c may be provided with a first vent (not shown), and the first vent may be provided with a second waterproof and breathable layer (not shown). This can achieve air pressure balance in the first waste liquid chamber 20c, and facilitate the transfer of waste liquid into the first waste liquid chamber 20c during the process of pushing the push rod 10 to make the collection part 11 penetrate the sealing layer 23.

[0172] In some implementations, reference Figure 3 It is understood that the target material enrichment layer 30 can be located inside the inner cylinder, specifically at the connection between the inner cylinder 20b and the first waste liquid chamber 20c; or, refer to... Figure 4 It is understood that the target substance enrichment layer 30 can be disposed within the inner cylinder 20b, and located near the push rod inlet 21 at the connection between the inner cylinder 20b and the first waste liquid chamber 20c. This further facilitates the transfer of liquid samples to the waste liquid chamber after enrichment by the target substance enrichment layer. Optionally, the target substance enrichment layer 30 can be disposed near the push rod inlet 21 at the connection between the inner cylinder 20b and the first waste liquid chamber 20c.

[0173] In some embodiments, the target substance enrichment layer 30 can be fixed inside the cylinder 20 before processing the liquid sample. Exemplarily, the target substance enrichment layer 30 can be bonded to the cylinder 20, welded together, connected via a plastic structure, or connected via a sealing ring. Optionally, the welded connection can be achieved by ultrasonic welding, such as by ultrasonically welding the edge of the target substance enrichment layer 30 to the inner cylinder 20b. Alternatively, the target substance enrichment layer 30 can be clamped inside the inner cylinder 20b using sealing rings. For example, two sealing rings can be provided inside the inner cylinder 20b, with the inner diameter of the sealing rings larger than the outer diameter of the collection part 11, so that the outer surfaces of the two sealing rings abut and fix against the inner surface of the inner cylinder 20b, clamping the target substance enrichment layer 30 between the two sealing rings; for another example, refer to... Figure 7 It is understood that a step and a sealing ring can be provided inside the inner cylinder 20b. The step is connected to the inner wall of the inner cylinder 20b in the radial direction and extends into the inner cylinder 20b. The step 26 and the collection part 11 can be penetrated. The inner diameter of the sealing ring is greater than or equal to the outer diameter of the collection part 11, so that the sealing ring abuts against the inner surface of the inner cylinder 20b and the step surface of the step, respectively, and the target material enrichment layer 30 is sandwiched between the sealing ring and the step surface of the step.

[0174] In some embodiments, a waste liquid absorption material may be provided in the first waste liquid chamber 20c. This not only absorbs excess waste liquid but also improves the transport force of liquid into the waste liquid chamber. In particular, when the liquid sample enters the waste liquid chamber after passing through the target substance enrichment layer 30, it helps to improve the enrichment efficiency of the target substance and reduce the risk of waste liquid backflow.

[0175] In some implementations, reference Figure 7 or Figure 8 It is understood that a flow channel 24 may be provided on the side of the inner cylinder 20b near the outlet 22 of the collection section. The inner cylinder 20b can be connected to the first waste liquid chamber 20c through the flow channel 24. The target substance enrichment layer 30 is located inside the inner cylinder 20b and is located at the flow channel 24 or on the side of the flow channel 24 near the push rod inlet 21. This further facilitates the transfer of liquid samples to the waste liquid chamber after enrichment by the target substance enrichment layer. Optionally, the target substance enrichment layer 30 may be located on the side of the flow channel 24 near the push rod inlet 21. Alternatively, the flow channel 24 may be located at the end of the inner cylinder 20b near the outlet 22 of the collection section.

[0176] Optionally, the flow channel 24 may include a first flow channel 24a, which may be disposed on the side wall of the inner cylinder 20b and penetrate the side wall of the inner cylinder 20b in the radial direction. This facilitates the communication between the inner cylinder 20b and the first waste liquid chamber 20c.

[0177] Further, refer to Figure 10 It is understood that a first thread 25b may be provided on the outer peripheral wall of the inner cylinder 20b facing the collection outlet 22, and a second thread 25a may be provided on the inner peripheral wall of the outer cylinder 20a near the collection outlet 22. The second thread 25a is screwed into the first thread 25b. A second flow channel 24b may be provided on the first thread 25b and / or the second thread 25a, and the first flow channel 24a is connected to the first waste liquid chamber 20c through the second flow channel 24b. This facilitates both the connection between the inner cylinder 20b and the outer cylinder 20a and the connection between the inner cylinder 20b and the first waste liquid chamber 20c.

[0178] Optionally, refer to Figures 7 to 10 It is understood that the inner cylinder 20b facing the outlet 22 of the collection section may be provided with a first flow channel 24a and a step portion 26. The step portion 26 is connected to the inner wall of the inner cylinder 20b in the radial direction and extends into the inner cylinder 20b. The step portion 26 may be located on the side of the first flow channel 24a near the push rod inlet 21 and may be permeable to the collection section 11. The target material enrichment layer 30 may be fixed inside the inner cylinder 20b in the following manner:

[0179] In some specific examples, the target material enrichment layer 30 can be bonded to the step surface of the step portion 26. Optionally, the target material enrichment layer 30 can be bonded to the step surface of the step portion 26 facing the push rod inlet 21, or to the step surface of the step portion 26 facing the collection outlet 22.

[0180] In other specific examples, refer to Figure 7 or Figure 8 It is understood that the target material enrichment layer 30 can be fixed to the step surface of the step portion 26 by the sealing ring 27. Optionally, the target material enrichment layer 30 can be sandwiched between the sealing ring 27 and the step surface of the step portion 26 facing the push rod inlet 21, or sandwiched between the sealing ring 27 and the step surface of the step portion 26 facing the collection section outlet 22. It is understood that the inner diameter of the sealing ring 27 is greater than or equal to the outer diameter of the collection section 11, and the sealing ring 27 can abut against the inner surface of the inner cylinder 20b and the step surface of the step portion 26, respectively. Optionally, the sealing ring 27 can be an elastic sealing ring.

[0181] In some specific examples, refer to Figure 7 Understood, the target material enrichment layer 30 can be fixed between the step portion 26 and the first flow channel 24a by the sealing ring 27 (after the inner cylinder 20b and the outer cylinder 20a are assembled). One side of the sealing ring 27 along its thickness direction can abut against the step surface of the step portion 26 (understood to be the step surface of the step portion 26 facing the collection section outlet 22), and the other side can abut against the inner wall of the outer cylinder 20a (facing the push rod inlet). (Refer to...) Figure 10 It is understood that the sealing ring 27 may have a third flow channel 24c penetrating its radial sidewall, and the third flow channel 24c may communicate with the first flow channel 24a. This facilitates communication between the inner cylinder 20b and the first waste liquid chamber 20c, and also allows as much waste liquid as possible to flow into the first waste liquid chamber. It is understood that the inner diameter of the sealing ring 27 is greater than or equal to the outer diameter of the collecting part 11, and the sealing ring 27 may abut against the inner surface of the inner cylinder 20b and the step surface of the step part 26, respectively. Optionally, the sealing ring 27 may be an elastic sealing ring. Further optionally, the number of sealing rings 27 may be one or more, and the target material enrichment layer 30 may be sandwiched between the step surface of the step part 26 and the sealing ring, or between two adjacent sealing rings. Still optionally, the target material enrichment layer 30 may be located on the side of the third flow channel 24c near the push rod inlet 21.

[0182] For some specific examples, see reference Figure 8 or Figure 9 It is understood that the sealing layer 23 can be disposed between the sealing ring 27 and the outer cylinder 20a; alternatively, the number of sealing rings 27 can be multiple, for example, such as Figure 7 As shown, the number of sealing rings 27 can be 1; as Figure 8 As shown, the number of sealing rings 27 can be two; as Figure 9 or Figure 10 As shown, there can be three sealing rings 27. When there are multiple sealing rings 27, the sealing layer 23 can be located between two adjacent sealing rings and on the side of the third flow channel 24c and / or the first flow channel 24a near the collection section outlet 22.

[0183] For some specific examples, see reference Figure 9 and Figure 10 It is understood that the inner cylinder 20b may also have a second step 28 and a third step 29 connected in sequence on the side of the step 26 facing the collection section outlet 22. The second step 28 is connected to the step 26 and located between the step 26 and the third step 29. The second step 28 and the third step 29 are independently connected to the inner wall of the inner cylinder 20b in the radial direction and extend into the inner cylinder 20b, and are both permeable to the collection section 11. The outer diameter of the second step 28 is larger than the outer diameter of the step 26, and the outer diameter of the third step 29 is larger than the outer diameter of the second step 28. The first flow channel 24a is located at the end of the second step 28 facing the collection section outlet 22. The sealing ring 27 may include a first sealing ring 27a, a second sealing ring 27b, and a third sealing ring 27c. The inner diameters of the first sealing ring 27a, the second sealing ring 27b, and the third sealing ring 27c are each independently greater than or equal to the outer diameter of the collection section 11, and:

[0184] The first sealing ring 27a is configured to be embedded in the outlet enclosed by the second step portion 28 and abut against the side wall of the second step portion 28 and the step surface of the step portion 26 facing the collection outlet 22; optionally, the thickness of the first sealing ring 27a can be less than the difference between the extension distance of the second step portion 28 and the first flow channel 24a in the axial direction of the cylinder 20.

[0185] The second sealing ring 27b may have a third flow channel 24c and a flange 27b1 on one side along its thickness direction. The third flow channel 24c penetrates the radial sidewall of the second sealing ring 27b, and the flange 27b1 protrudes radially along the second sealing ring 27b. The side of the second sealing ring 27b away from the flange 27b1 in its thickness direction is configured to be able to be embedded in the outlet enclosed by the second step portion 28, and the outer peripheral wall of the embedded portion abuts against the inner wall of the second step portion 28. The second step portion 28 may also have a limiting support port (not shown), which is located at one end of the second step portion 28 near the outlet 22 of the collection section and is recessed radially into the sidewall of the second step portion 28 along the inner cylinder 20b. The limiting support port and the flange 27b1 can be used for support. The third flow channel 24c is configured to communicate with the first flow channel 24a when the flange 27b1 and the limiting support port are used for limiting support. The thickness of the flange 27b1 is greater than or equal to the recess depth of the limiting support port. The difference between the total thickness of the first sealing ring 27a and the second sealing ring 27b and the thickness of the flange 27b1 is less than the extension distance of the second step portion 28 along the axial direction of the cylinder 20, and the total thickness of the first sealing ring 27a and the second sealing ring 27b is greater than or equal to the extension distance of the second step portion 28 along the axial direction of the cylinder 20. Optionally, it can be less than the total extension distance of the second step portion 28 and the third step portion 29 along the axial direction of the cylinder 20.

[0186] The third sealing ring 27c is configured such that at least a portion of its thickness can be embedded within the outlet enclosed by the third step portion 29, and the outer peripheral wall of the embedded portion abuts against the inner wall of the third step portion 29. Optionally, the thickness of the third sealing ring 27c can be configured such that, after the outer cylinder 20a and inner cylinder 20b are connected and the first sealing ring 27a, second sealing ring 27b, and target material enrichment layer 30 are assembled, one side of its thickness abuts against the inner wall of the outer cylinder 20a, and the other side abuts directly or indirectly against the second sealing ring 27b. Further alternatively, the first thread 25b can extend along the outer peripheral wall of the cylinder where the third step portion 29 is located to the outer peripheral wall of the cylinder where the second step portion 28 is located or the outer peripheral wall of the cylinder where the step portion 26 is located.

[0187] Based on the above scheme, the target material enrichment layer 30 can be sandwiched between the first sealing ring 27a and the second sealing ring 27b. Optionally, the sealing layer 23 can be disposed on one side of the third sealing ring 27c along its thickness direction. For example, it can be connected by bonding or other means so that after the outer cylinder 20a and the inner cylinder 20b are connected, the sealing layer 23 is located on the side of the third sealing ring 27c facing or away from the push rod inlet 21.

[0188] It should be noted that the specific structures of the step portion 26, the second step portion 28, and the third step portion 29 in this application are not particularly limited. Those skilled in the art can flexibly choose according to actual needs, as long as they can be penetrated by the collection unit 11 and cooperate to fix the target material enrichment layer 30. For example, the step portion 26, the second step portion 28, and the third step portion 29 can each be an annular step portion independently, or include multiple sub-step portions spaced circumferentially along the inner cylinder 20b. The following is an example of the step portion 26: Optionally, the step portion 26 can be an annular step portion. Further, the annular step portion can be coaxially arranged with the inner cylinder 20b. Alternatively, the step portion 26 can include multiple sub-step portions, which are spaced circumferentially along the inner cylinder 20b. Each sub-step portion can be independently connected to the inner wall of the inner cylinder 20b in the radial direction of the inner cylinder 20b and extend into the inner cylinder 20b.

[0189] To facilitate understanding of the sample processing device in Scheme 1, please refer to the following: Figure 11 A method for sample processing using the sample processing apparatus of one embodiment of Scheme 1 will be described by way of example.

[0190] refer to Figure 11 The sample processing method includes the following steps:

[0191] ① Transfer the liquid sample to be processed into the cylinder 20;

[0192] ② Press the push rod 10 into the cylinder 20. At this time, due to the downward pressure of the push rod 10, the liquid sample in the cylinder 20 will move downward, pass through the target material enrichment layer 30, and then flow into the first waste liquid chamber 20c. The liquid flow direction is as follows: Figure 11 As indicated by arrow ② in the diagram. During this process, the target substance enrichment layer 30 enriches the target substance in the liquid sample;

[0193] ③ Press the push rod 10 completely into the cylinder 20. At this time, the peeling part 11a of the push rod 10 will peel off the target material enrichment layer 30 containing the target product and take it out of the cylinder 20.

[0194] ④ Break the breakable part 14 of the push rod 10 so that the collection part 11 with the target material enrichment layer 30 can enter the subsequent detection.

[0195] Furthermore, for Scheme 2, one or more of the following additional technical features may also be satisfied:

[0196] In some embodiments of this application, reference is made to Figure 13 It is understood that the push rod 10 may have an open inner cavity 15a. The opening of the open inner cavity 15a may be located on the side of the collection section 11 away from the proximal operation section 13. The target material enrichment layer 30 may be located on the push rod 10 and at the opening of the open inner cavity 15a or inside the open inner cavity 15a. Therefore, after the target material enrichment layer 30 comes into contact with the liquid sample and enriches the target material, it is convenient to push the push rod 10 to penetrate the sealing layer 23 and bring the target material enrichment layer 30 out of the cylinder 20.

[0197] In some embodiments of this application, reference is made to Figure 13 It is understood that a cavity 15 may be provided inside the push rod 10. The cavity 15 may include a second waste liquid chamber 15b extending along the length of the push rod 10 and an open inner cavity 15a. The open inner cavity 15a is located on the side of the second waste liquid chamber away from the proximal operating part 13 and is communicatively connected to the second waste liquid chamber 15b. The opening of the open inner cavity 15a is located on the side of the collection part 11 away from the proximal operating part 13. The target material enrichment layer 30 may be located on the push rod 10 and at the opening of the open inner cavity 15a or inside the open inner cavity 15a. The cavity 15 is configured such that when the push rod 10 is pushed to allow the collection part 11 to penetrate the sealing layer 23, the liquid in the cylinder 20 can enter the cavity 15 through the open inner cavity 15a under pressure. Current sample enrichment devices generally do not have effective integrated waste liquid treatment or real-time monitoring functions. Waste liquid is usually directly discarded, which wastes unused sample resources and may cause unnecessary pollution and risks to the environment. The above setup integrates sample pretreatment, target substance enrichment, and waste liquid collection into a single unit. This not only results in a compact and simple-to-operate device, but also enables contactless transfer of the enriched target substance when the push rod 10 is equipped with a breakable part 14. This reduces the risk of target substance loss and / or cross-contamination during transfer, which could lead to decreased detection accuracy. Consequently, the entire process is efficient, safe, and pollution-free, overcoming the shortcomings of traditional technologies such as complex processing, susceptibility to cross-contamination, and low sample utilization efficiency.

[0198] In some implementations, reference Figure 13 It is understood that the push rod 10 may also be provided with a breakable part 14, which may be located on the outer wall of the open inner cavity 15a and on the side of the target material enrichment layer 30 near the proximal operating part 13. The second waste liquid cavity 15b may be located on the side of the breakable part 14 near the proximal operating part 13. This facilitates the effective separation of waste liquid and target material.

[0199] In some implementations, reference Figure 13It is understood that a one-way valve 15c can be provided between the second waste liquid chamber 15b and the open inner chamber 15a. The one-way valve 15c is adapted to open when the pressure in the open inner chamber 15a is greater than that in the second waste liquid chamber 15b. Thus, when the pressure in the open inner chamber 15a is greater than that in the second waste liquid chamber 15b, the one-way valve 15c can open, and liquid will flow from the open inner chamber 15a into the second waste liquid chamber 15b. When the pressure in the open inner chamber 15a is less than or equal to that in the second waste liquid chamber 15b, the one-way valve 15c will close, and liquid will not be able to flow back from the second waste liquid chamber 15b into the open inner chamber 15a.

[0200] In some implementations, reference Figure 14 It is understood that the second waste liquid chamber 15b may be equipped with a second waste liquid detection device 15d. Taking a chromatography test strip as an example, when liquid enters the waste liquid chamber, the liquid will contact the sample pad of the chromatography test strip to trigger detection. By setting the second waste liquid detection device 15d in the second waste liquid chamber 15b, necessary detection of the waste liquid can be performed before it is discarded, to assess and analyze the waste liquid condition in real time, and / or test the sample condition. This not only improves the overall sample information acquisition rate, but also determines whether the waste liquid needs to be treated before disposal, thereby reducing the potential unnecessary pollution and risks to the environment. It should be noted that the specific type of the second waste liquid detection device 15d is not particularly limited; those skilled in the art can flexibly choose according to actual needs. For example, the second waste liquid detection device 15d may include, but is not limited to, one or more of pH test strips, chromatography test strips, and electrochemical detection devices. Optionally, the electrochemical detection device may include, but is not limited to, an electrochemical electrode.

[0201] In some implementations, reference Figure 14 It is understood that a second viewing window 16 can be provided on the push rod 10, and the second viewing window 16 is configured to display the detection results of the second waste liquid detection device 15d. This allows for a more intuitive understanding of the waste liquid detection results.

[0202] In some implementations, reference Figure 13 It is understood that the second waste liquid chamber 15b may be provided with a second vent 17, and the second vent 17 may be provided with a third waterproof and breathable layer (not shown). This can achieve air pressure balance in the second waste liquid chamber 15b, and further facilitate the transfer of waste liquid into the second waste liquid chamber 15b during the process of pushing the push rod 10 to make the collection part 11 penetrate the sealing layer 23.

[0203] In some embodiments, the target substance enrichment layer 30 can be fixed to the push rod 10 before the liquid sample is processed. Exemplarily, the target substance enrichment layer 30 can be bonded to the push rod 10, welded together, connected via a plastic structure, or connected via a sealing ring. Optionally, the welded connection can be achieved by ultrasonic welding, for example, the edge of the target substance enrichment layer 30 can be ultrasonically welded to the push rod 10.

[0204] In some embodiments, the second waste liquid chamber 15b may be provided with waste liquid absorption material, thereby absorbing excess waste liquid and reducing the risk of waste liquid backflow.

[0205] To facilitate understanding of the sample processing device in Scheme 2, please refer to the following: Figure 15 A method for sample processing using the sample processing apparatus of one embodiment of Scheme 2 will be described by way of example.

[0206] refer to Figure 15 The sample processing method includes the following steps:

[0207] ① Transfer the liquid sample to be processed into the cylinder 20;

[0208] ② Press the push rod 10 into the cylinder 20 so that the target substance enrichment layer 30 inside the push rod 10 comes into contact with the liquid sample, so as to enrich the target substance in the liquid sample; at this time, due to the downward pressure of the push rod 10, the liquid sample inside the cylinder 20 will move towards the open inner cavity 15a of the push rod, pass through the target substance enrichment layer 30, and then flow into the second waste liquid cavity 15b. The liquid flow direction is as follows. Figure 15 As indicated by arrow ② in the middle;

[0209] ③ Press the push rod 10 completely into the cylinder 20. At this time, the collection part 11 of the push rod 10 will carry the target material enrichment layer 30 containing the target product out of the cylinder 20.

[0210] ④ Break the breakable part 14 of the push rod 10 so that the collection part 11 with the target material enrichment layer 30 can enter the subsequent detection.

[0211] Furthermore, Scheme 1 and Scheme 2 can each independently satisfy one or more of the following additional technical features:

[0212] In some embodiments of this application, reference is made to Figure 16It is understood that the push rod 10 may also include a deformable portion 18 extending between the proximal operating portion 13 and the distal sealing portion 12. The outer peripheral wall of the deformable portion 18 has a snap 18a, which protrudes radially along the push rod 10. A groove 20f is provided at the push rod inlet 21 of the cylinder 20. The groove 20f may include a circumferential rotation groove 20f1 and an inclined groove 20f2. The circumferential rotation groove 20f1 is recessed from the inner wall of the cylinder 20 in a direction away from the axis of the cylinder 20, and the inclined groove 20f2 is connected to the circumferential rotation groove 20f1. It is inclined towards the inside of the cylinder and extends towards the outlet 22 of the collection section. The circumferential rotating groove 20f1 is provided with an inlet end 20f3, which is connected to the push rod inlet 21. The circumferential rotating groove 20f1 is configured to rotate and engage with the circumferential rotating groove 20f1 when the push rod 10 is pushed to make the buckle 18a extend from the inlet end 20f3 into the circumferential rotating groove 20f1. The inclined groove 20f2 is configured to press and engage with the buckle 18a when the buckle 18a passes through the inclined groove 20f2 to push the buckle 18a and the push rod 10 downward.

[0213] In actual operation, the target material enrichment layer 30 is mostly made of porous material. When the liquid directly contacts the target material enrichment layer 30 to enrich the target material, a large amount of target material may be enriched on the side of the target material layer 30 facing the push rod inlet 21, while only a small amount of target material may pass through the surface of the target material enrichment layer 30 and enter its interior due to the gravity of the liquid. This poses a risk of low target material enrichment efficiency and / or incomplete enrichment of the target material in the liquid. However, by pushing the push rod 10 downward, pressure can be applied to the liquid to make it pass through the target material enrichment layer 30, allowing more target material to be enriched within the target material enrichment layer 30. Since it takes time for the liquid to pass through the target material enrichment layer 30 under the push of the push rod 10, the downward pressure of the push rod can be controlled by controlling the single advance distance of the push rod 10 within the cylinder 20. This ensures that while the liquid passes through the target material enrichment layer 30, the collection unit 11 does not prematurely contact the target material enrichment layer 30 and puncture the sealing layer 23, thus preventing the target material enrichment operation from failing. By adopting the above-mentioned structure of push rod 10 and cylinder 20, the buckle 18a and the slide 20f cooperate with each other, and the liquid can be discharged by pushing the push rod once or multiple times when enriching the target substance in the liquid (that is, the liquid penetrates the target substance enrichment layer 30), and the single discharge volume of the liquid can be controlled (the discharge volume can be understood as the discharge volume that penetrates the target substance enrichment layer), thereby reducing the risk of problems such as low target substance enrichment efficiency, incomplete target substance enrichment, or target substance enrichment operation failure.

[0214] Therefore, the sample processing device can further achieve one or more of the following technical effects: (1) In the process of enriching the target substance, the buckle 18a located on the deformable part 18 can cooperate with the slide groove 20f to promote the liquid to pass through the target substance enrichment layer and control the quantitative liquid output. For example, the buckle 18a can be used to adjust the depth of the push rod 10 pushed into the cylinder 20, and the circumferential rotation groove 20f1 can be used to suppress the buckle 18a from popping up under the action of air pressure, which is conducive to accurately controlling the travel distance and stopping position of the push rod 10, which is conducive to controlling the liquid output rate of penetrating the target substance enrichment layer and controlling the quantitative liquid output, thereby improving the accuracy of quantitative liquid output. Compared with the existing manual direct liquid dispensing, it is not only simple to operate, but also conducive to the rapid and accurate quantitative dispensing of liquid, improving the stability of repeated operations (such as using multiple sample processing devices of the same specification to perform the same operation) or different personnel operation; (2) simple structure and low cost; (3) no additional measuring tools are required to quickly and accurately complete quantitative dispensing, which is conducive to parallel or control experiments; (4) good dispensing stability and uniformity; (5) easy to mass produce and promote; (6) suitable for widespread promotion and use in multiple industries such as medical, laboratory, biopharmaceutical, chemical and food industries.

[0215] In practice, refer to Figure 17 It is understood that the latch 18a is adapted to extend into or disengage from the circumferential rotating groove 20f1 from the inlet end 20f3, either manually or automatically. Further, refer to... Figure 3 Understood, groove 20f includes inclined groove 20f2 (refer to...) Figure 18 (See detailed diagram G for understanding) Since the inclined groove 20f2 can apply a horizontal force to the right to the buckle 18a and the deformable part 18, the deformable part 18 can deform, so that the buckle 18a can move along the inclined groove 20f2 in a direction perpendicular to the slide groove 20f. Therefore, the movement of the push rod 10 along the axial direction of the cylinder 20 is not restricted.

[0216] It is understood that the deformable part 18 can undergo recoverable or irrecoverable deformation under the action of external force. For example, the deformable part 18 can undergo recoverable or irrecoverable deformation at least under the action of an external force perpendicular to it.

[0217] It is understandable that the circumferential rotation groove 20f1 is a groove that opens towards the inside of the cylinder 20 and extends circumferentially along the cylinder 20 (see reference). Figure 17 Understanding and Figure 18(Understanding) The extension distance of the circumferential rotating groove 20f1 on the inner wall of the cylinder 20 can be flexibly selected according to actual needs. For example, the arc corresponding to the circumferential rotating groove 20f1 can be 1°-359°, such as 1°, 5°, 10°, 20°, 30°, 40°, 50°, 60°, 70°, 80°, 90°, 100°, 110°, 120°, 130°, 140°, 150°, 180°, 210°, 240°, 270°, 300°, 330°, or 359°, or any range of the above values. Optionally, the arc corresponding to the circumferential rotating groove 20f1 can be 10°-150°.

[0218] It is understandable that the groove depth of the circumferential rotating groove 20f1 (i.e., the depth to which the circumferential rotating groove 20f1 is recessed outward from the inner wall of the cylinder 20, refer to...) Figure 17 Understanding and Figure 18 (Understanding) The selection can be flexibly made according to the wall thickness of the cylinder 20, the inner diameter of the cylinder 20, the distance from the outer peripheral wall of the buckle 18a to the axis of the push rod 10, etc., as long as the buckle 18a can rotate with the push rod 10 in the circumferential rotation groove 20f1.

[0219] Understandably, the height of the circumferential rotating groove 20f1 (i.e., the distance between the groove wall of the circumferential rotating groove 20f1 facing the push rod inlet 21 and the groove wall facing the collection section outlet 22) can be flexibly selected based on the extension distance of the latch 18a along the length of the push rod 10 and the required accuracy of the single liquid output. This allows the latch 18a to rotate with the push rod 10 within the circumferential rotating groove 20f1 and prevents the latch 18a from springing up towards the push rod inlet 21 under air pressure. Furthermore, the liquid error caused by the fitting gap between the latch 18a and the circumferential rotating groove 20f1 is within an acceptable range. For example, the height of the circumferential rotating groove 20f1 can be slightly larger than the extension distance of the latch 18a along the length of the push rod 10, such as by 0.02mm-1mm. Optionally, under general precision requirements, the height of the circumferential rotation groove 20f1 can be 0.5mm to 1mm greater than the extension distance of the latch 18a along the length of the push rod 10 (e.g., 0.5mm, 0.6mm, 0.7mm, 0.8mm, 0.9mm, or 1mm, etc.). Under high precision requirements, this value can be set smaller according to the precision calculation results. However, considering the flexible rotation of the push rod 10 within the circumferential rotation groove 20f1, this distance should generally be greater than 0.02mm, such as 0.02mm-0.05mm. For example, it can be greater than 0.02mm, 0.05mm, 0.1mm, 0.2mm, 0.3mm, 0.4mm, or 0.45mm, etc.

[0220] It is understandable that the extension distance of the inclined groove 20f2 in the length direction of the cylinder 20 is not particularly limited. Those skilled in the art can choose flexibly according to actual needs, as long as it can achieve the squeezing fit with the buckle 18a to push the buckle 18a and the push rod 10 downward.

[0221] It is understandable that the number and location of the slide grooves 20f are matched with the overall distribution and number of the buckles 18a along the length and circumferential direction of the push rod 10.

[0222] In some embodiments of this application, the specific structure of the deformable part 18 is not particularly limited, and those skilled in the art can flexibly choose according to actual needs. For example, the deformable part 18 can achieve deformation under external force by setting a deformable column and a buckle, or it can achieve deformation under external force by setting a deformable beam and a buckle. For example, the deformable part may include a deformable column and a buckle provided on the outer peripheral wall of the deformable column. The deformable column can be an elastic column, which can be formed of an elastic material (such as rubber). This facilitates the deformation of the deformable part 18 under compression deformation under external force. For example, refer to... Figure 19 , Figure 20 or Figure 21 It is understood that the deformable part 18 may include a deformable beam 18b and a latch 18a. The deformable beam 18b may extend along the length direction of the push rod 10, and the latch 18a may be provided on the outer peripheral wall of the deformable beam 18b. This facilitates the deformable part 18 to undergo compression deformation under the action of external force, so that the latch 18a can move along the inclined plane or perpendicular to the inclined plane.

[0223] In some embodiments of this application, reference is made to Figure 19 , Figure 20 or Figure 21 It is understood that the distance between the outer peripheral wall of the deformable beam 18b and the axis of the push rod 10 can be less than or equal to the distance between the outer peripheral wall of the distal sealing part 12 and the axis of the push rod 10; the distance between the outer peripheral wall of the latch 18a and the axis of the push rod 10 can be greater than the distance between the outer peripheral wall of the distal sealing part 12 and the axis of the push rod 10. Therefore, this facilitates the push rod 10's advancement into the cylinder 20, and also prevents the push rod 10 from springing up due to air pressure through the cooperation of the latch 18a and the slide groove 20f.

[0224] In some embodiments of this application, the deformable portion 18 may include a snap-fit ​​18a (see reference). Figure 22 (Understanding) or multiple clips 18a (reference) Figure 16 or Figure 23(Understanding). When the deformable part 18 includes multiple latches 18a, the multiple latches 18a can be spaced apart along the circumferential and / or length direction of the push rod 10. The number of times liquid is dispensed quantitatively at a time and the amount of liquid dispensed can be controlled by adjusting the number and spacing of the latches 18a along the length direction of the push rod 10. Furthermore, in the length direction of the push rod 10, after the distance of the latches 18a near the far end sealing part 12 of the push rod 10 is fixed, the number and spacing angle of the latches 18a along the circumferential direction of the push rod 10 can be adjusted to improve the fixing effect of the slide groove 20f on the latches 18a and the push rod 10, and improve the stability of the push rod 10 maintaining a constant height after the latches 18a enter the circumferential rotation groove 20f1.

[0225] In some embodiments of this application, the push rod 10 may include a snap-fit ​​18a (see reference). Figure 22 or Figure 23 (Understanding) or multi-layer snap fastener 18a (reference) Figure 16 (Understanding). When the push rod 10 includes multiple layers of snap fasteners 18a, the multiple layers of snap fasteners 18a can be spaced apart along the length direction of the push rod 10. The number of snap fasteners 18a in each layer can be one or more. Multiple snap fasteners 18a located in the same layer can be spaced apart along the circumference of the push rod 10. In the length direction of the push rod 10, the distance between the snap fasteners 18a located in the same layer and the distal sealing part 12 is equal.

[0226] For example, refer to Figure 22 Understandably, push rod 10 may consist of only one layer of latch 18a, and this layer of latch 18a may consist of only one latch 18a.

[0227] For example, refer to Figure 23 It is understood that the push rod 10 may consist of only one layer of latches 18a, which may include multiple latches 18a spaced apart circumferentially along the push rod 10. This is beneficial to improving the fixing effect of the slide groove 20f on the latches 18a and the push rod 10, and improving the stability of the push rod 10 in maintaining a constant height after the latches 18a enter the circumferential rotation groove 20f1.

[0228] For example, the push rod 10 may include multiple layers of snap fasteners 18a, each layer of snap fasteners 18a may consist of only one snap fastener 18a independently. Thus, the downward movement distance of the push rod 10 within the cylinder 20 can be controlled by adjusting the setting positions of different layers of snap fasteners along the length of the push rod and / or the distance between adjacent layers of snap fasteners 18a, achieving multiple quantitative liquid dispensing. It is understood that the number of snap fasteners 18a layers on the push rod 10 and the spacing between adjacent layers of snap fasteners 18a along the length of the push rod 10 can be flexibly selected according to actual needs. For example, the number of snap fasteners 18a layers can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 layers, etc.

[0229] For example, refer to Figure 16 It is understood that the push rod 10 may include multiple layers of latches 18a, with at least one layer of latches 18a including a plurality of latches 18a spaced apart circumferentially along the push rod 10; or, the multiple layers of latches 18a may each independently include a plurality of latches 18a spaced apart circumferentially along the push rod 10. It is understood that the number of latches 18a in the same layer can be flexibly selected according to actual needs, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.

[0230] In some embodiments of this application, reference is made to Figure 16 It is understood that the push rod 10 may include multiple layers of latches 18a, with multiple latches 18a in each layer. The number of latches 18a in different layers is the same, and the curvature of two adjacent latches 18a in one layer is the same as that of two adjacent latches 18a in another layer. This allows for multiple quantitative dispensing of liquid, facilitates the smooth entry of each layer of latches 18a into the chute 20f, improves the fixing effect of the chute 20f on the latches 18a and the push rod 10, and enhances the stability of the push rod 10 by maintaining a constant height after each layer of latches 18a enters the circumferential rotation groove 20f1.

[0231] Further, refer to Figure 16 It is understood that there can be two clips 18a in each layer. This not only improves the fixing effect of the slide groove 20f on the clips 18a and the push rod 10, but also improves the stability of the push rod 10 after each layer of clips 18a enters the circumferential rotation groove 20f1, and simplifies the structure of the device.

[0232] Further, refer to Figure 16 It is understood that among the snap fasteners 18a located on the same layer, the radius of curvature corresponding to two adjacent snap fasteners 18a can be between 100° and 180°, for example, it can be 100°, 120°, 135°, 150°, 165° or 180°, or it can be any range of the above values. Optionally, the radius of curvature corresponding to two adjacent snap fasteners 18a can be 180°.

[0233] In some embodiments of this application, reference is made to Figure 16 It is understood that the push rod 10 may include two layers of latches 18a, with two latches 18a in each layer, and the arc corresponding to two adjacent latches 18a in one layer is the same as the arc corresponding to two adjacent latches 18a in the other layer.

[0234] It is understandable that in the sample processing device, the number and location of the chute 20f are matched with the number of layers of buckle 18a, the number of buckles 18a in each layer, and their distribution location.

[0235] In some embodiments of this application, reference is made to Figure 19 , Figure 20 or Figure 21 It is understood that the deformable part 18 may include a plurality of deformable beams 18b spaced apart circumferentially along the push rod 10, and each deformable beam 18b may be independently provided with at least one buckle 18a. Therefore, the overall distribution of the buckles 18a on the push rod 10 can be adjusted by controlling the number of deformable beams 18b and the distribution of the buckles 18a on the deformable beams 18b. Optionally, the buckles 18a may be provided in a one-to-one correspondence with the deformable beams 18b, with one buckle 18a provided on each deformable beam 18b.

[0236] In some embodiments of this application, reference is made to Figure 18 It is understood that the distance between the outer peripheral wall of the inlet end 20f3 of the slide groove 20f and the axis of the cylinder 20 can be greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove 20f1 and the axis of the cylinder 20. Optionally, the distance between the outer peripheral wall of the inlet end 20f3 of the slide groove 20f and the axis of the cylinder 20 can be greater than the distance between the outer peripheral wall of the circumferential rotation groove 20f1 and the axis of the cylinder 20, which is more conducive to the buckle 18a extending into the circumferential rotation groove 20f1 through the inlet end 20f3.

[0237] In some embodiments of this application, reference is made to Figure 18 Understanding this, the distance from the connection point between the inclined groove 20f2 of the slide groove 20f and the cylinder 20 near the push rod inlet 21 to the axis of the cylinder 20 gradually decreases in the direction away from the circumferential rotation groove 20f1. This facilitates a gradual increase in the compressive force on the latch 18a and the deformable part 18, enabling the latch 18a to move along the inclined plane or perpendicular to the inclined plane, thus fulfilling the downward pressing requirement of the push rod 10.

[0238] In some embodiments of this application, reference is made to Figure 18 It is understood that the distance from the connection point between the inclined groove 20f2 of the chute 20f and the cylinder 20 near the outlet 22 of the collection section to the axis of the cylinder 20 and the distance from the inner wall of the cylinder 20 to the axis of the cylinder 20 can be the same. This allows the overall inner diameter of the cylinder 20 to remain unchanged, further facilitating the movement of the push rod 10 along the length of the cylinder 20.

[0239] In some embodiments of this application, the inclined groove 20f2 of the chute 20f can be provided on the side of the circumferential rotation groove 20f1 extending circumferentially along the inner wall of the cylinder 20, or it can be provided on the side of the circumferential rotation groove 20f1 facing into the cylinder 20, or it can be provided on the side of the circumferential rotation groove 20f1 facing into the cylinder and close to the collection section outlet 22 and extending away from the circumferential rotation groove 20f1 in the circumference of the cylinder 20.

[0240] In some embodiments of this application, the snap fastener 18a can be a deformable snap fastener. This further facilitates the deformation of the deformable part 18 under the compression of the inclined groove 20f2, thereby fulfilling the downward pressing requirement of the push rod 10.

[0241] In some embodiments of this application, the deformable portion 18 may be an elastically deformable portion. For example, the deformable portion 18 may include an elastically deformable beam and / or an elastic buckle. It should be noted that the specific material of the elastically deformable portion is not particularly limited, and those skilled in the art can flexibly choose according to actual needs, for example, they can choose common elastically deformable materials in the field.

[0242] In some embodiments of this application, reference is made to Figure 21 It is understood that the deformable beam 18b may include a cantilever beam, and the buckle 18a located on the cantilever beam may be provided at the free end of the cantilever beam.

[0243] In some embodiments of this application, reference is made to Figure 19 or Figure 20 It is understood that the deformable beam 18b may include a double-ended fixed beam, and the buckle 18a located on the double-ended fixed beam may be provided between the two ends of the double-ended fixed beam.

[0244] In some embodiments of this application, reference is made to Figure 24 It is understood that a second break 18c may be provided on the side of the double-ended fixed beam near the distal sealing part 12. This facilitates the deformation of the deformable part 18 after use, preventing irreversible deformation. Figure 25 (A schematic diagram showing the deformable beam 18b undergoing irreversible deformation at the second fracture 18c after use) thus prevents the push rod 10 from being reused multiple times.

[0245] In some embodiments of this application, when the cylinder 20 includes an outer cylinder 20a and an inner cylinder 20b, and the outer cylinder 20a is fitted onto the inner cylinder 20b, the sliding groove 20f can be provided on the inner cylinder 20b.

[0246] To facilitate understanding of the specific method of controlling quantitative liquid output when the sample processing device of this application enriches the target substance in the liquid, Scheme 1 is used as an example for illustrative explanation below.

[0247] Specifically, refer to Figure 1 , Figure 3 and Figure 10 To illustrate, let's take a cylindrical structure as an example: "The cylindrical body 20 includes an outer cylindrical body 20a and an inner cylindrical body 20b, with the outer cylindrical body 20a fitted onto the inner cylindrical body 20b, forming a first waste liquid chamber 20c between the outer cylindrical body 20a and the inner cylindrical body 20b, and the side of the inner cylindrical body 20b near the collection section outlet 22 being communicatively connected to the first waste liquid chamber 20c." An aluminum membrane is provided as a sealing layer 23 at the collection section outlet 22, and a permeable membrane is provided as a target substance enrichment layer 30 near the push rod inlet at the connection between the inner cylindrical body 20b and the first waste liquid chamber 20c. (Refer to...) Figure 16 , Figure 17 and Figure 26 For example:

[0248] Step S1: Add the liquid sample to be processed into the cylinder 20 through the push rod inlet 21;

[0249] Step S2: Position push rod 10 according to... Figure 26 Insert it into the cylinder 20 in the direction shown until the first layer of buckle 18a1 enters the inlet end 20f3 of the slide groove 20f and cannot be pressed down further;

[0250] Step S3: Keep the height of push rod 10 unchanged and rotate clockwise so that the first layer of buckle 18a1 is located in the circumferential rotation groove 20f1. At this time, the liquid is subjected to air pressure for the first time, flows through the permeation membrane and enters the first waste liquid chamber 20c. The first layer of buckle 18a1 is restricted by the circumferential rotation groove 20f1 and cannot bounce up in accordance with the air pressure.

[0251] Step S4: Press down further. At this time, the first layer of buckle 18a1 is located at the inclined groove 20f2, and the push rod 10 can be pressed down until the second layer of buckle 18a2 enters the inlet end 20f3 of the slide groove 20f and cannot be pressed down further.

[0252] Step S5: Keep the height of push rod 10 unchanged, rotate clockwise so that the second layer buckle 18a2 is located in the circumferential rotation groove 20f1. At this time, the liquid is subjected to air pressure for the second time, flows through the permeation membrane and enters the first waste liquid chamber 20c. The second layer buckle 18a2 is restricted by the circumferential rotation groove 20f1 and cannot bounce up in accordance with the air pressure.

[0253] Step S6: Press down further. At this point, the second layer of latch 18a2 is located at the inclined groove 20f2. The push rod 10 can be pressed down until it is fully inserted. At this point, the liquid is subjected to air pressure for the third time, passing through the permeation membrane and flowing into the first waste liquid chamber 20c. During this process, the push rod 10 can be continuously and slowly pushed until the collection part 11 penetrates the sealing layer 23, extends out of the cylinder 20, and brings out the target material enrichment layer 30, thereby achieving the enrichment and transfer of the target material.

[0254] It is understandable that when the sample processing device structure of Scheme 2 is adopted and a pusher with a waste gas chamber is used, the same operation can be used to achieve the enrichment and transfer of the target substance.

[0255] In a second aspect of this application, a detection system is provided, including the sample processing device provided in the first aspect of this application, such as the sample processing device of Scheme 1 and / or the sample processing device of Scheme 2 described above. This is beneficial in improving one or more of the following effects: detection efficiency, detection sensitivity, detection accuracy, and reliability of detection results.

[0256] In some embodiments of this application, the detection system may include a detection unit, wherein the sample inlet of the detection unit and the collection outlet of the sample processing device may be configured to cooperate. This further facilitates the detection operation.

[0257] In some embodiments of this application, the detection unit may include, but is not limited to, one or more of a test strip detection device, an electrochemical detection device, and an optical detection device.

[0258] The experimental examples described below are exemplary and are used only to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the experimental examples, they should be performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0259] Experimental test case

[0260] Experiment 1: Detection and testing of urine samples containing E. coli

[0261] Instruments and Materials

[0262] 1. Sample processing device: including a matching push rod 10 and a cylinder 20, as well as a target material enrichment layer 30 and a sealing layer 23, wherein the assembly structure of the push rod 10 and the cylinder is as follows: Figure 16 As shown, the cylinder 20 includes an inner cylinder 20b and an outer cylinder 20a, and the connection and assembly structure of the inner cylinder 20b and the outer cylinder 20a is the same as... Figure 1 As shown, the target material enrichment layer 30 is made of a porous PTFE membrane (micropore size 0.45 μm, Whatman), and the sealing layer 23 is made of an aluminum membrane. A cross-sectional view of the sample processing device near the outlet of the collection section after assembly is shown below. Figure 10 As shown.

[0263] 2. Sample collection tube (Roche, 10mL)

[0264] 3. Microcentrifuge tubes (1.5mL, 0.1mL)

[0265] 4. Centrifuge (Thermofisher)

[0266] 5. Pipettes and filter tips

[0267] 6. Thermofisher

[0268] 7. qPCR instrument (Roche LightCycler 480)

[0269] [Reagents]

[0270] 1. *Escherichia coli* containing a random gene; the random gene sequence is as follows:

[0271] (GGTTGGCGTTTGTAATGAATGCACAGCTTGCGAGTCCTTTTAAATGGACACGACTTTCTCTTTTTTGTATCTGCGTGGTGCTGTGTATGAACGCGGTGGTTTTCGGATCGCTCGCGGCTGTCGGCGACTTCGGTGAATGCATTATGGAGTGCACCTCGATTCGCGGTATGTTGGGCTTCGGCTGGACAATGTTGCTTATTGT GTGTTTTGTTCCGTGTTCACCTTGAGGTGTACTGGTAGTTGTGGGATTGAACTGGTTACTGTTGTTAGTAGTGTGTAGTGCGTTGTCGTGGATGCATCTGTCTTTTGTGCACTTTTGTGTGTGCAGTTGATAGAAGAGGAGTTTGAATTTGGGAAATTAGTGTACTGTGGGTTAATCCTGCGTGTATATCTCAA)(Shanghai Sangon)(SEQ ID NO:1)

[0272] 2. Urine from healthy volunteers

[0273] 3. LAMP reaction system:

[0274] Bst polymerase lyophilized beads (NEB)

[0275] E. coli LAMP Primer Mix (Sangon Biotech (Shanghai) Co., Ltd)

[0276] Primer sequence

[0277] F3 CTGCGTGGTGCTGTGTATG(SEQ ID NO:2)

[0278] B3 ACGCAGGATTAACCCACATG(SEQ ID NO:3)

[0279] FIP

[0280] ACTACCAGTACACCTCAAGGTCGGCTGGACAATGTTG(SEQ ID NO:4)

[0281] BIP

[0282] AGTGCGTTGTCGTGGATGCATCCCAAATTCAAACTCCTCT(SEQ ID NO:5)

[0283] LB GTGCACTTTTGTGTGTGCAGT(SEQ ID NO:6)

[0284] dH2O

[0285] Sample preparation and pretreatment

[0286] 1. Place 10 6 10 5 10,000 or 1,000 copies of E. coli were added to 1 mL of urine from healthy volunteers.

[0287] 2. The urine sample containing E. coli was added to the urine collection tube, with a ratio of approximately 5:2 to the preservation solution in the urine collection tube.

[0288] 3. The eddy current oscillates for 5-10 seconds, followed by instantaneous centrifugal movement.

[0289] 4. Incubate at room temperature for 3 minutes.

[0290] [Enrichment of the analyte]

[0291] refer to Figure 26 :

[0292] S1: Load the 1 mL sample obtained after sample pretreatment into the cylinder 20 of the sample processing device;

[0293] S2: Press the push rod 10 into the cylinder 20 until the first layer of clip 18a1 enters the inlet end 20f3 of the slide groove 20f (reference). Figure 16 , Figure 17 (Understanding) but unable to push it down further.

[0294] S3: Keep the height of push rod 10 constant, and follow the direction from the inlet end 20f3 of the slide groove 20f to the circumferential rotation groove 20f1 (e.g., Figure 26(As shown by the black arrow in S3) Rotate the push rod 10 so that the first layer of buckle 18a1 is located in the circumferential rotation groove 20f1. At this time, the liquid is subjected to air pressure for the first time, passes through the PTFE membrane and enters the first waste liquid chamber 20c. However, the first layer of buckle 18a1 is restricted by the circumferential rotation groove 20f1 and cannot bounce up in accordance with the air pressure.

[0295] S4: Press down further. At this time, the first layer of buckle 18a1 is located at the inclined groove 20f2, and the push rod 10 can be pressed down until the second layer of buckle 18a2 enters the inlet end 20f3 of the slide groove 20f and cannot be pressed down further.

[0296] S5: Keep the height of the push rod unchanged, rotate the push rod 10 in the direction from the inlet end 20f3 of the slide groove 20f to the circumferential rotation groove 20f1, so that the second layer buckle 18a2 is located in the circumferential rotation groove 20f1. At this time, the liquid is subjected to air pressure for the second time, passes through the PTFE membrane and enters the first waste liquid chamber 20c. The second layer buckle 18a2 is restricted by the circumferential rotation groove 20f1 and cannot bounce up in accordance with the air pressure.

[0297] S6: Press down further. At this point, the second layer of latch 18a2 is located at the inclined groove 20f2. The push rod 10 can be pressed down until it is fully inserted. At this point, the liquid is subjected to air pressure for the third time, passing through the PTFE membrane and entering the first waste liquid chamber 20c. During this process, the push rod 10 can be pushed slowly until the peeling part of the push rod peels off the PTFE membrane and pierces the aluminum membrane, bringing the PTFE membrane out of the cylinder 20. At this point, the break point of the breakable part 14 is also located outside the cylinder 20.

[0298] S7: Break the push rod 10 along the fracture point of the breakable part 14, so that the PTFE membrane is transferred with the collection part 11 for inspection.

[0299] [Detection of analytes]

[0300] Loop-mediated isothermal amplification (LAMP) reaction

[0301] 1. Prepare the LAMP reactants shown in Table 1 in the reaction tube:

[0302] Table 1

[0303] concentration Volume (μL) Bst polymerase lyophilized beads - - LAMP Primer Mix 10x 2.5 <![CDATA[dH2O]]> - 17.5 Total - 20

[0304] 2. Place the entire collection section 11 with the attached PTFE membrane into the reaction tube, ensuring that the PTFE membrane is submerged.

[0305] 3. Run the LAMP reaction on a qPCR instrument or hot plate as described below:

[0306] 1. Incubation: 37℃ for 5 minutes

[0307] 2. LAMP: 67℃ for 30 minutes.

[0308]

result

[0309] Figure 27 The results show that this device has an enrichment effect on the test samples, and the target sequence of E. coli can be fully detected. This indicates that the above sample processing device successfully enriched E. coli nucleic acid on the PTFE membrane.

[0310] Experiment 2: Detection and testing of saliva samples containing novel coronavirus pseudovirus

[0311] Instruments and Materials

[0312] 1. Sample processing device: The difference from Experiment 1 is that the target material enrichment layer 30 uses a nylon membrane (micropore size 0.22μm, German filter).

[0313] 2. Saliva collection tube (Sarstedt, Germany)

[0314] 3. Microcentrifuge tubes (1.5mL, 0.1mL)

[0315] 4. Centrifuge (Thermofisher)

[0316] 5. Pipettes and filter tips

[0317] 6. Thermofisher

[0318] 7. qPCR instrument (Roche LightCycler 480)

[0319] [Reagents]

[0320] 1. Novel Coronavirus Pseudovirus (Fubai Ao)

[0321] 2.dH2O

[0322] 3. Saliva from healthy volunteers

[0323] 4. LAMP reaction system:

[0324] Bst polymerase lyophilized beads (NEB)

[0325] LAMP Primer Mix for Novel Coronavirus Test E Gene (Sangon Biotech (Shanghai) Co., Ltd.)

[0326] Primer sequence:

[0327] E1-F3 TGAGTACGAACTTATGTACTCAT(SEQ ID NO:7)

[0328] E1-B3 TTCAGATTTTTAACACGAGAGT(SEQ ID NO:8)

[0329] E1-FIP

[0330] ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG(SEQ ID NO:9)

[0331] E1-BIP

[0332] TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT(SEQ ID NO:10)

[0333] E1-LF CGCTATTAACTATTAACG(SEQ ID NO:11)

[0334] E1-LB GCGCTTCGATTGTGTGCGT(SEQ ID NO:12)

[0335] [Sample preparation and pretreatment]

[0336] 1. Place 10 6 10 5 10,000 or 1,000 copies of the novel coronavirus pseudovirus were mixed into 1 mL of saliva from a healthy volunteer.

[0337] 2. The saliva sample containing the novel coronavirus pseudovirus was added to the saliva collection tube, with a ratio of approximately 4:1 to the preservation solution in the collection tube.

[0338] 3. Eddy oscillation for 5-10 seconds followed by instantaneous centrifugal force.

[0339] 4. Incubate at room temperature for 10 minutes.

[0340] [Enrichment of the analyte]

[0341] The operating steps are the same as in Experiment Example 1.

[0342] [Detection of analytes]

[0343] Loop-mediated isothermal amplification (LAMP) reaction

[0344] 1. Prepare the LAMP reactants shown in Table 2 in the reaction tube:

[0345] Table 2

[0346] concentration Volume (μL) Bst polymerase lyophilized beads - - LAMP Primer Mix 10x 2.5 <![CDATA[dH2O]]> - 17.5 Total - 20

[0347] 2. Place the entire collection section 11 with the attached nylon membrane into the reaction tube, ensuring that the nylon membrane is submerged.

[0348] 3. Run the LAMP reaction on a qPCR instrument or hot plate as described below:

[0349] 1. Incubation: 37℃ for 5 minutes

[0350] 2. LAMP: 67℃ for 30 minutes.

[0351]

result

[0352] Figure 28 The results show that the device has an enrichment effect on the test samples, and nucleic acid amplification can occur normally. This indicates that the novel coronavirus pseudovirus was successfully enriched on the nylon membrane using the above sample processing device.

[0353] Experiment 3 used qPCR to test for oral mycoplasma contamination in the culture medium.

[0354] Instruments and Materials

[0355] 1. Sample processing device: The difference from Experiment 1 is that the target substance enrichment layer 30 uses a polyethersulfone (PES) membrane (micropore size 0.22 μm, Cobot).

[0356] 2. Cell culture flask (Thermofisher)

[0357] 3. Microcentrifuge tubes (1.5mL, 0.1mL)

[0358] 4. Centrifuge (Thermofisher)

[0359] 5. Pipettes and filter tips

[0360] 6. Thermofisher

[0361] 7. qPCR instrument (Roche LightCycler 480)

[0362] [Reagents]

[0363] 1. Oral mycoplasma nucleic acid standard material (Beina Biotechnology, BNCC375819)

[0364] 2. DMEM medium (Thermofisher)

[0365] 3. qPCR reaction system:

[0366] Premix Ex Taq(Probe qPCR)(Takara Bio Inc)

[0367] PCR forward primer TYCTACGGGAGGCAGCAG (SEQ ID NO:13)

[0368] PCR reverse primer CGRCTGCTGGCACATAGTT (SEQ ID NO:14)

[0369] SybrGreen 1x (Beytime, 10000X)

[0370] Sample preparation and pretreatment

[0371] 1. Place 10 5 Oral mycoplasma standard substances with 10,000, 1,000, and 100 copies were added to 1 mL of DMEM culture medium.

[0372] 2. The above-mentioned samples containing oral mycoplasma standard material were heated at 95 degrees Celsius for 5 minutes to lyse.

[0373] 3. The eddy current oscillates for 5-10 seconds and then momentarily centrifuges.

[0374] [Enrichment of the analyte]

[0375] The operating steps are the same as in Experiment Example 1.

[0376] [Detection of analytes]

[0377] 1. Quantitative Polymerase Chain Reaction (qPCR)

[0378] 2. Prepare the qPCR reaction materials as shown in Table 3 in the reaction tube:

[0379] Table 3

[0380] concentration Volume (μL) Premix Ex Taq (Probe qPCR) 2x 10 PCR forward primers 10μM 0.4 PCR reverse primers 10μM 0.4 SybrGreen 10x 2 <![CDATA[dH2O]]> - 2.2 Total - 15

[0381] 3. Cut a 4 mm diameter circle from the PES membrane obtained after the enrichment process and place it in a PCR reaction tube.

[0382] 4. Run the qPCR reaction as follows:

[0383] 1. Denaturation: 95℃ for 30 seconds, 1 cycle.

[0384] 2. PCR: 95℃ for 5 seconds, 60℃ for 30 seconds, 40 cycles

[0385] 3. Cooling: 50℃ for 30 seconds, 1 cycle.

[0386]

result

[0387] Figure 29The results showed that mycoplasma contamination as low as 100 copies could be detected. This indicates that the target substance was successfully enriched on the PES membrane using the above sample processing device.

[0388] Experiment 4 uses an electrochemical detection method to specifically detect the novel coronavirus in upper respiratory tract saliva samples.

[0389] Instruments and Materials

[0390] 1. Sample processing device: The difference from Experiment 1 is that the target material enrichment layer 30 uses a nylon membrane (micropore size 0.22μm, German filter).

[0391] 2. Saliva collection tube (Sarstedt, Germany)

[0392] 3. Microcentrifuge tubes (1.5mL, 0.1mL)

[0393] 4. Centrifuge (Thermofisher)

[0394] 5. Pipettes and filter tips

[0395] 6. Thermofisher

[0396] 7. qPCR instrument (Roche LightCycler 480)

[0397] 8. Constant Potentiometer (Shanghai Chenhua)

[0398] 9. Screen-printed carbon electrodes

[0399] [Reagents]

[0400] 1. Novel coronavirus pseudovirus (Fubai Ao), Staphylococcus aureus

[0401] (ATCC6538), Streptococcus pneumoniae(ATCC49619),

[0402] Streptococcus hemolyticus(CMCC32210), Bordetella pertussis

[0403] (ATCC 9340)

[0404] 2. Saliva from healthy volunteers

[0405] 3. Electrochemical LAMP reaction system containing probes:

[0406] LAMP reaction master mix (NEB)

[0407] LAMP Primer Mix for Novel Coronavirus Testing (Sangon Biotech (Shanghai) Co., Ltd.)

[0408] Primer and probe sequences:

[0409] The LF primers for this experiment are shown below (the rest are the same as in Experiment 2):

[0410] Probe: E1-LF-MB methylene blue-CGCTATTAACTATTAACG

[0411] (SEQ ID NO:15)

[0412] Sample preparation and pretreatment

[0413] 1. Place 10 6 Copy numbers of the novel coronavirus pseudoviruses (Fauci), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), and Bordetella pertussis (ATCC 9340) were added to 1 mL of saliva from healthy volunteers.

[0414] 2. The saliva sample containing the novel coronavirus pseudovirus was added to the saliva collection tube, with a ratio of approximately 4:1 to the preservation solution in the collection tube.

[0415] 3. Eddy oscillation for 5-10 seconds followed by instantaneous centrifugal force.

[0416] 4. Incubate at room temperature for 10 minutes.

[0417] [Enrichment of the analyte]

[0418] The operating steps are the same as in Experiment Example 1.

[0419] [Item to be tested]

[0420] Loop-mediated isothermal amplification (LAMP) reaction

[0421] 1. Prepare the LAMP reactants shown in Table 4 in the reaction tube:

[0422] Table 4

[0423] concentration Volume (μL) LAMP reaction master mix (NEB) 2x 10 LAMP Primer and probe Mix 10x 2.5 <![CDATA[dH2O]]> - 17.5 Total - 20

[0424] 2. Place the entire collection section with the attached nylon membrane into the reaction tube, ensuring that the nylon membrane is submerged.

[0425] 3. Run the electrochemical LAMP reaction on a qPCR instrument or hot plate as described below:

[0426] 1. Incubation: 37℃ for 5 minutes

[0427] 2. LAMP: 67℃ for 30 minutes.

[0428] 4. After the reaction, the reaction solution is dropped onto the screen-printed carbon electrode and tested using differential pulse voltammetry with a potential step of 2.5 mV, a scan rate of 25 mV s⁻¹, and a scan range of -0.5 V to -0.1 V.

[0429]

result

[0430] See results Figure 30 Because the methylene blue (MB) probe is inserted into the double-stranded amplicon during amplification, the steric hindrance between the probe and the amplicon relative to the electrode surface differs, resulting in a difference in current values. As shown in the figure, after enrichment by this device, the pseudovirus of the novel coronavirus produced a lower signal than NTC after electrochemical LAMP amplification; while other bacteria that failed to amplify also showed higher signals, verifying the specificity of this method. This indicates that the target substance was successfully enriched on the nylon membrane using the above sample processing device. Experimental Example 5: Specific detection of the novel coronavirus in upper respiratory tract saliva samples using nucleic acid chromatography test strips.

[0431] Instruments and Materials

[0432] 1. Sample processing device: The difference from Experiment 1 is that the target material enrichment layer 30 uses a polyethersulfone (PES) membrane (micropore size 0.45μm, Cobot).

[0433] 2. Saliva collection tube (Sarstedt, Germany)

[0434] 3. Microcentrifuge tubes (1.5mL, 0.1mL)

[0435] 4. Centrifuge (Thermofisher)

[0436] 5. Pipettes and filter tips

[0437] 6. Thermofisher

[0438] 7. qPCR instrument (Roche LightCycler 480)

[0439] 8. BTE-8 Nucleic Acid Extraction System (Zhuhai Baorui)

[0440] 7. Constant Potentiometer (Shanghai Chenhua)

[0441] 8. Screen-printed carbon electrodes

[0442] [Reagents]

[0443] 1. Novel coronavirus pseudovirus (Fubai Ao), Staphylococcus aureus

[0444] (ATCC6538), Streptococcus pneumoniae(ATCC49619), Streptococcushemolyticus(CMCC32210), Bordetella pertussis

[0445] (ATCC 9340)

[0446] 2. Saliva from healthy volunteers

[0447] 3. Electrochemical LAMP reaction system containing probes:

[0448] LAMP reaction master mix (NEB)

[0449] LAMP Primer Mix for Novel Coronavirus Testing (Sangon Biotech (Shanghai) Co., Ltd.)

[0450] Primer and probe sequences:

[0451] Probes: E1-LF FAM-CGCTATTAACTATTAACG (SEQ ID NO:16) E1-LB Biotin-GCGCTTCGATTGTGTGCGT (SEQ ID NO:17)

[0452] E1-F3, E1-B3, E1-FIP, and E1-BIP are the same as in Experiment Example 2.

[0453] Sample preparation and pretreatment

[0454] 1. Place 10 6 Copy numbers of the novel coronavirus pseudoviruses (Fauci), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), and Bordetella pertussis (ATCC9340) were added to 1 mL of saliva from healthy volunteers.

[0455] 2. The saliva sample containing the novel coronavirus pseudovirus was added to the saliva collection tube, with a ratio of approximately 4:1 to the preservation solution in the collection tube.

[0456] 3. Eddy oscillation for 5-10 seconds followed by instantaneous centrifugal force.

[0457] 4. Incubate at room temperature for 10 minutes.

[0458] [Enrichment of the analyte]

[0459] The operating steps are the same as in Experiment Example 1.

[0460] [Detection of analytes]

[0461] Loop-mediated isothermal amplification (LAMP) reaction

[0462] 1. Prepare the LAMP reactants shown in Table 5 in the reaction tube:

[0463] Table 5

[0464] concentration Volume (μL) LAMP reaction master mix (NEB) 2X 10 LAMP Primer and probe Mix 10x 2.5 <![CDATA[dH2O]]> - 17.5 Total - 20

[0465] 2. Place the entire collection section with the attached polyethersulfone membrane into the reaction tube, ensuring that the membrane is fully immersed.

[0466] 3. Run the LAMP reaction on a qPCR instrument or hot plate as described below:

[0467] 1. Incubation: 37℃ for 5 minutes

[0468] 2. LAMP: 67℃ for 30 minutes.

[0469] 4. After the reaction, add the reaction solution to the nucleic acid chromatography test paper of the FAM-Biotin system. Observe the results after 3 minutes.

[0470]

result

[0471] See Figure 31 As the FAM and biotin probes are inserted into the double-stranded product during amplification, the antibodies on the detection band of the nucleic acid chromatography strip can trap this product, resulting in a red colloidal gold aggregation band. Therefore, a positive amplification product should show two bands on the test strip, while a negative result should show one band. The figure shows that after enrichment with this device, the pseudovirus of the novel coronavirus, after LAMP amplification, exhibits a distinct two-band characteristic on the test strip, proving that this device has the function of enriching the target substance, the pseudovirus of the novel coronavirus.

[0472] The present application has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to it, and it can be combined arbitrarily as needed, which is obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present application fall within the scope of protection claimed in this application.

Claims

1. A sample processing apparatus, comprising: A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part; A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling portion at its end away from the proximal operating section. This peeling portion is configured to peel off the target substance enrichment layer and remove it from the cylinder when the collection section penetrates the sealing layer by pushing the push rod. Alternatively, the target substance enrichment layer is located on the side of the collection section away from the proximal operating section, and is configured to be removed from the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod. The peeling portion has multiple protrusions on the side away from the proximal operating portion, and the multiple protrusions surround a groove on the side facing the proximal operating portion. The groove is suitable for holding the target material enrichment layer.

2. The sample processing apparatus as described in claim 1, wherein, The distance between the outer peripheral wall of the collecting part and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; and / or The sealing layer is a waterproof layer or a first waterproof and breathable layer; and / or, The push rod is also provided with a breakable part, which is located between the collection part and the remote sealing part.

3. The sample processing apparatus as described in claim 1 or 2, wherein, The push rod also has a breakable portion, the distance between the outer peripheral wall of the breakable portion and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the collection portion and the axis of the push rod; and / or The breakable portion includes a first fracture.

4. The sample processing apparatus as described in claim 3, wherein, The push rod is also provided with a breakable portion, which includes one or more first fractures, which are continuously or spaced out along the circumference of the push rod.

5. The sample processing apparatus as described in claim 1 or 4, wherein, The target material enrichment layer is a porous layer; and / or, The target substance enrichment layer includes filter materials and / or adsorption materials; and / or, The target substance enrichment layer is configured to allow the retention of natural biological carriers of nucleic acids in biological samples; and / or, The pore size of the target material enrichment layer is 0.1 μm to 5 μm; and / or, The target substance enrichment layer includes an adsorbent material adapted to specifically bind to the target substance; and / or, The target material enrichment layer includes one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, glass fiber layer, and polyethersulfone (PES) layer; and / or, The distal sealing portion is an elastic sealing portion; and / or, The distal sealing portion includes a sealing ring and / or a piston; and / or, A pressing part is provided on the side of the proximal operating part away from the distal sealing part.

6. The sample processing apparatus as described in claim 1 or 4, wherein, A pressing part is provided on the side of the proximal operating part away from the distal sealing part, and the distance from the outer peripheral wall of the pressing part to the axis of the push rod is greater than the distance from the outer peripheral wall of the distal sealing part to the axis of the push rod.

7. The sample processing apparatus as described in claim 1 or 4, wherein, The protrusion has a pointed tip; and / or, The peeling section includes a plurality of protrusions, with adjacent protrusions spaced apart.

8. The sample processing apparatus as described in claim 1 or 4, wherein, The cylinder includes an outer cylinder and an inner cylinder. The outer cylinder is sleeved on the inner cylinder. A first waste liquid chamber is provided between the outer cylinder and the inner cylinder. The side of the inner cylinder near the outlet of the collection section is connected to the first waste liquid chamber. The inner wall of the inner cylinder is sealed to the distal sealing part, and the inner wall of the inner cylinder is movable relative to the push rod.

9. The sample processing apparatus as described in claim 8, wherein, The inner cylinder is connected to the outer cylinder by thread, snap-fit, riveting, welding, or bonding; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device; and / or, The first waste liquid chamber is provided with a first vent, and a second waterproof and breathable layer is provided at the first vent; and / or, The target substance enrichment layer is disposed within the inner cylinder, and is located at the communication point between the inner cylinder and the first waste liquid chamber, or at the communication point between the inner cylinder and the first waste liquid chamber on the side near the push rod inlet; and / or, The inner cylinder has a flow channel on the side near the outlet of the collection section. The inner cylinder is connected to the first waste liquid chamber through the flow channel. The target substance enrichment layer is disposed in the inner cylinder and is located at the flow channel or on the side of the flow channel near the push rod inlet; and / or, The target material enrichment layer is bonded to the inner cylinder, welded together, connected through a plastic structure, or connected through a sealing ring.

10. The sample processing apparatus as claimed in claim 9, wherein, The inner cylinder has a flow channel on the side near the outlet of the collection section. The flow channel includes a first flow channel, which is located on the side wall of the inner cylinder and penetrates the side wall of the inner cylinder in the radial direction; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, and the outer cylinder is equipped with a first viewing window, which is configured to display the detection result of the first waste liquid detection device; and / or, The first waste liquid chamber is equipped with waste liquid absorption material.

11. The sample processing apparatus as claimed in claim 9, wherein, The inner cylinder is provided with a first flow channel on the side facing the outlet of the collection section, and the outer peripheral wall of the inner cylinder is provided with a first thread on the side facing the outlet of the collection section. The inner peripheral wall of the outer cylinder is provided with a second thread on the side near the outlet of the collection section. The second thread is screwed into the first thread. The first thread and / or the second thread are provided with a second flow channel. The first flow channel is connected to the first waste liquid chamber through the second flow channel.

12. The sample processing apparatus according to any one of claims 9-11, wherein, The inner cylinder has a first flow channel and a stepped portion on the side facing the outlet of the collection section. The stepped portion is connected to the inner wall of the inner cylinder in the radial direction and extends into the inner cylinder. The stepped portion is located on the side of the first flow channel near the push rod inlet and is permeable to the collection section, and satisfies one of the following conditions: (1) The target material enrichment layer is bonded to the step surface of the step portion; (2) The target material enrichment layer is fixed to the step surface of the step portion by a sealing ring; (3) The target material enrichment layer is fixed between the step portion and the first flow channel by a sealing ring. One side of the sealing ring along its thickness direction abuts against the step surface of the step portion, and the other side abuts against the inner wall of the outer cylinder. The sealing ring is provided with a third flow channel penetrating its radial side wall, and the third flow channel is connected to the first flow channel.

13. The sample processing apparatus as claimed in claim 12, wherein, The target material enrichment layer is fixed to the step surface of the step portion or between the step portion and the first flow channel by a sealing ring, and the sealing ring is an elastic sealing ring.

14. The sample processing apparatus as claimed in claim 1 or 13, wherein, The push rod has a cavity, which includes a second waste liquid cavity extending along the length of the push rod and an open inner cavity. The open inner cavity is located on the side of the second waste liquid cavity away from the proximal operating part and is communicative with the second waste liquid cavity. The opening of the open inner cavity is located on the side of the collection part away from the proximal operating part. The target substance enrichment layer is located on the push rod and at the opening of the open inner cavity or inside the open inner cavity.

15. The sample processing apparatus as claimed in claim 14, wherein, A one-way valve is provided between the second waste liquid chamber and the open inner cavity, the one-way valve being adapted to open when the pressure in the open inner cavity is greater than that in the second waste liquid chamber; and / or, The push rod also has a breakable portion, which is located on the outer wall of the open inner cavity and on the side of the target material enrichment layer near the proximal operating part; the second waste liquid chamber is located on the side of the breakable portion near the proximal operating part; and / or The second waste liquid chamber is equipped with a second waste liquid detection device; and / or, The second waste liquid chamber is provided with a second vent, and the second vent is provided with a third waterproof and breathable layer; and / or, The target material enrichment layer is bonded to the push rod, welded together, connected through a plastic structure, or connected through a sealing ring.

16. The sample processing apparatus as claimed in claim 15, wherein, The second waste liquid chamber is equipped with a second waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The second waste liquid chamber is equipped with a second waste liquid detection device, and the push rod is equipped with a second viewing window, which is configured to display the detection result of the second waste liquid detection device; and / or, The second waste liquid chamber is equipped with waste liquid absorption material.

17. The sample processing apparatus as claimed in claim 1 or 16, wherein, The push rod also includes a deformable portion extending between the proximal operating portion and the distal sealing portion, the outer peripheral wall of the deformable portion having a snap fastener that protrudes radially along the push rod; The cylinder has a sliding groove at the push rod inlet, which includes a circumferential rotating groove and an inclined groove. The circumferential rotating groove is recessed from the inner wall of the cylinder in a direction away from the axis of the cylinder. The inclined groove is connected to the circumferential rotating groove and is inclined towards the inside of the cylinder and extends towards the outlet of the collection section. The circumferential rotating groove has an inlet end, which is connected to the push rod inlet. The circumferential rotating groove is configured to rotate and engage with the circumferential rotating groove when the push rod is pushed to extend the buckle from the inlet end into the circumferential rotating groove. The inclined groove is configured to press and engage with the buckle when the buckle passes through the inclined groove to push the buckle and the push rod downward.

18. The sample processing apparatus as claimed in claim 17, wherein, The deformable portion includes a deformable beam and the latch, the deformable beam extending along the length of the push rod, and the latch being disposed on the outer peripheral wall of the deformable beam; and / or The distance between the outer peripheral wall of the inlet end and the axis of the cylinder is greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove and the axis of the cylinder; and / or, The distance from the connection point between the inclined groove near the push rod inlet and the cylinder to the cylinder axis gradually decreases in the direction away from the circumferential rotation groove; and / or, The distance from the connection point between the inclined groove and the cylinder near the outlet of the collecting section to the axis of the cylinder is the same as the distance from the inner wall of the cylinder to the axis of the cylinder; and / or, The height of the circumferential rotating groove is 0.02mm-1mm greater than the extension distance of the buckle along the length of the push rod; and / or, The inclined groove is disposed on one side of the circumferential rotating groove extending circumferentially along the inner wall of the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder and near the outlet of the collecting part and in a direction away from the circumferential rotating groove in the circumferential direction of the cylinder; and / or, The deformable portion includes one or more of the aforementioned latches, with the plurality of latches spaced apart along the circumferential and / or length direction of the push rod; and / or, The deformable part includes one or more of the buckles, and the buckles are deformable buckles.

19. The sample processing apparatus as claimed in claim 18, wherein, The deformable part includes a deformable beam and the buckle: The distance between the outer peripheral wall of the deformable beam and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; the distance between the outer peripheral wall of the buckle and the axis of the push rod is greater than the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; and / or The deformable beam includes a cantilever beam, and the latch located on the cantilever beam is disposed at the free end of the cantilever beam; and / or, The deformable beam includes a double-ended fixed beam, and the buckle located on the double-ended fixed beam is disposed between the two ends of the double-ended fixed beam; and / or The deformable beam includes a double-ended fixed beam, and the double-ended fixed beam has a second break on the side near the distal sealing part.

20. The sample processing apparatus as claimed in claim 18, wherein, The deformable part includes a plurality of deformable beams spaced apart circumferentially along the push rod, and each deformable beam is independently provided with at least one buckle.

21. The sample processing apparatus according to any one of claims 18-20, wherein, The push rod includes one or more of the buckles, the multiple buckles are spaced apart along the length of the push rod, each layer has one or more buckles, and multiple buckles in the same layer are spaced apart along the circumference of the push rod, and the distance between the buckles in the same layer and the distal sealing part is equal along the length of the push rod.

22. The sample processing apparatus as claimed in claim 21, wherein, The push rod includes multiple layers of buckles, with multiple buckles in each layer. The number of buckles in different layers is the same, and the arc of two adjacent buckles in one layer is the same as the arc of two adjacent buckles in the other layer.

23. The sample processing apparatus as claimed in claim 21, wherein, The number of buckles in each layer is two; and / or, Among the buckles located on the same layer, the arc of two adjacent buckles is 100°-180°.

24. A detection system, wherein, The sample processing apparatus includes any one of claims 1-23.

25. The detection system as described in claim 24, wherein, It includes a detection unit, wherein the sample inlet of the detection unit is configured to cooperate with the collection section outlet of the sample processing device.

26. The detection system as described in claim 25, wherein, The detection unit includes one or more of the following: a test strip detection device, an electrochemical detection device, and an optical detection device.

Images