A molecular marker related to egg production at 66 weeks of age of zhongshan duck and application thereof

Abstract

The application discloses a molecular marker related to egg production of Zhongshan duck at 66 weeks of age and application thereof, and belongs to the technical field of poultry breeding. 300 Zhongshan ducks are selected as experimental objects for whole genome association analysis, related data of egg production traits are collected, blood is collected under wings at 66 weeks of age, genomic DNA is extracted, the integrity, purity and concentration of the extracted genomic DNA are detected, resequencing is performed on qualified samples, then whole genome association analysis is performed on the egg production traits of Zhongshan duck, and 105 SNPs significantly related to egg production at 66 weeks of age are obtained. Verification analysis is performed on part of the SNPs, which provides theoretical support for breeding Zhongshan duck breeds related to egg production at 66 weeks of age.

Description

Technical Field

[0001] This invention relates to the field of poultry breeding technology, and in particular to a molecular marker related to the egg production of Zhongshan Ma ducks at 66 weeks of age and its application. Background Technology

[0002] Zhongshan Ma Duck is the only local duck breed in Guangdong Province, possessing both strong environmental adaptability and advantages in meat and egg production. With an annual egg production exceeding 180 eggs, it is an excellent material for studying the egg production traits of local duck breeds in China. Egg production at 66 weeks of age reflects the ability of a duck flock to maintain high production in the later stages of egg production and is a core indicator for measuring the sustainability of poultry egg production and the overall economic benefits throughout the breeding cycle. Egg production at 66 weeks of age directly affects the overall profitability of poultry farming. This trait is influenced by a complex genetic network of multiple genes, including ovarian function decline, stress resistance, and nutritional metabolic efficiency. Traditional phenotypic breeding is time-consuming, costly, and difficult to predict later performance in young ducks.

[0003] Current molecular breeding research in poultry mainly focuses on the time of egg onset or peak egg production, with relatively few molecular markers targeting egg production at 66 weeks of age. Genome-wide association studies (GWAS) suggest that egg production persistence in ducks is significantly associated with genes inhibiting follicle atresia, genes involved in antioxidant pathways, and genes related to lipid metabolism; however, the practical molecular markers for these candidate genes in Zhongshan Ma ducks have not yet been clearly validated. Developing SNPs or InDel molecular markers closely linked to egg production at 66 weeks of age could eliminate individuals with poor egg production persistence, reduce later-stage feeding costs, accelerate the selection process for high-producing lines, and optimize high-quality germplasm resources such as Zhongshan Ma ducks. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to the egg production of Zhongshan Ma ducks at 66 weeks of age and its application, in order to solve the problems existing in the prior art. By conducting genome-wide association analysis of duck genomic DNA, candidate genes and SNP sites that are significantly related to the egg production of Zhongshan Ma ducks are screened out, providing theoretical support for the future breeding of high-quality Ma duck breeds.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] In the first aspect, the present invention provides a molecular marker related to the egg-laying trait of Zhongshan Ma ducks, the nucleotide sequence of which is shown in SEQ ID NO.1, and an A / G mutation is present at the 51st base of the nucleotide sequence shown in SEQ ID NO.1.

[0007] Preferably, the genotype of the molecular marker is AA, GA, or GG.

[0008] Preferably, the egg production trait of the Zhongshan Ma duck is the egg production at 66 weeks of age.

[0009] Preferably, the Zhongshan Ma Duck includes the Wenshi Zhongshan Ma Duck.

[0010] Secondly, the present invention also provides the application of the said molecular marker in any of the following:

[0011] (1) Identify the egg-laying characteristics of Zhongshan Ma Duck;

[0012] (2) Improvement of egg production traits in Zhongshan Ma ducks;

[0013] (3) Screening for new breeds related to the egg-laying traits of Zhongshan Ma Duck;

[0014] (4) Prepare products for detecting molecular markers.

[0015] Thirdly, the present invention also provides the use of the product for detecting the molecular marker in any of the following:

[0016] (1) Identify the egg-laying characteristics of Zhongshan Ma Duck;

[0017] (2) Improvement of egg production traits in Zhongshan Ma ducks;

[0018] (3) Screening for new breeds related to the egg production traits of Zhongshan Ma Duck.

[0019] Fourthly, the present invention also provides a breeding method related to the egg-laying trait of Zhongshan Ma ducks, comprising the following steps:

[0020] Genomic DNA of the duck to be tested is extracted and whole-genome sequencing is performed or the 5kb sequences upstream and downstream of the SNP site of the molecular marker are obtained. The egg production trait of the duck to be tested is determined based on the genotype of the SNP site. Based on the determination results, duck breeds with excellent egg production traits of Zhongshan ducks are selected.

[0021] Preferably, the egg production of Zhongshan Ma ducks at 66 weeks of age is determined by the genotype of the SNP locus of the molecular marker, and the optimal genotype for egg production of Zhongshan Ma ducks at 66 weeks of age is AA.

[0022] Preferably, in the breeding of Zhongshan Ma ducks for egg production traits, duck breeds that retain the AA genotype for egg production traits are selected.

[0023] The present invention discloses the following technical effects:

[0024] This invention selects the Wenshi Zhongshan Ma duck egg production phenotypic phenotype for genome-wide association analysis. By selecting these traits, single nucleotide polymorphisms that are significantly associated with egg production traits are identified. The results show that 105 SNPs that are significantly associated with egg production at 66 weeks of age were detected.

[0025] This invention takes the Chr14:8208635 locus as an example to analyze its association with egg production at 66 weeks of age. The results show that the Chr14:8208635 locus is significantly associated with egg production at 66 weeks of age, and the egg production at 66 weeks of age of the AA genotype population is significantly greater than that of the GA and GG genotypes (P<0.01). The phenotypic differences between the GA and GG genotypes are extremely significant (P<0.01).

[0026] This invention has identified key genes and signaling pathways that affect egg production traits in poultry, revealing the underlying genetic mechanisms. It fills the gap in genome-wide association studies of egg production in Zhongshan Ma ducks and provides theoretical support for the breeding of new high-quality duck breeds. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Image of genomic DNA stock solution on 1% agarose gel electrophoresis;

[0029] Figure 2 Manhattan plot of genome-wide association analysis results for egg production at 66 weeks of age;

[0030] Figure 3 The results of the QQ graph showing the egg production at 66 weeks of age. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] SEQ ID NO.1: 5'-ACAGGACACAGGGCTGAGGTCTGCGCATGATTTATTTCTTTTGGC TTCAG[A / G]AATCCCGTGTATGAAAGCTTCAAAGAACAGACTTTAGGAATGGAGTCACT-3';

[0037] In this context, the bases in parentheses and bolded represent mutation sites.

[0038] Example 1

[0039] 1. Laboratory animals

[0040] The experimental animals used were Zhongshan Muscovy ducks from Yuncheng Wenshi Co., Ltd. in Yunfu City, Guangdong Province. The ducks were cage-raised until they reached 66 weeks of age, and managed according to the farm's feeding procedures. The duck house was kept well-ventilated, and the ambient temperature, humidity, and lighting were suitable. Routine immunizations and disease prevention were carried out.

[0041] 2. Sample collection and processing

[0042] When the ducks reached 66 weeks of age, 300 male ducks were randomly selected from the caged and housed group for blood collection under their wings. 1 mL of blood was drawn with a syringe, injected into a blood collection tube containing heparin sodium, and mixed to prevent blood clotting. The individual wing number was marked on the blood collection tube, and then stored in a -80℃ refrigerator.

[0043] 3. Experimental Methods

[0044] 3.1 Phenotypic Data Determination

[0045] Egg production data of individual Zhongshan Ma ducks at 66 weeks of age were recorded during the experiment.

[0046] 3.2 Extraction and Detection of Genomic DNA

[0047] DNA was extracted from blood samples using magnetic beads. The concentration of DNA samples was measured using a Qubit quantitative PCR instrument; the integrity of the DNA samples was checked by 1% agarose gel electrophoresis, and samples that passed quality control were used for library preparation. DNA samples were fragmented using dsDNA fragmentase, the restriction ends were repaired, and an A base was added to the 3' end. The effectiveness of DNA fragmentation was assessed by 2% agarose gel electrophoresis; samples with a clear bright band at 300-500 bp were used for subsequent reactions. Sequencing adapters were ligated to the fragmented DNA using ligase, and the ligation products were purified using magnetic beads. The concentration of the purified products was measured using a Qubit quantitative PCR instrument, and samples with acceptable concentrations were used for subsequent reactions. The ligation products were amplified using PCR, and fragments were screened using magnetic beads. The library concentration of the screened products was measured using a Qubit quantitative PCR instrument, fragment size was determined by 2% agarose gel electrophoresis, and the fragment size was verified using a Qsep400 bioanalyzer. The linear library was denatured into single strands and then circularized. Uncircularized linear DNA molecules were digested to obtain a single-stranded circular library. The concentration of the single-stranded circular library was measured using a Qubit quantitative PCR instrument; if the concentration was within acceptable limits, subsequent reactions were performed. The single-stranded circular DNA molecules replicated via rolling circle replication, forming a DNA nanosphere (DNB) containing more than 300 copies. The DNB concentration was measured using a Qubit quantitative PCR instrument; if the concentration was within acceptable limits, subsequent reactions were performed. The DNB was loaded into a sequencing chip using the MGIDL-T7 loading device, and sequencing was performed using a combined probe-anchored polymerization technique.

[0048] 3.3 Sequencing Data Quality Control and Analysis Process

[0049] The raw image data files obtained from high-throughput sequencing are converted into sequencing reads through basecalling analysis. The results are stored in FASTQ (fq) file format. Each FASTQ file contains the name of the sequencing read, its base sequence, and its corresponding sequencing quality information. FASTP is used for quality control of the data, filtering low-quality reads. Reads with a quality value of Q ≤ 20 accounting for more than 50% of the total bases are removed; adapter fragments are removed; reads with too many N bases are filtered out, including reads containing more than 5 Ns; and reads shorter than 100 bytes are filtered out. Sentieon was used to align and detect variants in the processed data. Reads were aligned to the corresponding species reference genome (reference genome species: Anasplatyrhynchos, reference genome: GCF_003850225.1_IASCAAS_PekingDuck_PBH1.5_genomic.fna), ordered by position, and marked as duplicate reads. Variant sites were detected for each sample, and the gVCF of each sample was obtained. Joint-calling was performed using Sentieon to jointly analyze the gVCF of all samples, obtaining the variant results for each individual in the population. To ensure the accuracy of SNPs and INDELs, preliminary hard filtering was performed on the SNPs and INDEL sites obtained after joint analysis. The hard filtering criteria for SNPs were QD<2.0||QUAL<30.0||FS>60.0||MQ<40.0||SOR>3.0||MQRankSum<-12.5||ReadPosRankSum<-8.0; the hard filtering criteria for INDELs were QD<2.0||FS>200.0||QUAL<30.0||ReadPosRankSum<-20.0.

[0050] 4. Data processing and statistical analysis

[0051] 4.1 Descriptive statistical analysis of egg production-related traits

[0052] The collected egg production data at 66 weeks of age were initially organized using Excel, and outliers were removed according to the μ±3σ principle. Descriptive statistical analysis was performed on the data using R software. The results of the analysis include sample size, mean, standard deviation, and coefficient of variation.

[0053] 4.2 Genome-wide association analysis

[0054] The samples were sent to Huazhi Biotechnology Co., Ltd. for genome-wide association analysis. In order to screen for genes or molecular markers related to egg production traits across the entire genome, this invention performed low-coverage sequencing (10×) on 300 samples that passed quality testing.

[0055] Genome-wide association analysis (GWA) was performed using a mixed linear model (MLM) combining phenotypic and genotypic data to identify Special National Product (SNP) pairs associated with egg production at 66 weeks of age in Zhongshan Ma ducks. Considering both fixed factors (SNP effects) and random effects (inter-individual kinship), the statistical model is as follows:

[0056] This invention is based on developed high-density molecular marker data, and the mixed linear model formula is as follows:

[0057] Y = SNP + Q(or PCs) + Kinship + e;

[0058] Wherein, SNP is the SNP genotype to be tested; Q or PCs are the fixed effects of population structure; Kinship is the kinship matrix; and e is the residual.

[0059] 4.3 Group Stratification

[0060] Population stratification refers to the difference in allele frequencies due to different ancestors. It has been proven to be a confounding factor and may lead to many false positive results. Therefore, when conducting association analysis on the egg production of Zhongshan Ma ducks, a Quantile-Quantile plot is drawn to determine whether there is bias and stratification of the sample population in the association analysis.

[0061] 4.4 Gene annotation of significant SNPs

[0062] After obtaining significant SNPs from genome-wide association analysis, genes within 5kb upstream and downstream of the SNPs were extracted and annotated based on the reference genome.

[0063] 5. Results and Analysis

[0064] 5.1 Genomic DNA Detection Results

[0065] Genomic DNA extracted from 300 samples was subjected to quality testing using agarose gel electrophoresis. Some genomic DNA test results are shown below. Figure 1 As shown, the electrophoresis wells must be clean and uncontaminated, the main band must be clear, and there must be no tailing. Additionally, DNA purity must be measured at 1.6. <OD 260 / OD 280 <2.0, 1.8 <OD 260 / OD 230<2.1. Genomic DNA testing results must simultaneously meet the above requirements before library construction can proceed. Unqualified samples must be discarded or DNA extracted again. Of all samples tested in this invention, 300 met the requirements.

[0066] 5.2 Sequencing data quality control and alignment results with the reference genome

[0067] The sequencing data quality control results are shown in Table 1. Base type distribution detection was mainly used to check for AT and CG segregation, which may originate from sequencing or library construction. Significant segregation can affect subsequent analysis. The average percentage of G and C bases in the sample (GC(%)) was 42.01%, the average percentage of bases with a quality value greater than or equal to 20 (Q20(%)) was 98.76%, and the average percentage of bases with a quality value greater than or equal to 30 (Q30(%)) was 96.18%. The alignment efficiency between the sample genomic DNA and the reference genomic DNA was above 98%, averaging 98.61%, indicating that the library construction and sequencing of this sample were normal.

[0068] Table 1. Evaluation Statistics and Comparison of Sample Sequencing Data

[0069]

[0070] Note: Clean_Reads: Number of filtered reads; Clean_Base: Number of filtered bases, calculated by multiplying the number of Clean_Reads by the sequence length.

[0071] 5.3 Statistical analysis of SNP detection results between sample and reference genome

[0072] In the variant detection analysis, 20,012,707 SNPs were obtained after hard filtering. Then, the number and proportion of each genotype in each sample were analyzed. The results are shown in Table 2, with a detection rate of 95%.

[0073] Table 2. Statistical analysis of SNP detection results between the genome and the reference genome.

[0074]

[0075] Note: homozygosis (RR): number of homozygous SNPs consistent with the reference genome; homozygosis (AA): number of homozygous SNPs different from the reference genome; heterozygous SNPs (RA): number of heterozygous SNPs; missing: number of loci whose genotypes were not detected; ratio (detection): detection rate.

[0076] 5.4 Descriptive statistical analysis results of egg production traits

[0077] The results of the descriptive statistical analysis of egg production traits are shown in Table 3. The analysis revealed that a total of 300 ducks (all females) were tested. The average egg production of Zhongshan Ma ducks at 66 weeks of age was 236.79, with a coefficient of variation of 18.79%.

[0078] Table 3. Descriptive statistical analysis of fetal volume at 66 weeks of age.

[0079]

[0080] 5.5 Results of Genome-wide Association Analysis

[0081] Genome-wide association analysis (GWAS) was performed using the R package rMVP (YinLetal.2021). Three computational models were used: General Linear Model (GLM), Mixed Linear Model (MLM), and FarmCPU model. Principal components were added as covariates to the models for calibration. GWAS was performed on the egg production trait of 300 Muscovy ducks (300 ducks meeting quality requirements after genomic DNA extraction). Significantly associated SNPs with egg production at 66 weeks of age were identified across the entire genome. The SNP molecular markers were located at the duck reference genome GCF_003850225.1_IASCAAS_PekingDuck_PBH1.5_genomic.fna.

[0082] 5.5.1 Genome-wide association analysis results of egg production at 166 weeks of age

[0083] Table 4 shows the partial results of the genome-wide association analysis of egg production at 66 weeks of age, illustrating the results using -log 10 (p)>5 represents the SNPs that were significantly correlated with egg production at 66 weeks of age, selected based on the criteria. The corresponding Manhattan plot is shown below. Figure 2 As shown, 105 SNPs were significantly associated with egg production at 66 weeks of age, located on chromosomes Chr1, Chr2, Chr3, Chr4, Chr5, Chr7, Chr9, Chr11, Chr12, Chr13, Chr14, Chr15, Chr18, Chr21, Chr22, Chr28, Chr29, and ChrZ.

[0084] Table 4. Partial results of genome-wide association analysis of fetal numbers at 66 weeks of gestation.

[0085]

[0086] Note: CHROM: chromosome; Allele: allele.

[0087] 5.6 Group Stratification Assessment Results

[0088] Significant SNP loci were found in egg production at 66 weeks of age, as shown in the QQ plot. Figure 3 As shown, the horizontal axis represents the expected value, and the vertical axis represents the observed value. The thin line in the graph represents the 45° line, which is the prediction threshold. The yellow area represents the 95% confidence interval of the scatter plot. The greater the distance between the SNP and the solid line, the stronger the association. Figure 3 As can be seen, most of the sites in the lower left corner of the graph are on the diagonal, indicating that the model selection is reasonable. The sites in the upper right corner that extend beyond the diagonal and confidence interval represent the target trait with high significance. This suggests that there is no population stratification in the experimental population.

[0089] 5.7 Gene annotation of SNPs that are significantly associated at the whole genome level

[0090] GWAS analysis identified 105 SNPs that were significantly correlated with egg production at 66 weeks of age, located on chromosomes Chr1, Chr2, Chr3, Chr4, Chr5, Chr7, Chr9, Chr11, Chr12, Chr13, Chr14, Chr15, Chr18, Chr21, Chr22, Chr28, Chr29, and ChrZ. Preliminary gene annotation of these loci was performed using NCBI and Ensembl, and the results are shown in Table 5.

[0091] Table 5. Annotation results of genome-wide association analysis of egg production at 66 weeks of age (partial).

[0092]

[0093]

[0094] 5.8 Association analysis between significant loci and egg production traits

[0095] Association analysis of genotype with egg production phenotype at 66 weeks of age was performed using SPSS software. The results showed that there were three genotypes (AA, GA, and GG) at the Chr14:8208635 locus in the Zhongshan Ma duck population. The egg production at 66 weeks of age of the AA genotype population was higher than that of the GA and GG populations, and the egg production at 66 weeks of age of the AA genotype population was significantly higher than that of the GA and GG genotypes (P<0.01). The phenotypes of the GA and GG genotypes were significantly different (P<0.01).

[0096] Table 6 shows the SNPs that were significantly associated with egg production traits at 66 weeks of age.

[0097]

[0098] Note: Different letters in the superscript indicate significant differences; uppercase letters indicate a significance level of P<0.01; ** indicates a significance level of P<0.01.

[0099] The above results also show that the SNP marker at the Chr14:8208635 locus provided by this invention indicates that ducks with the AA genotype have a higher egg production rate at 66 weeks of age, ducks with the GA genotype have a higher egg production rate at 66 weeks of age, and ducks with the GG genotype have a lower egg production rate at 66 weeks of age. Therefore, selecting the AA genotype for egg production at 66 weeks of age in the breeding of Zhongshan ducks can improve breeding efficiency and quickly select duck breeds with excellent egg production traits.

[0100] Genotyping of egg production at 66 weeks of age was performed using the SNP locus Chr14:8208635 provided above, retaining duck breeds with the AA genotype at 66 weeks of age, thus providing a new molecular marker for screening egg production traits in ducks.

[0101] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a molecular marker associated with the egg-laying trait of Zhongshan Ma Duck in any of the following: (1) Identify the egg-laying characteristics of Zhongshan Ma Duck; (2) Improvement of egg production traits in Zhongshan Ma ducks; (3) Screening for new breeds related to the egg-laying traits of Zhongshan Ma Duck; The SNP site of the molecular marker is located at base 8208635 on chromosome 14 of the duck reference genome, where an A / G mutation exists; the duck reference genome is GCF_003850225.1_IASCAAS_PekingDuck_PBH1.5_genomic.fna; The egg production trait of Zhongshan Ma ducks is the egg production at 66 weeks of age.

2. The application according to claim 1, characterized in that, The genotype of the molecular marker is AA, GA, or GG.

3. Application of products that detect molecular markers related to egg production traits in Zhongshan Ma ducks in any of the following: (1) Identify the egg-laying characteristics of Zhongshan Ma Duck; (2) Improvement of egg production traits in Zhongshan Ma ducks; (3) Screening for new breeds related to the egg-laying traits of Zhongshan Ma Duck; The SNP site of the molecular marker is located at base 8208635 on chromosome 14 of the duck reference genome, where an A / G mutation exists; the duck reference genome is GCF_003850225.1_IASCAAS_PekingDuck_PBH1.5_genomic.fna; The egg production trait of Zhongshan Ma ducks is the egg production at 66 weeks of age.

4. The application according to claim 3, characterized in that, The genotype of the molecular marker is AA, GA, or GG.

5. A breeding method related to the egg production trait of Zhongshan Ma Duck, characterized in that, Includes the following steps: Extract genomic DNA from the duck to be tested, perform whole-genome sequencing or obtain 5kb sequences upstream and downstream of the SNP site of the molecular marker described in any one of claims 1-4, determine the egg production trait of the duck to be tested based on the genotype of the SNP site, and select duck breeds with excellent egg production traits based on the determination results. The SNP site is located at base 8208635 on chromosome 14 of the duck reference genome, and an A / G mutation exists at this site; the duck reference genome is GCF_003850225.1_IASCAAS_PekingDuck_PBH1.5_genomic.fna; The egg production trait of Zhongshan Ma ducks is the egg production at 66 weeks of age.

6. The breeding method according to claim 5, characterized in that, The egg production of Zhongshan Ma ducks at 66 weeks of age was determined by using the genotype of the SNP locus. The optimal genotype for egg production of Zhongshan Ma ducks at 66 weeks of age was AA.

7. The breeding method according to claim 6, characterized in that, In the breeding of egg production traits of Zhongshan Ma ducks, duck breeds with the AA genotype for egg production traits are retained.

Images