Detection device and detection system
By designing a detection device with clamping, sealing, cutting, and testing mechanisms, and utilizing phase change materials and heating components to achieve precise temperature control and automatic mixing of liquids, the problems of liquid evaporation loss and low degree of automation in traditional detection devices are solved, thereby improving the stability and ease of use of the detection results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- FLEX DIAGNOSTICS LTD
- Filing Date
- 2025-06-12
- Publication Date
- 2026-07-21
AI Technical Summary
Traditional detection devices struggle to achieve a high degree of airtightness during the reaction process, leading to liquid evaporation losses and unstable detection results. Furthermore, their low level of automation affects the accuracy and high-throughput applications of the detection.
A detection device was designed, comprising a clamping mechanism, a sealing mechanism, a cutting mechanism, and a detection mechanism. It utilizes phase change materials and heating components to achieve precise temperature control and automatic mixing of liquids, reducing evaporation loss, and achieves automatic liquid conduction through the cutting mechanism.
It improves the stability and accuracy of test results, reduces the risk of liquid evaporation and cross-reaction, and enhances the ease of operation and high-throughput application of the test.
Smart Images

Figure CN120891184B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of analytical testing, and more specifically, it relates to testing devices and testing systems. Background Technology
[0002] With the increasing demand for testing in modern medicine, biochemistry, environmental science, food safety, and other fields, various testing methods are becoming increasingly sophisticated, automated, and integrated. Among these methods, temperature-controlled reactions of reagent liquids are frequently involved (especially nucleic acid amplification, enzymatic reactions, or antigen-antibody binding reactions). Precise and reliable temperature control and strict sealing are fundamental requirements. Fluctuations in temperature and sealing during the reaction process can severely affect the volume stability and component accuracy of the reaction solution, thereby impacting the stability and accuracy of the overall test results.
[0003] Currently, traditional reagent kits or reaction systems used for nucleic acid amplification, enzymatic reactions, or immunoassay typically take the form of disposable reaction tubes or microplates, which are sealed with caps or membranes. While caps or sealing membranes can prevent spillage and evaporation of the reaction solution to some extent, conventional methods cannot achieve complete airtightness due to limitations in the reaction chamber structure or sealing design challenges. This is especially true when the reaction system needs to maintain a high reaction temperature for an extended period (e.g., polymerase chain reaction PCR or isothermal nucleic acid amplification reactions). In such cases, moisture or volatile components in the reaction system inevitably evaporate and are lost. This not only leads to changes in the concentration of reaction components and a reduction in reaction volume but may also increase the variability in results between repeated tests, thereby reducing the stability and accuracy of the assay.
[0004] Furthermore, in some detection techniques, the reaction solution needs to be mixed with other reagents or detection components after the reaction is completed to further complete subsequent detection and analysis. This mixing of liquids often requires opening the reaction chamber or manual operation. During opening, there is a serious risk of liquid evaporation, reagent volatilization, or external contamination, as well as cross-reactions. Manual operation further reduces the degree of automation, affecting the simplicity of operation and the high-throughput application of detection.
[0005] Therefore, the industry urgently needs a detection device with excellent sealing performance, capable of precise temperature control and avoiding liquid evaporation loss, and capable of automatically realizing liquid conduction and mixing after the reaction is completed. Summary of the Invention
[0006] In a first aspect of this application, a detection device is provided, comprising: A clamping mechanism, wherein a heating chamber is provided inside the clamping mechanism, a first through mounting port is provided at the top of the heating chamber, and a heating component is provided in the heating chamber; A sealing mechanism is located below the clamping mechanism. The sealing mechanism includes a through hole that extends through the sealing mechanism in a first direction. The through hole cooperates with the first mounting port to accommodate a liquid-containing tube. The inner wall of the liquid-containing tube near the port is provided with a phase change material. A cutting mechanism, located within the through hole, configured to contact and cut the liquid-containing tube when the clamping mechanism is pressed down along the first direction; and The detection mechanism is located on the side of the cutting mechanism away from the clamping mechanism and is sealed to the sealing mechanism.
[0007] The detection device of this application has at least one of the following technical effects: 1. The detection device of this application can reduce the evaporation loss of the liquid in the liquid-containing tube when heating the liquid-containing tube, thereby improving the stability and accuracy of the detection results; 2. The detection device of this application can reduce the risk of liquid evaporation, reagent volatilization, or external contamination, as well as cross-reaction, that may be caused by transferring the liquid container during the detection process, thereby improving the stability and accuracy of the detection results. 3. The detection device of this application can improve the ease of operation and the high-throughput application of detection.
[0008] In a second aspect of this application, a detection system is provided, including the detection device described in the first aspect of this application.
[0009] As a non-limiting example, this application provides the following implementation scheme: 1. A detection device, comprising: A clamping mechanism, wherein a heating chamber is provided inside the clamping mechanism, a first through mounting port is provided at the top of the heating chamber, and a heating component is provided in the heating chamber; A sealing mechanism is located below the clamping mechanism. The sealing mechanism includes a through hole that extends through the sealing mechanism in a first direction. The through hole cooperates with the first mounting port to accommodate a liquid-containing tube. The inner wall of the liquid-containing tube near the port is provided with a phase change material. A cutting mechanism, located within the through hole, configured to contact and cut the liquid-containing tube when the clamping mechanism is pressed down along the first direction; and The detection mechanism is located on the side of the cutting mechanism away from the clamping mechanism and is sealed to the sealing mechanism.
[0010] 2. The detection device according to embodiment 1, wherein a second mounting port is provided on the first side wall of the heating chamber, and the heating component is detachably disposed in the second mounting port.
[0011] 3. The detection device according to embodiment 2, wherein the heating component is configured to heat the phase change material in the liquid-containing tube when it is inserted into the second mounting port.
[0012] 4. The detection device according to any one of the embodiments 1-3, wherein the side wall of the heating chamber is further provided with a through groove extending along the first direction, the sealing mechanism is provided with a guide post extending along the first direction, the through groove and the guide post are correspondingly arranged and adapted to be embedded in the through groove when the clamping mechanism is pressed down along the first direction.
[0013] 5. The detection device according to embodiment 4, wherein the guide post is disposed on the side of the sealing mechanism away from the second mounting port.
[0014] 6. The detection device according to any one of the embodiments 1-5, wherein an elastic support component is provided at the upper end of the through hole.
[0015] 7. The detection device according to any one of the embodiments 1-6, wherein a first elastic sealing ring is provided at the upper end of the through hole, and a support component is provided on the first elastic sealing ring.
[0016] 8. The detection device according to any one of embodiments 1-7, wherein the heating chamber further includes a second sidewall and a third sidewall disposed opposite to each other, the second sidewall and / or the third sidewall being provided with a first groove, the first groove extending through at least a portion of the second sidewall and / or the third sidewall from the side of the clamping mechanism near the sealing mechanism along the first direction.
[0017] 9. The detection device according to embodiment 8, wherein the sealing mechanism further includes a limiting block, the limiting block being disposed corresponding to the first groove and adapted to be embedded in the first groove when the clamping mechanism is pressed down along the first direction.
[0018] 10. The detection device according to embodiment 8 or 9, wherein the first groove is provided on both the second sidewall and the third sidewall.
[0019] 11. The detection device according to any one of embodiments 1-10, wherein the side wall of the sealing mechanism is further provided with buckles spaced apart along the first direction, the bottom of the side wall of the clamping mechanism forms a first flange facing the interior of the clamping mechanism, and the buckles are configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism when the clamping mechanism is pressed down along the first direction.
[0020] 12. The detection device according to embodiment 11, wherein the latch includes a first latch and a second latch, the first latch is located above the second latch, the first latch is configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism when the clamping mechanism is pressed down along the first direction to the bottom of the liquid-filled tube and contacts the cutting mechanism, the first latch is configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism, and the second latch is configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism after the clamping mechanism is pressed down along the first direction to the bottom of the liquid-filled tube and cut by the cutting mechanism.
[0021] 13. The detection device according to embodiment 12, wherein the side wall of the sealing mechanism is provided with a plurality of first buckles and / or a plurality of second buckles.
[0022] 14. The detection device according to any one of embodiments 9-13, wherein the limiting block includes a first limiting block and a second limiting block spaced apart along the first direction, the first limiting block is disposed above the second limiting block, the first limiting block is configured to be embedded in the first groove when the clamping mechanism is not pressed down, and the second limiting block is configured to be embedded in the first groove along with the first limiting block when the clamping mechanism is pressed down along the first direction.
[0023] 15. The detection device according to embodiment 14, wherein the sealing mechanism further includes a support mechanism, the support mechanism being detachably disposed between the first limiting block and the second limiting block, and the support mechanism being configured to support the lower end of the clamping mechanism when the clamping mechanism is not pressed down.
[0024] 16. The detection device according to any one of the embodiments 1-15, wherein the clamping mechanism further includes an observation port.
[0025] 17. The detection device according to any one of the embodiments 1-16, wherein the melting point of the phase change material is 40℃-120℃.
[0026] 18. The detection device according to any one of embodiments 1-17, wherein the top of the heating chamber is provided with one or more of the first mounting ports.
[0027] 19. The detection device according to any one of embodiments 1-18, wherein the sealing mechanism includes a first sealing part and a second sealing part, the through hole is provided in the first sealing part, the second sealing part is connected to one end of the first sealing part away from the second mounting port, and the detection mechanism extends from the first sealing part to the second sealing part.
[0028] 20. The detection device according to embodiment 19, wherein the second sealing part is provided with an observation window.
[0029] 21. The detection device according to embodiment 19 or 20, wherein the guide post is disposed on the first sealing part near the second sealing part.
[0030] 22. The detection device according to any one of the embodiments 1-21, wherein the detection mechanism is provided with a squeezing component, the squeezing component is configured to squeeze the liquid-holding tube to deform and discharge liquid after the clamping mechanism is pressed down along the first direction to the bottom of the liquid-holding tube and cut by the cutting mechanism.
[0031] 23. The detection device according to embodiment 22, wherein the extrusion assembly is located directly below the cutting mechanism.
[0032] 24. The detection device according to any one of embodiments 1-23, wherein the detection mechanism includes a detection module, and the detection module includes one or more of a test strip detection module, an electrochemical detection module, and an optical detection module.
[0033] 25. A detection system comprising the detection device according to any one of embodiments 1-24.
[0034] 26. The detection system according to embodiment 25 further includes a sample processing device connected to the detection device.
[0035] 27. The detection system according to embodiment 26, wherein the sample processing device comprises: A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part; A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling section at its end away from the proximal operating section. The peeling section is configured to peel off the target substance enrichment layer and carry it out of the cylinder when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device. Alternatively, the target substance enrichment layer is disposed on the side of the collection section away from the proximal operating section, and is configured to be carried out of the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device.
[0036] 28. The detection system according to embodiment 27, wherein the distance between the outer peripheral wall of the acquisition part and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; and / or, The sealing layer is a waterproof layer or a first waterproof and breathable layer; and / or, The push rod is also provided with a breakable part, which is located between the collection part and the remote sealing part.
[0037] 29. The detection system according to embodiment 27 or 28, wherein the push rod further comprises a breakable portion, and the distance between the outer peripheral wall of the breakable portion and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the collection portion and the axis of the push rod; and / or, The breakable portion includes a first fracture.
[0038] 30. The detection system according to embodiment 28 or 29, wherein the breakable portion includes one or more first fractures, the first fractures being continuously or intermittently arranged along the circumference of the push rod.
[0039] 31. The detection system according to any one of embodiments 27-30, wherein the target material enrichment layer is a porous layer; and / or, The target substance enrichment layer includes filter materials and / or adsorption materials; and / or, The target substance enrichment layer is configured to allow the retention of natural biological carriers of nucleic acids in biological samples; and / or, The pore size of the target material enrichment layer is 0.1 μm to 5 μm; and / or, The target substance enrichment layer includes an adsorbent material adapted to specifically bind to the target substance; and / or, The target material enrichment layer includes one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polyethersulfone (PES) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, and glass fiber layer; and / or, The distal sealing portion is an elastic sealing portion; and / or, The distal sealing portion includes a sealing ring and / or a piston; and / or, A pressing part is provided on the side of the proximal operating part away from the distal sealing part.
[0040] 32. The detection system according to any one of embodiments 27-31, wherein a pressing part is provided on the side of the proximal operating part away from the distal sealing part, and the distance from the outer peripheral wall of the pressing part to the axis of the push rod is greater than the distance from the outer peripheral wall of the distal sealing part to the axis of the push rod.
[0041] 33. The detection system according to any one of embodiments 27-32, wherein the end of the acquisition unit away from the proximal operating unit is provided with a peeling part, and the side of the peeling part away from the proximal operating unit is provided with a protrusion.
[0042] 34. The detection system according to embodiment 33, wherein the protrusion has a pointed tip; and / or, The peeling portion includes a plurality of protrusions, with adjacent protrusions spaced apart, and / or, The plurality of protrusions enclose a second groove on one side facing the proximal operating portion, the second groove being adapted to hold the target material enrichment layer.
[0043] 35. The detection system according to any one of embodiments 27-34, wherein the cylinder includes an outer cylinder and an inner cylinder, the outer cylinder is sleeved on the inner cylinder, a first waste liquid chamber is provided between the outer cylinder and the inner cylinder, the side of the inner cylinder near the outlet of the collection part is communicatively connected to the first waste liquid chamber, the inner wall of the inner cylinder is sealably fitted with the distal sealing part, and the inner wall of the inner cylinder is relatively movable with the push rod.
[0044] 36. The detection system according to implementation plan 35, wherein, The inner cylinder is connected to the outer cylinder by thread, snap-fit, riveting, welding, or bonding; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device; and / or, The first waste liquid chamber is provided with a first vent, and a second waterproof and breathable layer is provided at the first vent; and / or, The target substance enrichment layer is disposed within the inner cylinder, and is located at the communication point between the inner cylinder and the first waste liquid chamber, or at the communication point between the inner cylinder and the first waste liquid chamber on the side near the push rod inlet; and / or, The inner cylinder has a flow channel on the side near the outlet of the collection section. The inner cylinder is connected to the first waste liquid chamber through the flow channel. The target substance enrichment layer is disposed in the inner cylinder and is located at the flow channel or on the side of the flow channel near the push rod inlet; and / or, The target material enrichment layer is bonded to the inner cylinder, welded together, connected through a plastic structure, or connected through a sealing ring.
[0045] 37. The detection system according to embodiment 35 or 36, wherein the inner cylinder is provided with a flow channel on the side near the outlet of the collection section, the flow channel including a first flow channel, the first flow channel being disposed on the side wall of the inner cylinder and penetrating the side wall of the inner cylinder in the radial direction of the inner cylinder; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, and the outer cylinder is equipped with a first viewing window, which is configured to display the detection result of the first waste liquid detection device; and / or, The first waste liquid chamber is equipped with waste liquid absorption material.
[0046] 38. The detection system according to any one of embodiments 35-37, wherein the inner cylinder is provided with a first flow channel on the side facing the outlet of the collection section, the outer peripheral wall of the inner cylinder is provided with a first thread on the side facing the outlet of the collection section, the inner peripheral wall of the outer cylinder is provided with a second thread on the side near the outlet of the collection section, the second thread is screwed into the first thread, the first thread and / or the second thread are provided with a second flow channel, and the first flow channel is connected to the first waste liquid chamber through the second flow channel.
[0047] 39. The detection system according to any one of embodiments 35-38, wherein the inner cylinder is provided with a first flow channel and a stepped portion on the side facing the outlet of the collection section, the stepped portion is connected to the inner wall of the inner cylinder in the radial direction of the inner cylinder and extends into the inner cylinder, the stepped portion is located on the side of the first flow channel near the push rod inlet and is permeable to the collection section, and satisfies one of the following conditions: (1) The target material enrichment layer is bonded to the step surface of the step portion; (2) The target material enrichment layer is fixed to the step surface of the step portion by a sealing ring; (3) The target material enrichment layer is fixed between the step portion and the first flow channel by a sealing ring. One side of the sealing ring along its thickness direction abuts against the step surface of the step portion, and the other side abuts against the inner wall of the outer cylinder. The sealing ring is provided with a third flow channel penetrating its radial side wall, and the third flow channel is connected to the first flow channel.
[0048] 40. The detection system according to any one of embodiments 35-39, wherein the target material enrichment layer is fixed to the step surface of the step portion or between the step portion and the first flow channel by a sealing ring, and the sealing ring is a second elastic sealing ring.
[0049] 41. The detection system according to any one of embodiments 27-32, wherein the push rod has a cavity, the cavity includes a second waste liquid cavity extending along the length direction of the push rod and an open inner cavity, the open inner cavity is located on the side of the second waste liquid cavity away from the proximal operating part and is communicatively connected to the second waste liquid cavity, the opening of the open inner cavity is located on the side of the collection part away from the proximal operating part, and the target substance enrichment layer is located on the push rod and at the opening of the open inner cavity or is located in the open inner cavity.
[0050] 42. The detection system according to embodiment 41, wherein a one-way valve is provided between the second waste liquid chamber and the open inner cavity, the one-way valve being adapted to open when the pressure in the open inner cavity is greater than that in the second waste liquid chamber; and / or, The push rod also has a breakable portion, which is located on the outer wall of the open inner cavity and on the side of the target material enrichment layer near the proximal operating part; the second waste liquid chamber is located on the side of the breakable portion near the proximal operating part; and / or The second waste liquid chamber is equipped with a second waste liquid detection device; and / or, The second waste liquid chamber is provided with a second vent, and the second vent is provided with a third waterproof and breathable layer; and / or, The target material enrichment layer is bonded to the push rod, welded together, connected through a plastic structure, or connected through a sealing ring.
[0051] 43. The detection system according to embodiment 41 or 42, wherein the second waste liquid chamber is provided with a second waste liquid detection device, the second waste liquid detection device comprising one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The second waste liquid chamber is equipped with a second waste liquid detection device, and the push rod is equipped with a second viewing window, which is configured to display the detection result of the second waste liquid detection device; and / or, The second waste liquid chamber is equipped with waste liquid absorption material.
[0052] 44. The detection system according to any one of embodiments 27-43, wherein, The push rod also includes a deformable portion extending between the proximal operating portion and the distal sealing portion, the outer peripheral wall of the deformable portion having a third latch that protrudes radially along the push rod; The cylinder has a sliding groove at the push rod inlet, which includes a circumferential rotating groove and an inclined groove. The circumferential rotating groove is recessed from the inner wall of the cylinder in a direction away from the axis of the cylinder. The inclined groove is connected to the circumferential rotating groove and is inclined towards the inside of the cylinder and extends towards the outlet of the collection section. The circumferential rotating groove has an inlet end, which is connected to the push rod inlet. The circumferential rotating groove is configured to rotate and engage with the circumferential rotating groove when the push rod is pushed to extend the third buckle from the inlet end into the circumferential rotating groove. The inclined groove is configured to press and engage with the third buckle when the third buckle passes through the inclined groove to push the third buckle and the push rod downward.
[0053] 45. The detection system according to embodiment 44, wherein the deformable part includes a deformable beam and the third buckle, the deformable beam extends along the length direction of the push rod, and the third buckle is disposed on the outer peripheral wall of the deformable beam; and / or, The distance between the outer peripheral wall of the inlet end and the axis of the cylinder is greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove and the axis of the cylinder; and / or, The distance from the connection point between the inclined groove near the push rod inlet and the cylinder to the cylinder axis gradually decreases in the direction away from the circumferential rotation groove; and / or, The distance from the connection point between the inclined groove and the cylinder near the outlet of the collecting section to the axis of the cylinder is the same as the distance from the inner wall of the cylinder to the axis of the cylinder; and / or, The height of the circumferential rotating groove is 0.02mm-1mm greater than the extension distance of the third buckle along the length of the push rod; and / or, The inclined groove is disposed on one side of the circumferential rotating groove extending circumferentially along the inner wall of the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder and near the outlet of the collecting part and in a direction away from the circumferential rotating groove in the circumferential direction of the cylinder; and / or, The deformable portion includes one or more of the third latches, and the plurality of third latches are spaced apart along the circumferential and / or length direction of the push rod; and / or, The third buckle is a deformable buckle.
[0054] 46. The detection system according to embodiment 44 or 45, wherein the deformable part includes a deformable beam and the third buckle: The distance between the outer peripheral wall of the deformable beam and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing portion and the axis of the push rod; the distance between the outer peripheral wall of the third buckle and the axis of the push rod is greater than the distance between the outer peripheral wall of the distal sealing portion and the axis of the push rod; and / or The deformable beam includes a cantilever beam, and the third latch located on the cantilever beam is disposed at the free end of the cantilever beam; and / or, The deformable beam includes a double-ended fixed beam, and the third buckle located on the double-ended fixed beam is disposed between the two ends of the double-ended fixed beam; and / or The deformable beam includes a double-ended fixed beam, and the double-ended fixed beam has a second break on the side near the distal sealing part.
[0055] 47. The detection system according to any one of embodiments 44-46, wherein the deformable part includes a plurality of deformable beams spaced apart circumferentially along the push rod, and each deformable beam is independently provided with at least one third buckle.
[0056] 48. The detection system according to any one of embodiments 44-47, wherein the push rod includes one or more third buckles, the multiple third buckles are spaced apart along the length direction of the push rod, each layer has one or more third buckles, the multiple third buckles located in the same layer are spaced apart along the circumferential direction of the push rod, and the distance between the third buckles located in the same layer and the distal sealing portion is equal in the length direction of the push rod.
[0057] 49. The detection system according to any one of embodiments 44-48, wherein the push rod includes multiple layers of the third buckle, each layer has multiple third buckles, the number of third buckles in different layers is the same, and in two adjacent layers of the third buckles, the arc corresponding to two adjacent third buckles in one layer is the same as the arc corresponding to two adjacent third buckles in the other layer.
[0058] 50. The detection system according to any one of embodiments 44-49, wherein the number of the third clips in each layer is two; and / or, Among the third buckles located on the same layer, the arc of two adjacent third buckles is 100°-180°. Attached Figure Description
[0059] Figure 1 This is a schematic diagram of the detection device in one embodiment of the present application, in the state where the heating component is not inserted.
[0060] Figure 2 This is a schematic diagram of the detection device in the state of inserting the heating component in one embodiment of this application.
[0061] Figure 3 This is a schematic diagram of the clamping mechanism in the detection device according to one embodiment of this application.
[0062] Figure 4 This is a schematic diagram of the unassembled state of the detection device in one embodiment of this application.
[0063] Figure 5 This is a schematic diagram of the assembled detection device according to one embodiment of this application.
[0064] Figure 6 This is a schematic diagram showing the position and structure of the heating component and the liquid-holding pipe in the detection device according to one embodiment of this application.
[0065] Figure 7 for Figure 6 The left view.
[0066] Figure 8 for Figure 7 Cross-sectional structural diagrams of AA under different states.
[0067] Figure 9 This is a schematic diagram of the liquid-filled tube and phase change material of the detection device in several embodiments of this application.
[0068] Figure 10 This is a schematic diagram of the detection device according to another embodiment of this application.
[0069] Figure 11 for Figure 10 A schematic diagram of the disassembled detection device.
[0070] Figure 12 This is a schematic diagram of the structure of the detection device according to one embodiment of this application.
[0071] Figure 13 for Figure 12 BB cross-section structural diagram.
[0072] Figure 14 This is a schematic diagram of the sealing mechanism in the detection device according to one embodiment of this application.
[0073] Figure 15 This is a schematic diagram of the sealing mechanism in a detection device according to another embodiment of this application.
[0074] Figure 16 This is a schematic diagram of the detection device according to another embodiment of this application.
[0075] Figure 17 This is a schematic diagram of the structure of the detection device according to one embodiment of this application.
[0076] Figure 18 for Figure 17 Structural diagram of the CC section.
[0077] Figure 19 This is a schematic diagram of the structure of the detection device according to one embodiment of this application.
[0078] Figure 20 for Figure 19 DD cross-sectional structural diagram.
[0079] Figure 21 This is a partial structural diagram of the detection mechanism in the detection device according to one embodiment of this application.
[0080] Figure 22 This is a partial structural diagram of the detection device according to one embodiment of this application.
[0081] Figure 23 This is a schematic diagram of the structure of the test strip detection module in the detection device according to one embodiment of this application.
[0082] Figure 24 This is a schematic diagram of the electrochemical detection module in the detection device according to one embodiment of this application.
[0083] Figure 25 This is a schematic diagram of the structure of the optical detection module in the detection device according to one embodiment of this application.
[0084] Figure 26 This is a schematic diagram of the structure of the optical detection component in the detection device according to an embodiment of this application.
[0085] Figure 27 This is a schematic diagram of the structure of the detection mechanism in the detection device according to one embodiment of this application.
[0086] Figure 28 This is a schematic diagram of the structure of the detection mechanism in a detection device according to another embodiment of this application.
[0087] Figure 29 This is a schematic diagram of the sample processing device according to one embodiment of the present application, wherein... Figure 29 In Figure 'a', the sample processing device is an assembly drawing, and in Figure 'b', it is an exploded view of the sample processing device.
[0088] Figure 30 This is a schematic diagram of the structure of the cylinder in one embodiment of this application.
[0089] Figure 31 This is a schematic diagram of the internal structure of the cylinder in one embodiment of this application.
[0090] Figure 32 This is a schematic diagram of the internal structure of the cylinder in another embodiment of this application.
[0091] Figure 33 This is a schematic diagram of the push rod in one embodiment of this application, wherein... Figure 33 In the image, b is a magnified view of a local region B within a.
[0092] Figure 34 This is a schematic diagram of the structure of the cylinder in another embodiment of this application, wherein... Figure 34 In the diagram, 'a' is an isometric view of the cylinder, and 'b' is an exploded view of 'a'.
[0093] Figure 35 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in one embodiment of this application.
[0094] Figure 36 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in another embodiment of this application.
[0095] Figure 37 This is a schematic diagram of the assembly of the inner cylinder and the outer cylinder or a partial structure within the cylinder in another embodiment of this application.
[0096] Figure 38 For this application Figure 37 This is a structural diagram after rotating the structure by an appropriate angle in the direction indicated by the arrow.
[0097] Figure 39 This is a schematic diagram illustrating the movement and disassembly of a liquid sample processed using the sample processing device according to one embodiment of this application. Figure 39 ① is a schematic diagram of adding a sample; ② is a schematic diagram of pressing down the push rod; ③ is a schematic diagram of pushing the push rod out of the cylinder; ④ is a schematic diagram of breaking the push rod to obtain the collection part.
[0098] Figure 40 This is a schematic diagram of the sample processing apparatus in another embodiment of this application, wherein... Figure 40 In Figure 'a', the sample processing device is an assembly drawing, and in Figure 'b', it is an exploded view of the sample processing device.
[0099] Figure 41 This is a schematic diagram of the push rod in another embodiment of this application, wherein... Figure 41In diagram b, we see a cross-sectional view along the DD direction in diagram a. Diagram c1 is an enlarged view of a local region E in diagram b after the check valve is opened. Diagram c2 is an enlarged view of a local region E in diagram b when the check valve is not opened.
[0100] Figure 42 This is a schematic diagram of the assembly structure of the push rod in another embodiment of this application, wherein... Figure 42 In the diagram, 'a' is an isometric view of the push rod, and 'b' is an exploded view of 'a'.
[0101] Figure 43 This is a schematic diagram illustrating the movement and disassembly of a liquid sample being processed using the sample processing apparatus according to another embodiment of this application. Figure 43 ① is a schematic diagram of adding a sample; ② is a schematic diagram of pressing down the push rod; ③ is a schematic diagram of pushing the push rod out of the cylinder; ④ is a schematic diagram of breaking the push rod to obtain the collection part.
[0102] Figure 44 This is a schematic diagram of the sample processing device in another embodiment of this application, wherein... Figure 44 In diagram a, the push rod is inserted into the cylinder, and in diagram b, the push rod is not inserted into the cylinder.
[0103] Figure 45 This is a schematic diagram of the structure of the cylinder and the slide groove in one embodiment of this application, wherein... Figure 45 In Figure a, it is a schematic diagram of the cylinder structure, and in Figure b, it is an enlarged view of the structure of the sliding groove in a local area of the cylinder shown in Figure a.
[0104] Figure 46 This is a schematic diagram illustrating the matching relationship between the push rod with a latch and the slide groove in a liquid dispensing device according to one embodiment of this application. Figure 46 Figure b is a schematic diagram of the push rod being inserted into the cylinder, and figure a is an enlarged view of a local area G in figure b.
[0105] Figure 47 This is a schematic diagram of the push rod in one embodiment of this application.
[0106] Figure 48 for Figure 32 A schematic diagram of the structure rotated 90° clockwise along the axis of the push rod.
[0107] Figure 49 This is a schematic diagram of the push rod in another embodiment of this application.
[0108] Figure 50 This is a schematic diagram of the push rod in another embodiment of this application. Figure 50 In the diagram, a, b, and c are structural schematic diagrams of the push rod from three different perspectives. b is a schematic diagram of the push rod in a rotating 90° clockwise along the direction of the black arrow. c is a side view of a.
[0109] Figure 51 This is a schematic diagram of the push rod in another embodiment of this application. Figure 51 In the diagram, a, b, and c are structural schematic diagrams of the push rod from three different perspectives. b is a schematic diagram of a rotated 90° clockwise along the axis of the push rod, and c is a side view of a.
[0110] Figure 52 This is a schematic diagram of the push rod having a second break in one embodiment of this application.
[0111] Figure 53 This is a schematic diagram showing the irreversible deformation of the deformable beam at the second fracture point after use, as described in one embodiment of this application.
[0112] Figure 54 This is a step-by-step disassembly diagram of the push rod with two layers of buckles and the cylinder in one embodiment of this application, where the black arrows represent the movement mode of the push rod.
[0113] Figure 55 The results are from the nucleic acid chromatography test strip used in the experimental example.
[0114] Explanation of reference numerals in the attached figures: 10-Clamping mechanism; 11-Heating chamber; 111-Top; 112-First sidewall; 101-First mounting port; 102-Second mounting port; 12-Heating assembly; 113-Second sidewall; 114-Third sidewall; 13-First groove; 103-Through groove; 14-Observation port; 15-First flange; 20-Sealing mechanism; 21-Liquid collection tube; 201-Through hole; 211-Phase change material; 22-Limiting block; 221-First limiting block; 222-Second limiting block; 223-Supporting mechanism; 23-Guide post; 24-Elastic support assembly; 25-First elastic sealing ring; 26-Snap; 261-First snap; 262-Second snap 27-Support assembly; 28-First sealing part; 29-Second sealing part; 291-Observation window; 30-Cutting mechanism; 40-Detection mechanism; 401-Sample inlet; 41-Squeezing assembly; 43-Test strip detection module; 431-Strip fixing device; 432-Test strip; 433-Sample pad; 44-Electrochemical detection module; 441-Electrochemical detection device housing; 442-Electrochemical detection circuit; 45-Optical detection module; 451-Optical detection module fixing device; 452-Optical detection assembly; 453-Liquid sampling tank; 454-Optical detection device inlet; 50-Push rod; 511-Collection part; 511a-Peeling part; 511a1 - Protrusion; 511a2 - Second groove; 512 - Distal sealing part; 513 - Proximal operating part; 513a - Pressing part; 514 - Breakable part; 514a - First fracture; 515 - Cavity; 515a - Open inner cavity; 515b - Second waste liquid chamber; 515c - One-way valve; 515d - Second waste liquid detection device; 516 - Second viewing window; 517 - Second vent; 518 - Deformable part; 518a - Third buckle; 518b - Deformable beam; 518c - Second fracture; 60 - Cylinder; 60a - Outer cylinder; 60b - Inner cylinder; 60c - First waste liquid chamber; 60d - First waste liquid detection device; 6 0e - First viewing window; 620f - Slide groove; 620f1 - Circumferential rotation groove; 620f2 - Inclined groove; 620f3 - Inlet end; 621 - Push rod inlet; 622 - Collection section outlet; 623 - Sealing layer; 624 - Flow channel; 624a - First flow channel; 624b - Second flow channel; 624c - Third flow channel; 625a - Second thread; 625b - First thread; 626 - Stepped section; 627 - Sealing ring; 627a - First sealing ring; 627b - Second sealing ring; 627b1 - Second flange; 627c - Third sealing ring; 628 - Second stepped section; 629 - Third stepped section; 70 - Target material enrichment layer. Detailed Implementation
[0115] The present application will be further described below with reference to specific embodiments. It should be understood that these specific embodiments are for illustrative purposes only and are not intended to limit the scope of the present application.
[0116] In this application, the following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art.
[0117] As used herein, the term "comprising" should be interpreted as inclusive and open-ended, not exclusive. Specifically, when used in the specification and claims, the term "comprising" and its variations mean including the specified features, steps, or components. These terms should not be construed as excluding the presence of other features, steps, or components.
[0118] In this document, the terms "first," "second," "third," and "fourth" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first," "second," "third," or "fourth" may explicitly or implicitly include at least one of that feature. In the description of this application, "multiple" means at least two, such as two, three, etc., unless otherwise explicitly specified.
[0119] In a first aspect of this application, a detection device is provided, with reference to Figure 1-28 It is understood that the detection device includes: a clamping mechanism 10, a sealing mechanism 20, a cutting mechanism 30, and a detection mechanism 40.
[0120] refer to Figure 1-3 The clamping mechanism 10 is provided with a heating chamber 11. The top 111 of the heating chamber 11 is provided with a through first mounting port 101. The heating chamber 11 is provided with a heating component 12.
[0121] It should be noted that the "heating component 12" in this application can be fixed inside the heating cavity 11 or detachably disposed inside the heating cavity 11. When the heating component 12 is fixed inside the heating cavity 11, it is acceptable as long as the structure of the heating component 12 does not affect the pressing process of the clamping mechanism 10. For example, the heating component 12 can be a heating wire or a heating plate. When the heating component 12 is detachably disposed inside the heating cavity 11, in one embodiment of this application, refer to... Figure 1-2 The heating chamber 11 has a second mounting port 102 on its first sidewall 112. For example, the second mounting port 102 may cover part or all of the first sidewall 112. The heating assembly 12 is detachably mounted on the second mounting port 102. For example, the heating assembly 12 may be a U-shaped heating assembly.
[0122] refer to Figure 1-24-5 and 8, the sealing mechanism 20 is located below the clamping mechanism 10. The sealing mechanism 20 includes a through hole 201, which penetrates the sealing mechanism 20 along a first direction. The through hole 201 cooperates with the first mounting port 101 to accommodate the liquid-containing tube 21. The inner wall of the liquid-containing tube 21 near the port is provided with a phase change material 211.
[0123] In some embodiments of this application, the heating assembly 12 is configured to heat the phase change material 211 within the liquid-holding tube 21 when inserted into the second mounting port 102. As an example, see reference... Figure 6-7 The heating assembly 12 has a U-shaped structure. The liquid-holding pipe 21 is located between the U-shaped heating arms of the heating assembly 12. The heating arms are arranged in the upper half of the height of the liquid-holding pipe 21 and are in contact with the pipe wall. The lower half of the height of the liquid-holding pipe 21 is not in contact with or surrounded by the heating arms. When the heating assembly 12 is not turned on (see reference...), Figure 8 In step a), the phase change material 211 inside the liquid-containing pipe 21 is located on the inner wall near the opening of the liquid-containing pipe 21, and the heating component 12 is turned on (see reference). Figure 8 (b) The heating component 12 preferentially heats the phase change material 211 on the side wall of the liquid-containing tube 21, causing it to change from a solid to a liquid state and gradually cover the liquid surface inside the liquid-containing tube 21. Before this coverage is fully formed, the liquid temperature inside the liquid-containing tube 21 is lower than the set reaction temperature, and the evaporation of the liquid surface is minimal. When the phase change material 211 completely melts and covers the liquid surface inside the liquid-containing tube 21 (refer to...) Figure 8 (c) The liquid inside the liquid-containing tube 21 is isolated from the outside environment. At this time, there is no evaporation of the liquid inside the liquid-containing tube 21, thus effectively ensuring that the volume and composition of the liquid inside the liquid-containing tube 21 are not affected by the outside environment. Subsequently, the heat required for the reaction process inside the liquid-containing tube 21 is transferred to the liquid inside the liquid-containing tube 21 by the completely molten phase change material 211, promoting the occurrence of reactions such as nucleic acid amplification or related biochemical reactions. After the reaction is completed, the heating component 12 is removed. The molten phase change material 211 gradually solidifies and returns to a solid state as the temperature of the liquid-containing tube 21 decreases, but it still adheres to the surface of the liquid inside the liquid-containing tube 21 to form a tight sealing layer, continuously preventing the liquid inside the liquid-containing tube 21 from evaporating or the entry of outside gases.
[0124] In some embodiments of this application, the shapes of the liquid-containing tube 21 and the phase change material 211 are not particularly limited. As an example, see reference to Figure 9 The liquid-holding tube 21 may have a pointed bottom (see reference). Figure 9 (a, b, c, and d) or rounded bottom (see reference) Figure 9 (e, f, g, and h), and the phase change material 211 on the inner wall of the liquid-containing tube 21 can be annular ( Figure 9 (a, b, e, and f) or teardrop shape ( Figure 9 (c, d, g, and h).
[0125] In some embodiments of this application, the melting point of the phase change material 211 is 40°C-120°C, such as 40°C, 50°C, 60°C, 70°C, 80°C, 90°C, 100°C, 110°C, 120°C, etc., or can be any range of the above values. As an example, the phase change material 211 includes paraffin wax, beeswax, microcrystalline wax, or polyethylene glycol, etc.
[0126] In some embodiments of this application, reference is made to Figure 3-5 The clamping mechanism 10 may also include an observation port 14, which allows observation of whether the liquid in the liquid-filled tube 21 is at the bottom of the tube and whether there are air bubbles in the tube before the heating component 12 heats the liquid-filled tube 21.
[0127] In some embodiments of this application, the top 111 of the heating cavity 11 may be provided with a first mounting port 101 (see reference). Figure 10-11 One or more first mounting ports 101 can be selected by those skilled in the art according to actual needs. For example, refer to Figure 3 The top 111 of the heating chamber 11 is provided with two first mounting ports 101. For example, a liquid holding tube 21 containing the reaction liquid can be placed in one of the first mounting ports 101, and a liquid holding tube 21 containing the diluent can be placed in the other first mounting port 101, or a liquid holding tube 21 containing the reaction liquid can be placed in both of the first mounting ports 101.
[0128] In some embodiments of this application, reference is made to Figure 1-5 In addition to 10-11, the side wall of the heating chamber 11 is also provided with a through groove 103 extending along the first direction. The sealing mechanism 20 is provided with a guide post 23 extending along the first direction. The through groove 103 and the guide post 23 are correspondingly arranged and adapted to be embedded in the through groove 103 when the clamping mechanism 10 is pressed down along the first direction. As a result, the stability of the clamping mechanism 10 during the pressing process along the first direction can be improved.
[0129] In some embodiments of this application, reference is made to Figure 1 and 4 The guide post 23 is located on the sealing mechanism 20 on the side away from the second mounting port 102.
[0130] refer to Figure 12-13 The cutting mechanism 30 is located within the through hole 201. The cutting mechanism 30 is configured to contact and cut the liquid-filling tube 21 when the clamping mechanism 10 is pressed down in the first direction. In some embodiments of this application, when the heating assembly 12 is detachably provided in the second mounting port 102, the cutting mechanism 30 is configured to contact and cut the liquid-filling tube 21 when the clamping mechanism 10 is pressed down in the first direction after the heating assembly 12 is removed.
[0131] In some embodiments of this application, the material forming the through hole 201 can be a deformable material. After the heating component 12 is used to heat the liquid-containing tube 21 and then the heating component 12 is removed, the clamping mechanism 10 is pressed down in the first direction. The lower end of the liquid-containing tube 21 abuts against the through hole 201 until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, since the liquid-containing tube 21 abuts against the through hole 201, the lower end area of the liquid-containing tube 21 can be sealed to prevent the liquid in the liquid-containing tube 21 from evaporating or being contaminated.
[0132] It should be noted that when the material forming the through hole 201 is a deformable material, those skilled in the art can select the deformable material according to actual needs, such as rubber.
[0133] In some other embodiments of this application, reference is made to Figure 14 The upper end of the through hole 201 of the sealing mechanism 20 is provided with an elastic support component 24. The elastic support component 24 is configured to support and seal the lower end of the liquid-containing tube 21 when the first mounting port 101 cooperates with the through hole 201 to accommodate the liquid-containing tube 21. As an example, after heating the liquid-containing tube 21 with the heating component 12 and then removing the heating component 12, when the clamping mechanism 10 is pressed down in the first direction, the lower end of the liquid-containing tube 21 abuts against the elastic support component 24 until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, since the liquid-containing tube 21 abuts against the elastic support component 24, it can support and seal the lower end area of the liquid-containing tube 21, preventing the liquid in the liquid-containing tube 21 from evaporating or being contaminated.
[0134] It should be noted that those skilled in the art can select the material and shape of the elastic support component 24 according to actual needs. For example, the material can be rubber, and the shape can be ring-shaped.
[0135] In some embodiments of this application, reference is made to Figure 15 A first elastic sealing ring 25 can be provided at the upper end of the through hole 201. A support component 27 is provided on the first elastic sealing ring 25. The orthographic projection of the opening on the first elastic sealing ring 25 in the plane perpendicular to the height of the liquid-holding tube 21 is located inside the orthographic projection of the opening on the support component 27 in the plane perpendicular to the height of the liquid-holding tube 21. The orthographic projection area of the opening on the first elastic sealing ring 25 in the plane perpendicular to the height of the liquid-holding tube 21 is smaller than the orthographic projection area of the opening on the support component 27 in the plane perpendicular to the height of the liquid-holding tube 21. That is, after the heating component 12 is used to heat the liquid-holding tube 21 and then the heating component 12 is removed, and the clamping mechanism 10 is pressed down in the first direction, the lower end of the liquid-holding tube 21 abuts against the first elastic sealing ring 25 until the lower end of the liquid-holding tube 21 contacts the cutting mechanism 30. At this time, due to the action of the first elastic sealing ring 25, the lower end area of the liquid-holding tube 21 can be sealed to prevent the liquid in the liquid-holding tube 21 from evaporating or being contaminated.
[0136] It should be noted that those skilled in the art can select the material of the first elastic sealing ring 25 according to actual needs, such as rubber, and can also select the shape of the first elastic sealing ring 25 according to actual needs. At the same time, the structure of the cutting mechanism 30 in this application is not particularly limited, as long as it can cut the liquid-filled tube 21 when the clamping mechanism 10 is pressed down in the first direction. Those skilled in the art can select the specific structure of the cutting mechanism 30 according to actual needs, such as a blade, a plastic sheet, a glass sheet, etc.
[0137] In some embodiments of this application, reference is made to Figure 1-5 The heating chamber 11 also includes a second sidewall 113 and a third sidewall 114 disposed opposite to each other. A first groove 13 is provided on the second sidewall 113 and / or the third sidewall 114. The first groove 13 extends from the side of the clamping mechanism 10 near the sealing mechanism 20 along a first direction through at least a portion of the second sidewall 113 and / or the third sidewall 114. As an example, both the second sidewall 113 and the third sidewall 114 of the heating chamber 11 are provided with the first groove 13.
[0138] In some embodiments of this application, reference is made to Figure 1-2 In addition to 4-5, the sealing mechanism 20 also includes a limiting block 22. The limiting block 22 is correspondingly provided with the first groove 13 on the second side wall 113 and / or the third side wall 114 of the heating chamber 11 and is adapted to be embedded in the first groove 13 when the clamping mechanism 10 is pressed down in the first direction. That is, when the clamping mechanism 10 is pressed down in the first direction, the clamping mechanism 10 achieves downward pressure in the first direction with the cooperation of the first groove 13 on it and the limiting block 22 of the sealing mechanism 20.
[0139] As an example, the second sidewall 113 and the third sidewall 114 of the heating chamber 11 are each provided with a first groove 13, and the sealing mechanism 20 is provided with a limiting block 22 at a position corresponding to the first groove 13 on the second sidewall 113 and the third sidewall 114. This allows for stable downward pressing of the clamping mechanism 10 along the first direction.
[0140] It should be noted that a first groove 13 can be provided on the second side wall 113 and / or the third side wall 114 of the heating chamber 11, and a limiting block 22 can be provided on the sealing mechanism 20. That is, when the clamping mechanism 10 is pressed down in the first direction, the clamping mechanism 10 achieves downward pressure in the first direction through the cooperation of the first groove 13 on it and the limiting block 22 on the sealing mechanism 20; or a through groove 103 extending in the first direction can be provided on the side wall of the heating chamber 11, and a guide post 23 can be provided on the sealing mechanism 20. That is, when the clamping mechanism 10 is pressed down in the first direction, the clamping mechanism 10 achieves downward pressure in the first direction through the cooperation of the first groove 13 on it and the limiting block 22 on the sealing mechanism 20. With the cooperation of 3, downward pressure is achieved along the first direction; or a first groove 13 is provided on the second side wall 113 and / or the third side wall 114 of the heating chamber 11, a limiting block 22 is provided on the sealing mechanism 20, and a through groove 103 extending along the first direction is provided on the side wall of the heating chamber 11, and a guide post 23 is provided on the sealing mechanism 20. That is, when the clamping mechanism 10 is pressed down along the first direction, the clamping mechanism 10 achieves downward pressure along the first direction through the cooperation of the first groove 13 on it and the upper limit block 22 of the sealing mechanism 20, as well as through the cooperation of the through groove 103 on the clamping mechanism 10 and the guide post 23 on the sealing mechanism 20. It should be noted that those skilled in the art can increase or decrease the number, combination form and position of the limiting block 22 and the guide post 23 according to actual needs.
[0141] In some embodiments of this application, reference is made to Figure 4-5 In addition to 10-13, the sidewall of the sealing mechanism 20 is also provided with latches 26 spaced apart along a first direction. The bottom of the sidewall of the clamping mechanism 10 forms a first flange 15 facing inward towards the clamping mechanism 10. The latches 26 are configured to engage with the first flange 15 to restrict upward movement of the clamping mechanism 10 when the clamping mechanism 10 is pressed down along the first direction. As an example, see reference. Figure 12-13 And 17-18, the buckle 26 includes a first buckle 261 and a second buckle 262, and the first buckle 261 is located above the second buckle 262, see reference. Figure 18 The first latch 261 is configured to engage with the first flange 15 to restrict upward movement of the clamping mechanism 10 when the clamping mechanism 10 is pressed down along the first direction until the bottom of the liquid-filled tube 21 contacts the cutting mechanism 30; Reference Figures 19-20 The second latch 262 is configured to cooperate with the first flange 15 to restrict the upward movement of the clamping mechanism 10 after the clamping mechanism 10 is pressed down along the first direction to the bottom of the liquid-holding tube 21 and cut by the cutting mechanism 30.
[0142] In some embodiments of this application, the sealing mechanism 20 has multiple first latches 261 and / or multiple second latches 262 on its sidewall. For example, each sidewall of the sealing mechanism 20 with a limiting block 22 has two first latches 261 and two second latches 262. The two first latches 261 on the same sidewall of the sealing mechanism 20 are arranged on both sides of the limiting block 22, and the two second latches 262 on the same sidewall of the sealing mechanism 20 are arranged on both sides of the limiting block 22. Preferably, multiple first latches 261 and multiple second latches 262 are provided on both opposite sidewalls of the sealing mechanism 20. Thus, the multiple first latches 261 and / or multiple second latches 262 restrict the upward movement of the clamping mechanism 10, achieve sealing of the bottom end of the liquid-filled tube 21, and reduce the possibility of contamination caused by user misoperation of the liquid-filled tube 21. It should be noted that the purpose of setting the first buckle 261 is to prevent user misoperation. Under the premise of correct operation by the user, whether or not the first buckle 261 is set will not affect the test results and sealing effect.
[0143] In some embodiments of this application, reference is made to Figure 1 , 2 And 16, the limiting block 22 includes a first limiting block 221 and a second limiting block 222 spaced apart along a first direction. The first limiting block 221 is located above the second limiting block 222. The first limiting block 221 is configured to be embedded in the first groove 13 when the clamping mechanism 10 is not pressed down. (Refer to...) Figure 16 The second limiting block 222 is configured to be embedded in the first groove 13 along with the first limiting block 221 when the clamping mechanism 10 is pressed down in the first direction.
[0144] In some embodiments of this application, reference is made to Figure 1-2 The sealing mechanism 20 also includes a support mechanism 223, which is detachably disposed between the first limiting block 221 and the second limiting block 222. The support mechanism 223 is configured to support the lower end of the clamping mechanism 10 when the clamping mechanism 10 is not pressed down. Specifically, the support mechanism 223 can be detached when it is necessary to press the clamping mechanism 10 down in the first direction.
[0145] refer to Figure 4 , 1318 and 20, the detection mechanism 40 is located on the side of the cutting mechanism 30 away from the clamping mechanism 10 and is sealed and connected to the sealing mechanism 20. That is, the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30 located in the through hole 201 of the sealing mechanism 20 to cut the liquid-containing tube 21. The reaction liquid automatically flows into the detection mechanism 40 located below the sealing mechanism 20 to complete the subsequent analysis and detection. As an example, the sealing connection between the detection mechanism 40 and the sealing mechanism 20 can be achieved by filling the gap with glue, sealing ring, or ultrasonic welding, thereby sealing the detection mechanism 40 and preventing sample volatilization or contamination during the detection process, thus improving the stability and accuracy of the detection results.
[0146] In some embodiments of this application, reference is made to Figure 21 The detection mechanism 40 is equipped with a squeezing component 41. The squeezing component 41 is configured to squeeze the liquid-holding mechanism 10 down along the first direction to the bottom of the liquid-holding tube 21 after it is cut by the cutting mechanism 30, so that the liquid-holding tube 21 deforms and liquid is discharged.
[0147] In some specific embodiments of this application, the extrusion assembly 41 is located directly below the cutting mechanism 30. As an example, see [reference needed]. Figure 21 The extrusion component 41 is a protrusion. After the cutting mechanism 30 completes the cutting of the bottom of the liquid-holding tube 21, it continues to press down the clamping mechanism 10, so that the cut part at the bottom of the liquid-holding tube 21 is squeezed by the protrusion, thereby causing the liquid-holding tube 21 to deform and release liquid.
[0148] In some embodiments of this application, reference is made to Figure 22 The sealing mechanism 20 includes a first sealing part 28 and a second sealing part 29. A through hole 201 is provided in the first sealing part 28. The second sealing part 29 is connected to the end of the first sealing part 28 away from the second mounting port 102. The detection mechanism 40 extends from the first sealing part 28 to the second sealing part 29.
[0149] In some embodiments of this application, reference is made to Figure 22 The second sealing part 29 is also provided with an observation window 291, which is set to observe the detection results on the detection mechanism 40 after the liquid-containing tube 21 is squeezed and deformed and liquid is discharged.
[0150] In some embodiments of this application, reference is made to Figure 22 The guide post 23 is located on the first sealing part 28 on the side near the second sealing part 29.
[0151] In some embodiments of this application, reference is made to Figure 23-26 The testing unit 40 may include one or more of the following: a test strip testing module 43, an electrochemical testing module 44, and an optical testing module 45.
[0152] refer to Figure 23 The test strip detection module 43 includes a test strip fixing device 431 and a test strip 432. The test strip 432 is disposed within the test strip fixing device 431, and the squeezing component 41 is disposed within the test strip fixing device 431. For example, when the test strip 432 is a chromatography test strip, two first mounting ports 101 can be provided on the clamping mechanism 10. One first mounting port 101 is used to place the liquid holding tube 21 containing the reaction solution, and the other first mounting port 101 is used to place the liquid holding tube 21 containing the diluent. The sample pad 433 on the chromatography test strip is located directly below the cutting mechanism 30. The test strip fixing device 431 is provided with a squeezing component 41 on the side near the sample pad 433. When the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down, and the squeezing component 41 squeezes the liquid collection tube 21 to release liquid. When the reaction liquid and diluent in the liquid collection tube 21 flow through the sample pad 433, the reaction liquid and diluent will flow along the test strip 432, and the result will be displayed on the display area of the test strip 432.
[0153] refer to Figure 24 The electrochemical detection module 44 includes an electrochemical detection device housing 441 and an electrochemical detection circuit 442. The electrochemical detection circuit 442 is sealed inside the electrochemical detection device housing 441, and the electrochemical detection device housing 441 is provided with a sample inlet 401, which is located directly below the cutting mechanism 30. A squeezing component 41 is provided at the sample inlet 401 of the electrochemical detection device housing 441. After the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down, and the squeezing component 41 squeezes the liquid collection tube 21 to release liquid. The reaction liquid in the liquid collection tube 21 flows out and enters the sample inlet 401, directly contacting the electrode on the electrochemical detection circuit 442 for detection.
[0154] refer to Figure 25-26 The optical detection module 45 includes an optical detection module fixing device 451 and an optical detection component 452. The optical detection component 452 is sealed inside the optical detection module fixing device 451, and the optical detection module fixing device 451 is provided with a sample inlet 401. The sample inlet 401 is located directly below the cutting mechanism 30. The sample inlet 401 of the optical detection module fixing device 451 is provided with a squeezing component 41. After the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down, and the squeezing component 41 squeezes the liquid collection tube 21 to release the liquid. After the reaction liquid flows out, it enters the liquid sampling tank 453 of the optical detection component 452 through the sample inlet 401 for optical sampling. Optical detection device inlets 454 are provided on both sides of the liquid sampling tank 453 to provide detection space for the optical detection equipment.
[0155] In some embodiments of this application, the detection mechanism 40 may include two or three of the following: paper detection module 43, electrochemical detection module 44, and optical detection module 45, and the two or three detection modules may be stacked.
[0156] For example, refer to Figure 27 The test strip 432 in the test strip detection module 43 can be stacked on top of the electrochemical detection module 44. Taking the test strip 432 as an example of a chromatography test strip, the test strip 432 is placed on top of the outer shell 441 of the electrochemical detection device. The electrochemical detection circuit 442 is sealed inside the outer shell 441 of the electrochemical detection device. After the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down, and the squeezing component 41 squeezes the liquid collection tube 21 to release liquid. When the reaction liquid in the liquid collection tube 21 flows through the sample pad 433, a part of the reaction liquid will flow along the test strip 432, and the result will be displayed on the display area of the test strip 432. At the same time, another part of the reaction liquid in the sample pad 433 will seep into the sample inlet 401 of the electrochemical detection module 44 below and contact the electrode on the electrochemical detection circuit 442 for detection. That is, the test strip detection and electrochemical detection of the reaction liquid are realized simultaneously.
[0157] For example, refer to Figure 28 The test strip 432 in the test strip detection module 43 can be stacked on top of the optical detection module 45. Taking the test strip 432 as an example of a chromatographic test strip, the test strip 432 is placed on top of the optical detection module fixing device 451. The optical detection component 452 is sealed inside the optical detection module fixing device 451, and the optical detection module fixing device 451 is provided with a sample inlet 401. When the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down, and the squeezing component 41 squeezes the liquid collection tube 21 to release liquid. When the reaction liquid in the liquid collection tube 21 flows through the sample pad 433, a part of the reaction liquid will flow along the test strip 432, and the result will be displayed on the display area of the test strip 432. At the same time, another part of the reaction liquid in the sample pad 433 will seep into the sample inlet 401 of the optical detection module 45 below and enter the liquid sampling tank 453 of the optical detection component 452 for optical sampling, that is, the test strip detection and optical detection of the reaction liquid are realized simultaneously.
[0158] The detection device of this application has at least the following technical effects: The liquid-containing tube 21 is accommodated by the first mounting port 101 on the clamping mechanism 10 cooperating with the through hole 201 on the sealing mechanism 20. A phase change material 211 is provided on the inner wall of the liquid-containing tube 21 near the port. When the heating assembly 12 is inserted into the second mounting port 102 to heat the liquid-containing tube 21 in the heating chamber 11, the phase change material 211 at the port of the liquid-containing tube 21 melts and covers the liquid surface inside the liquid-containing tube 21, isolating the liquid surface from the outside environment, minimizing the evaporation of the liquid inside the liquid-containing tube 21, and ensuring that the reaction components are not disturbed. After the reaction in the liquid-containing tube 21 is completed, the heating assembly 12 is removed. After the phase change material 211 on the surface of the reaction liquid in the liquid-containing tube 21 re-solidifies, a sealing layer is formed on the liquid surface inside the liquid-containing tube 21. This sealing layer can support the wall of the liquid-containing tube 21, thereby effectively reducing the sealing failure caused by the deformation of the liquid-containing tube 21 wall. Furthermore, during the pressing down of the clamping mechanism 10, the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30 located in the through hole 201 of the sealing mechanism 20, cutting the liquid-containing tube 21. As the clamping mechanism 10 continues to be pressed down in the first direction, the liquid in the liquid-containing tube 21 automatically flows into the detection mechanism 40 located below the sealing mechanism 20 under the action of the squeezing component 41 on the detection mechanism 40. Subsequent analysis and detection are completed in a completely sealed environment. On the one hand, this can reduce the risk of liquid evaporation, reagent volatilization, or external contamination and cross-reaction that may be caused by transferring the liquid-containing tube 21 during the detection process, thereby improving the stability and accuracy of the detection results. On the other hand, the detection device of this application can eliminate the step of transferring the reaction liquid, improving the ease of operation and the high-throughput application of detection.
[0159] For ease of understanding, the operation process of the detection device of this application is described below: In one embodiment of this application, the detection mechanism 40 employs a test strip detection module 43. The test strip in this module 43 is a chromatography test strip card. A phase change material 211 is provided on the wall of the liquid-containing tube 21 near the opening, and an isothermal nucleic acid amplification reaction occurs within the liquid-containing tube 21. First, a clamping mechanism 10 with two first mounting ports 101 is used. One first mounting port 101 is used to place the liquid-containing tube 21 containing the reaction solution, and the other first mounting port 101 is used to place the liquid-containing tube 21 containing the diluent. The reaction solution and diluent are added to the different liquid-containing tubes 21 respectively. Then, the heating assembly 12 is... Figure 1-2The heating assembly 12 is inserted into the second mounting port 102 of the clamping mechanism 10, with its heating arm only surrounding the upper half of the liquid-filled tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-filled tube 21. When the heating assembly 12 is turned on, the phase change material 211 will melt before the reaction liquid reaches the target reaction temperature, completely covering the surface of the reaction liquid. Heat will then be transferred to the reaction liquid through the molten phase change material 211, causing the reaction liquid to reach the required temperature and react. After the reaction is complete, the heating assembly 12 is removed from the second mounting port 102. Once the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down along the first direction until it contacts the lower end of the liquid collection tube 21 and the cutting mechanism 30. At this time, the liquid collection tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid collection tube 21 is squeezed by the squeezing component 41 to deform, forcing the reaction liquid and diluent to flow out from the liquid collection tube 21 to the sample pad 433 surface of the chromatography test strip. The reaction liquid and diluent will flow along the test strip 432, and the result will be displayed on the display area of the test strip 432. The result can be read from the observation window 291 of the detection mechanism 40.
[0160] In another embodiment of this application, a nucleic acid amplification reaction occurs within the liquid collection tube 21, and the detection mechanism 40 employs an optical detection module 45 to read the detection results using fluorescence. First, the reaction system containing fluorescently labeled probes is added to the liquid collection tube 21. Then, the liquid collection tube 21 is placed into the first mounting port 101 on the top 111 of the clamping mechanism 10, and subsequently... Figure 1-2 As shown, the heating component 12 is inserted into the second mounting port 102 of the clamping mechanism 10, with the heating arm of the heating component 12 only surrounding the upper half of the liquid-containing tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-containing tube 21. The heating component 12 is turned on. Before the reaction liquid reaches the target reaction temperature, the phase change material 211 will be heated and melted first, completely covering the surface of the reaction liquid, thereby maintaining the sealed state of the liquid in the liquid-containing tube 21 and inhibiting the evaporation of the reaction liquid, so that the nucleic acid amplification reaction can proceed stably and efficiently. After the reaction is completed, the heating component 12 is removed from the second mounting port 102. After the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down along the first direction until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, the liquid-containing tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid-containing tube 21 is squeezed by the squeezing component 41 to deform, so that the reaction liquid enters the liquid sampling tank 453 in the optical detection module 45 for optical detection. After the reaction solution enters the liquid sampling tank 453, it is irradiated by light through the inlet 454 of the optical detection device. The optical detection component 452 excites, collects, and analyzes the fluorescence signal, and the final fluorescence detection result is read by an external device.
[0161] In another embodiment of this application, an ELISA reaction occurs within the liquid collection tube 21, and the detection mechanism 40 employs an electrochemical detection module 44. First, a system containing enzyme-labeled antibodies and substrates, and other reaction reagents, is added to the liquid collection tube 21. Then, the liquid collection tube 21 is placed into the first mounting port 101 on the top 111 of the clamping mechanism 10, and the heating assembly 12 is then positioned accordingly. Figure 1-2 The heating component 12 is inserted into the second mounting port 102 of the clamping mechanism 10, and surrounds only the upper half of the liquid-containing tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-containing tube 21. When the heating component 12 is turned on, the phase change material 211 will melt first and completely cover the surface of the reaction liquid before the reaction liquid reaches the target reaction temperature. At this time, the phase change material 211 will efficiently and evenly transfer heat to the reaction liquid, ensuring that the ELISA enzymatic reaction proceeds stably under precise and constant temperature control. After the reaction is completed, the heating component 12 is removed from the second mounting port 102. After the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down completely along the first direction until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, the liquid-containing tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid-containing tube 21 is squeezed by the squeezing component 41 to deform, causing the reaction liquid to flow out and enter the electrochemical detection module 44, directly contacting the electrode on the electrochemical detection circuit 442. The product generated by the enzyme labeling reaction undergoes a corresponding electrochemical response on the electrode surface. The detection signal is received and processed in real time by the electrochemical detection circuit 442. The detection mechanism 40 records the response electrical signal and performs quantitative analysis on the target substance. The final detection result is obtained directly through the observation window 291 or an externally connected display module.
[0162] In a second aspect of this application, a detection system is proposed, which includes the detection device of the first aspect of this application.
[0163] In some embodiments of this application, the detection system further includes a sample processing device connected to the detection device.
[0164] To make it easier to understand, the following will be combined with... Figure 29-54 The sample processing device is described in detail.
[0165] refer to Figures 29-34 or Figures 40-41 The sample processing device includes: a pusher 50, a cylinder 60, and a target material enrichment layer 70. Specifically: refer to Figure 29 or Figure 40 Understandably, the push rod 50 includes a proximal operating part 513, a distal sealing part 512, and a collection part 511 located on the side of the distal sealing part 512 away from the proximal operating part 513.
[0166] refer to Figures 29-30 or Figure 30 and Figure 40 Understandably, the inner wall of the cylinder 60 and the distal sealing part 512 can be sealed together, and the inner wall of the cylinder 60 and the push rod 50 can move relative to each other. One end of the cylinder 60 is provided with a push rod inlet 621, and the other end of the cylinder 60 is provided with a collection part outlet 622. A sealing layer 623 is provided at the collection part outlet 622. The sealing layer 623 is configured to push the push rod 50 until the collection part 511 contacts the sealing layer 623, and then continue to push the push rod 50 so that the collection part 511 can penetrate the sealing layer 623.
[0167] Depending on the location of the target substance enrichment layer 70, this sample processing device can be used in combination with two different schemes: For scheme 1: the target material enrichment layer 70 is set on the cylinder 60.
[0168] refer to Figures 29-33 Understood, the target material enrichment layer 70 is located inside the cylinder 60 and adjacent to the collection section outlet 622 (reference). Figure 31 or Figure 32 (Understanding), the end of the acquisition unit 511 furthest from the proximal operation unit 513 is provided with a stripping part 511a (refer to) Figure 29 or Figure 33 (Understanding) The peeling part 511a is configured such that when the push rod 50 causes the collecting part 511 to penetrate the sealing layer 623, the peeling part 511a can peel off the target material enrichment layer 70 and carry it out of the cylinder 60. Thus, the enrichment and transfer of the target material can be achieved through the cooperation of the push rod 50, the cylinder 60 and the target material enrichment layer 70.
[0169] Regarding Scheme 1, in actual operation, the liquid sample can be transferred into the cylinder 60, allowing the liquid sample to come into contact with the target substance enrichment layer 70 and using the target substance enrichment layer 70 to enrich the target substance in the liquid sample. The collection part 511 of the push rod 50 is inserted into the cylinder 60 through the push rod inlet 621. During the enrichment of the target substance, the peeling part 511a located at the end of the collection part 511 away from the proximal operation part 513 can be selectively controlled to contact or not contact the target substance enrichment layer 70 (e.g., not contact can be selected). After the enrichment of the target substance is completed, the push rod 50 is pushed to make the peeling part 511a contact with the target substance enrichment layer 70 and peel it off and carry it out, until the collection part 511 penetrates the sealing layer 623, extends out of the cylinder 60 and carries out the target substance enrichment layer 70, thus realizing the enrichment and transfer of the target substance. The carried-out target substance enrichment layer 70 is then transferred to the liquid collection tube 21 of the detection device for subsequent detection.
[0170] For scheme 2, the target material enrichment layer 70 is set on push rod 50.
[0171] refer to Figure 30 and Figures 40-41 Understood, the target material enrichment layer 70 is located on the side of the collection unit 511 away from the proximal operation unit 513 (see reference). Figure 41 (Understanding) The target substance enrichment layer 70 is configured to be carried out of the cylinder 60 by the collection unit 511 when the push rod 50 pushes the collection unit 511 through the sealing layer 623. Thus, the enrichment and transfer of the target substance can be achieved through the cooperation of the push rod 50, the cylinder 60 and the target substance enrichment layer 70, and the carried-out target substance enrichment layer 70 is transferred to the liquid collection tube 21 of the detection device for subsequent detection.
[0172] Regarding Scheme 2, in actual operation, the liquid sample can be transferred into the cylinder 60, and the collection part 511 of the push rod 50 can be inserted into the cylinder 60 through the push rod inlet 621, so that the liquid sample comes into contact with the target substance enrichment layer 70 and the target substance in the liquid sample is enriched by the target substance enrichment layer 70. After the target substance enrichment operation is completed, the push rod 50 is pushed until the collection part 511 penetrates the sealing layer 623, extends out of the cylinder 60 and takes out the target substance enrichment layer 70, thereby realizing the enrichment and transfer of the target substance, and the target substance enrichment layer 70 is transferred to the liquid collection tube 21 of the detection device for subsequent detection.
[0173] It is understood that the liquid sample can be an untreated sample or a pretreated sample. The pretreatment operation can be flexibly selected according to actual needs. For example, for biological samples, the pretreatment operation can include, but is not limited to, one or more of the conventional treatment methods such as dilution, reaction, and lysis.
[0174] It is understood that the target substance can be the original component of the liquid sample, or it can be obtained from the original component of the liquid sample through reaction, pyrolysis or other treatment methods. The process of treating the liquid sample can be flexibly selected to be carried out in the cylinder 60 according to actual needs.
[0175] The sample processing devices of Scheme 1 and Scheme 2 of this application can each independently have one or more of the following technical effects: they can be used for sample processing or pre-processing steps to facilitate subsequent operations or detection requirements; they can be used to enrich the analyte in a large volume of sample liquid, or to enrich the components of a large volume of sample liquid from which the analyte can be obtained, so as to improve the sensitivity of subsequent operations or detection; they can simultaneously perform sample (pre) processing and enrichment of the target substance.
[0176] It should be noted that in this application, in the terms "outer peripheral wall of the collecting part 511", "outer peripheral wall of the distal sealing part 512", "outer peripheral wall of the pressing part 513a", "outer peripheral wall of the push rod 50", "outer peripheral wall of the deformable part 518", "outer peripheral wall of the deformable beam 518b", and "outer peripheral wall of the third buckle 518a", "outer" refers to the direction away from the axis of the push rod 50. Additionally, in the terms "inner wall of the cylinder 60", "outer cylinder 60a", "inner cylinder 60b", "inner wall of the cylinder 60 recessed outwards", "inner part of the cylinder 60", "outer peripheral wall of the inlet end 620f3", and "outer peripheral wall of the circumferential rotation groove 620f1", "inner" refers to the direction close to the axis of the cylinder 60, and "outer" refers to the direction away from the axis of the cylinder 60.
[0177] Furthermore, Scheme 1 and Scheme 2 can each independently satisfy one or more of the following additional technical features: In some embodiments of this application, reference is made to Figure 29 or Figure 40 It is understood that the distance between the outer peripheral wall of the collecting section 511 and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the distal sealing section 512 and the axis of the push rod 50. Optionally, the distance between the outer peripheral wall of the collecting section 511 and the axis of the push rod 50 can be less than the distance between the outer peripheral wall of the distal sealing section 512 and the axis of the push rod 50. This further facilitates the collecting section 511 penetrating the sealing layer 623 to carry the target material enrichment layer 70 out of the cylinder 60.
[0178] In some embodiments of this application, the sealing layer 623 may be a waterproof layer or a first waterproof and breathable layer. The specific type or material may be flexibly selected according to actual needs. For example, the waterproof layer may include, but is not limited to, an aluminum film, and the first waterproof and breathable layer may include, but is not limited to, a permeable membrane.
[0179] In some embodiments of this application, reference is made to Figure 29 or Figure 33It is understood that the push rod 50 may also be provided with a breakable part 514, which can be located between the collection part 511 and the distal sealing part 512. After the collection part 511 penetrates the sealing layer 623, extends out of the cylinder 60, and carries the target substance enrichment layer 70 out of the cylinder 60, the push rod can be broken at the breakable part 514, and then the target substance enrichment layer 70 is transferred with the collection part 511 to the liquid collection tube 21 of the detection device. Existing sample (pre)processing methods are usually quite cumbersome, such as involving multiple transfers between samples or devices. These transfer processes often rely on manual operation, such as sampling and transfer using tools like pipettes and tweezers. During the operation, errors and loss of target substances are prone to occur, leading to reduced detection accuracy. Moreover, the process is cumbersome, time-consuming, and labor-intensive. In addition, cross-contamination is easily generated during manual transfer operations, resulting in low reliability of the detection results. By incorporating a breakable section, contactless transfer of the target substance can be achieved, reducing contact between the enriched target substance and materials such as tweezers. This reduces the risk of target substance loss and / or cross-contamination during transfer, which could lead to decreased detection accuracy.
[0180] In some embodiments of this application, reference is made to Figure 29 or Figure 40 It is understood that the distance between the outer peripheral wall of the breakable portion 514 and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the collecting portion 511 and the axis of the push rod 50. It should be noted that the breakable portion 514 can achieve the breakable effect through material selection, structural design (such as forming a fracture on the push rod surface), or both material selection and structural design, as long as the push rod 50 can be broken to separate the collecting portion 511 and the push rod 50. Optionally, the distance between the outer peripheral wall of the breakable portion 514 and the axis of the push rod 50 can be less than the distance between the outer peripheral wall of the collecting portion 511 and the axis of the push rod 50, thereby further facilitating the breaking of the push rod 50 and achieving the separation of the collecting portion 511 and the push rod 50.
[0181] In some embodiments of this application, reference is made to Figure 29 and Figure 40 It is understood that the push rod 50 is located on the side of the distal sealing portion 512 away from the proximal operating portion 513. The distance between the outer peripheral wall of the push rod 50 and the axis of the push rod 50 can be less than the distance between the outer peripheral wall of the distal sealing portion 512 and the axis of the push rod 50. In this structural design, when the push rod 50 is pushed to move within the cylinder 60, a liquid sample can also be accommodated between the push rod 50 and the cylinder 60 within the space formed by the distal sealing portion 512, the inner wall of the cylinder 60, and the sealing layer 623.
[0182] In some embodiments of this application, reference is made to Figure 33It is understood that the breakable portion 514 may include a first fracture 514a. This facilitates the separation of the collecting part 511 and the push rod 50 by breaking the push rod 50. It should be noted that the specific structure and depth of the first fracture 514a are not particularly limited, and those skilled in the art can flexibly choose according to actual needs. For example, the first fracture 514a may include, but is not limited to, one or more of notches, notches, and grooves. Optionally, the notch may include, but is not limited to, one or more of V-shaped notches, U-shaped notches, etc. Optionally, the notch may extend along the circumferential direction of the push rod 50. Optionally, the groove may extend along the circumferential direction of the push rod 50. For example, in the circumferential direction of the push rod 50, the groove may extend along the entire outer peripheral wall of the push rod 50 (e.g., it may be an annular groove) or be provided along a portion of the outer peripheral wall of the push rod 50. Further optionally, the groove may be an annular groove.
[0183] In some embodiments of this application, the breakable portion 514 may include one or more first breaks 514a, which may be continuous or spaced apart along the circumference of the push rod 50. For example, the breakable portion 514 may include only one first break 514a, which may be continuous along the circumference of the push rod 50, such as an annular groove (see reference). Figure 33 (Understanding). For example, the breakable portion 514 may include multiple first breaks 514a, which may be spaced apart circumferentially along the push rod 50. For instance, the breakable portion 514 may include two first breaks 514a, which may be symmetrically spaced on the circumferential surface of the push rod 50. Providing multiple first breaks 514a or annular first breaks 514a facilitates breaking the push rod 50 from multiple directions and / or reduces the radial distance of the breakable portion 514, further facilitating the separation of the collecting unit 511 and the push rod 50 by breaking the push rod 50.
[0184] It is understandable that, based on the purpose of separating the collection part 511 and the push rod 50 by breaking the push rod 50, the length of the collection part 511 can be set as follows: when the push rod 50 is pushed to the point that the distal sealing part 512 abuts against the inner wall of the cylinder 60 on the side away from the push rod inlet 621, the breakable part 514 extends out of the cylinder 60, or the breakable part 514 is located at the collection part outlet 622.
[0185] It is understood that, in some embodiments of this application, the composition, type or structure of the target material enrichment layer 70 may be flexibly selected according to actual needs such as the target material to be enriched.
[0186] Optionally, the target substance enrichment layer 70 can be a porous layer. Using a porous layer is beneficial to ensure that the liquid sample is in full contact with the target substance enrichment layer, thereby achieving the enrichment and separation of the target substance.
[0187] It is understandable that when the target material enrichment layer 70 is a porous layer, the specific type of the porous layer can be flexibly selected according to actual needs. For example, the porous layer may include, but is not limited to, one or more of the following: sponge, porous adsorption membrane, porous microsphere.
[0188] It is understood that when the target material enrichment layer 70 is a porous layer, the pore size of the porous layer is not particularly limited. Those skilled in the art can flexibly select according to actual needs. For example, the pore size of the target material enrichment layer can be from 0.1μm to 5μm, such as 0.1μm, 0.5μm, 1μm, 1.5μm, 2μm, 2.5μm, 3μm, 3.5μm, 4μm, 4.5μm or 5μm, or it can be any range of the above values.
[0189] Optionally, the target substance enrichment layer 70 may include filter materials and / or adsorbent materials. It is understood that the materials of the filter materials and the adsorbent materials are not particularly limited, and those skilled in the art can flexibly select them according to actual needs. For example, when it is necessary to enrich the target substance through filtration, the target substance enrichment layer 70 may include filter materials, and the specific material of the filter materials can be flexibly selected according to the specific type, size, etc. of the target substance; when it is necessary to enrich the target substance through adsorption (such as physical adsorption and / or chemical adsorption), the target substance enrichment layer 70 may include adsorbent materials, and the specific material of the adsorbent materials can be flexibly selected according to the specific type, etc. of the target substance; furthermore, the target substance enrichment layer 70 may also have both filtration and adsorption functions, which can be achieved through conventional technical means such as material selection and structural design of the target substance enrichment layer.
[0190] Optionally, the target substance enrichment layer 70 can be configured to allow the retention of nucleic acid natural biological carriers (e.g., cells or viruses) in biological samples. For example, a porous layer with a suitable pore size can be selected as the target substance enrichment layer according to the molecular size or dimensions of the nucleic acid natural biological carriers that allow the retention of nucleic acid in biological samples. For example, the pore size of the porous layer can be from 0.1 μm to 5 μm.
[0191] Optionally, the target material enrichment layer 70 may include, but is not limited to, one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polyethersulfone (PES) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, and glass fiber layer.
[0192] Optionally, the target substance enrichment layer 70 may include an adsorbent material adapted to specifically bind to the target substance. This allows for the specific enrichment of the desired target substance (such as nucleic acids or proteins). For example: In some embodiments, the adsorbent material of the target substance enrichment layer 70 can be a hydrophobic silicon-based material to specifically capture and adsorb hydrophobic molecules in the sample, such as various lipid-soluble drugs and their metabolites.
[0193] In other embodiments, the adsorbent material of the target substance enrichment layer 70 can be an immunoaffinity membrane modified with specific antibodies to specifically capture specific antigens or pathogenic microorganisms in the sample, such as surface protein antigens of Streptococcus pneumoniae and Staphylococcus aureus.
[0194] In some other embodiments, the adsorbent material of the target substance enrichment layer 70 may be a combination of a silicon-based membrane and magnetic nanobeads as a highly efficient nucleic acid enrichment material to capture RNA or DNA in the sample to be tested.
[0195] In some embodiments of this application, reference is made to Figure 29 or Figure 40 It is understood that the specific type of the distal sealing part 512 is not particularly limited, and those skilled in the art can choose flexibly according to actual needs. For example, the distal sealing part 512 can be an elastic sealing part. As another example, the distal sealing part 512 can include, but is not limited to, a sealing ring and / or a piston. It should be noted that the specific materials of the elastic sealing part, sealing ring, and piston are not particularly limited, and those skilled in the art can choose flexibly according to actual needs. For example, common elastic sealing materials in the field can be selected, as long as they can achieve a sealing fit between the inner wall of the cylinder 60 and the distal sealing part 512 and allow relative movement.
[0196] In some embodiments of this application, reference is made to Figure 29 It is understood that a pressing part 513a may be provided on the side of the proximal operating part 513 away from the distal sealing part 512. This further facilitates the pressing operation of the push rod 50.
[0197] In some embodiments of this application, reference is made to Figure 29 It is understood that the distance from the outer peripheral wall of the pressing part 513a to the axis of the push rod 50 can be greater than the distance from the outer peripheral wall of the distal sealing part 512 to the axis of the push rod 50. This further facilitates the push-pull operation of the push rod 50 within the cylinder 60.
[0198] Furthermore, for Scheme 1, one or more of the following additional technical features may also be satisfied: In some embodiments of this application, reference is made to Figure 33It is understood that the end of the collection unit 511 away from the proximal operation unit 513 is provided with a peeling part 511a, and the side of the peeling part 511a away from the proximal operation unit 513 may be provided with a protrusion 511a1. Protrusion 511a1 is provided to facilitate the peeling part 511a to pierce the target material enrichment layer 70 when the push rod 50 is pushed to make the collection unit 511 penetrate the sealing layer 623, and further facilitates the peeling part 511a to peel off the target material enrichment layer 70 and bring it out of the cylinder 60.
[0199] Optionally, refer to Figure 33 It is understood that the protrusion 511a1 may have a pointed tip, which further facilitates the peeling part 511a to peel off and attach the target material enrichment layer 70 when the push rod 50 is pushed to make the collection part 511 penetrate the sealing layer 623.
[0200] Optionally, refer to Figure 33 It is understood that the peeling section 511a may include multiple protrusions 511a1, and adjacent protrusions 511a1 may be spaced apart. Therefore, when the push rod 50 is pushed to make the collection section 511 penetrate the sealing layer 623, the push rod 50 can be rotated when the peeling section 511a pierces the target material enrichment layer 70, thereby further facilitating the peeling section 511a to peel off and smoothly bring the target material enrichment layer 70 out of the cylinder 60.
[0201] Optionally, refer to Figure 33 It is understood that the peeling section 511a may include multiple protrusions 511a1, and the side of the multiple protrusions 511a1 facing the proximal operating section 513 may form a second groove 511a2. The second groove 511a2 is suitable for clamping the target material enrichment layer 70. Thus, when the push rod 50 is pushed to make the collection section 511 penetrate the sealing layer 623, the push rod 50 can be rotated when the peeling section 511a pierces the target material enrichment layer 70, so that the target material enrichment layer 70 is peeled off and attached to the second groove 511a2. This not only further facilitates the collection section 511 to smoothly bring the target material enrichment layer 70 out of the cylinder 60, but also facilitates the discharge of the liquid between the target material enrichment layer 70 and the peeling section 511a.
[0202] In some embodiments of this application, reference is made to Figure 29 and Figure 31It is understood that the cylinder 60 may include an outer cylinder 60a and an inner cylinder 60b. The outer cylinder 60a is fitted onto the inner cylinder 60b, forming a first waste liquid chamber 60c between the outer cylinder 60a and the inner cylinder 60b. The side of the inner cylinder 60b near the collection section outlet 622 is communicatively connected to the first waste liquid chamber 60c. The inner wall of the inner cylinder 60b is sealed to the distal sealing section 512, and the inner wall of the inner cylinder 60b is movable relative to the push rod 50. Thus, when the push rod 50 is pushed to allow the collection section 511 to penetrate the sealing layer 623, the liquid inside the inner cylinder 60b can enter the first waste liquid chamber 60c under pressure after passing through the target substance enrichment layer 70. Current sample enrichment devices generally do not have effective integrated waste liquid treatment or real-time monitoring functions, and the waste liquid is usually directly discarded, which wastes unused sample resources and may cause unnecessary pollution and risks to the environment. The above-mentioned setup of this application can integrate sample pretreatment, target substance enrichment and waste liquid collection into one device. Not only is the device compact and easy to operate, but the addition of a breakable part 514 on the push rod 50 also enables contactless transfer of the enriched target substance, reducing the risk of target substance loss and / or cross-contamination during the transfer process, which could lead to a decrease in detection accuracy. This facilitates a more efficient, safe and pollution-free process, overcoming the shortcomings of traditional technologies such as complex processing, easy cross-contamination, and low sample utilization efficiency.
[0203] In some implementations, reference Figure 29 or Figure 30 It is understood that the outer cylinder 60a and the inner cylinder 60b can be integrally formed or fixedly connected by welding or other methods, or they can be detachably connected. For example, the inner cylinder 60b and the outer cylinder 60a can be connected by threads, snap-fit, riveting, welding, or bonding. The welding method can be flexibly selected from one or more methods according to actual needs. For example, mating threads can be provided on the outer surface of the inner cylinder 60b and the inner surface of the outer cylinder 60a, and ultrasonic lines can be provided at the threads to achieve a fusion connection between the inner cylinder 60b and the outer cylinder 60a using ultrasonic welding. For example, refer to... Figure 31 It is understood that the inner cylinder 60b is connected to the outer cylinder 60a on the side near the push rod inlet 621, and / or the inner cylinder 60b is connected to the outer cylinder 60a on the side near the collection section outlet 622.
[0204] In some implementations, reference Figure 32 and Figure 34It is understood that a first waste liquid detection device 60d may be provided within the first waste liquid chamber 60c. Taking a chromatographic test strip as an example, when liquid enters the waste liquid chamber, the liquid will contact the sample pad of the chromatographic test strip to trigger detection. By setting the first waste liquid detection device 60d in the first waste liquid chamber 60c, necessary detection of the waste liquid can be performed before it is discarded, to assess and analyze the waste liquid condition in real time, and / or test the sample condition. This not only improves the overall sample information acquisition rate but also determines whether the waste liquid needs to be treated before disposal, thereby reducing the potential unnecessary pollution and risks to the environment. It should be noted that the specific type of the first waste liquid detection device 60d is not particularly limited; those skilled in the art can flexibly choose according to actual needs. For example, the first waste liquid detection device 60d may include, but is not limited to, one or more of pH test strips, chromatographic test strips, and electrochemical detection devices. Optionally, the electrochemical detection device may include, but is not limited to, an electrochemical electrode.
[0205] In some implementations, reference Figure 34 It is understood that a first viewing window 60e may be provided on the outer cylinder 60a, and the first viewing window 60e is configured to display the detection results of the first waste liquid detection device 60d. This allows for a more intuitive understanding of the waste liquid detection results.
[0206] In some embodiments, the first waste liquid chamber 60c may be provided with a first vent (not shown), and the first vent may be provided with a second waterproof and breathable layer (not shown). This can achieve air pressure balance in the first waste liquid chamber 60c, and facilitate the transfer of waste liquid into the first waste liquid chamber 60c during the process of pushing the push rod 50 to make the collection part 511 penetrate the sealing layer 623.
[0207] In some implementations, reference Figure 31 It is understood that the target material enrichment layer 70 can be located inside the inner cylinder 60b, and at the connection between the inner cylinder 60b and the first waste liquid chamber 60c; or, refer to Figure 32 It is understood that the target substance enrichment layer 70 can be disposed within the inner cylinder 60b, and located on the side near the push rod inlet 621 at the connection between the inner cylinder 60b and the first waste liquid chamber 60c. This further facilitates the transfer of liquid samples to the waste liquid chamber after enrichment by the target substance enrichment layer. Optionally, the target substance enrichment layer 70 can be disposed on the side near the push rod inlet 621 at the connection between the inner cylinder 60b and the first waste liquid chamber 60c.
[0208] In some embodiments, the target substance enrichment layer 70 can be fixed inside the cylinder 60 before processing the liquid sample. Exemplarily, the target substance enrichment layer 70 can be bonded to the cylinder 60, welded together, connected via a plastic structure, or connected via a sealing ring. Optionally, the welded connection can be achieved by ultrasonic welding, such as by ultrasonically welding the edge of the target substance enrichment layer 70 to the inner cylinder 60b. Alternatively, the target substance enrichment layer 70 can be clamped inside the inner cylinder 60b using sealing rings. For example, two sealing rings can be provided inside the inner cylinder 60b, with the inner diameter of the sealing rings larger than the outer diameter of the collection part 511, so that the outer surfaces of the two sealing rings abut and fix against the inner surface of the inner cylinder 60b, clamping the target substance enrichment layer 70 between the two sealing rings 627; for another example, refer to... Figure 35 It is understood that a step portion 626 and a sealing ring 627 can be provided inside the inner cylinder 60b. The step portion 626 is connected to the inner wall of the inner cylinder 60b in the radial direction and extends into the inner cylinder 60b. The step portion 626 and the collection portion 511 can be penetrated. The inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collection portion 511, so that the sealing ring 627 abuts against the inner surface of the inner cylinder 60b and the step surface of the step portion 626 respectively, and the target material enrichment layer 70 is sandwiched between the sealing ring 627 and the step surface of the step portion 626.
[0209] In some embodiments, a waste liquid absorption material may be provided in the first waste liquid chamber 60c. This not only absorbs excess waste liquid but also improves the transport force of liquid into the waste liquid chamber. In particular, when the liquid sample enters the waste liquid chamber after passing through the target substance enrichment layer 70, it helps to improve the enrichment efficiency of the target substance and reduce the risk of waste liquid backflow.
[0210] In some implementations, reference Figure 35 or Figure 36 It is understood that a flow channel 624 may be provided on the side of the inner cylinder 60b near the outlet 622 of the collection section. The inner cylinder 60b can be connected to the first waste liquid chamber 60c through the flow channel 624. The target substance enrichment layer 70 is disposed inside the inner cylinder 60b and is located at the flow channel 624 or on the side of the flow channel 624 near the push rod inlet 621. This further facilitates the transfer of liquid samples to the waste liquid chamber after enrichment by the target substance enrichment layer. Optionally, the target substance enrichment layer 70 may be located on the side of the flow channel 624 near the push rod inlet 621. Alternatively, the flow channel 624 may be located at the end of the inner cylinder 60b near the outlet 622 of the collection section.
[0211] Optionally, the flow channel 624 may include a first flow channel 624a, which may be disposed on the side wall of the inner cylinder 60b and penetrate the side wall of the inner cylinder 60b in the radial direction. This facilitates the communication between the inner cylinder 60b and the first waste liquid chamber 60c.
[0212] Further, refer to Figure 38 It is understood that a first thread 625b may be provided on the outer peripheral wall of the inner cylinder 60b facing the collection section outlet 622, and a second thread 625a may be provided on the inner peripheral wall of the outer cylinder 60a near the collection section outlet 622. The second thread 625a and the first thread 625b are screwed together. A second flow channel 624b may be provided on the first thread 625b and / or the second thread 625a. The first flow channel 624a is connected to the first waste liquid chamber 60c through the second flow channel 624b. This facilitates both the connection between the inner cylinder 60b and the outer cylinder 60a and the connection between the inner cylinder 60b and the first waste liquid chamber 60c.
[0213] Optionally, refer to Figures 35-38 It is understood that the inner cylinder 60b facing the outlet 622 of the collection section may be provided with a first flow channel 624a and a step portion 626. The step portion 626 is connected to the inner wall of the inner cylinder 60b in the radial direction and extends into the inner cylinder 60b. The step portion 626 may be located on the side of the first flow channel 624a near the push rod inlet 621 and may penetrate the collection section 511. The target material enrichment layer 70 may be fixed inside the inner cylinder 60b in the following manner: In some specific examples, the target material enrichment layer 70 can be bonded to the step surface of the step portion 626. Optionally, the target material enrichment layer 70 can be bonded to the step surface of the step portion 626 facing the push rod inlet 621, or to the step surface of the step portion 626 facing the collection outlet 622.
[0214] In other specific examples, refer to Figure 35 or Figure 36 It is understood that the target material enrichment layer 70 can be fixed to the step surface of the step portion 626 by the sealing ring 627. Optionally, the target material enrichment layer 70 can be sandwiched between the sealing ring 627 and the step surface of the step portion 626 facing the push rod inlet 621, or sandwiched between the sealing ring 627 and the step surface of the step portion 626 facing the collection section outlet 622. It is understood that the inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collection section 511, and the sealing ring 627 can abut against the inner surface of the inner cylinder 60b and the step surface of the step portion 626 respectively. Optionally, the sealing ring 627 can be a second elastic sealing ring.
[0215] In some specific examples, refer to Figure 35 Understood, the target material enrichment layer 70 can be fixed between the step portion 626 and the first flow channel 624a by the sealing ring 627. (After the inner cylinder 60b and the outer cylinder 60a are assembled) one side of the sealing ring 627 along its thickness direction can abut against the step surface of the step portion 626 (understood to be the step surface of the step portion 626 facing the collection section outlet 622), and the other side can abut against the inner wall of the outer cylinder 60a (facing the push rod inlet side), for reference. Figure 38 It is understood that the sealing ring 627 may have a third flow channel 624c penetrating its radial sidewall, and the third flow channel 624c may communicate with the first flow channel 624a. This facilitates communication between the inner cylinder 60b and the first waste liquid chamber 60c, and also allows as much waste liquid as possible to flow into the first waste liquid chamber. It is understood that the inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collecting part 511, and the sealing ring 627 may abut against the inner surface of the inner cylinder 60b and the step surface of the step portion 626, respectively. Optionally, the sealing ring 627 may be a second elastic sealing ring. Further optionally, the number of sealing rings 627 may be one or more, and the target material enrichment layer 70 may be sandwiched between the step surface of the step portion 626 and the sealing ring, or between two adjacent sealing rings. Still optionally, the target material enrichment layer 70 may be located on the side of the third flow channel 624c near the push rod inlet 621.
[0216] For some specific examples, see reference Figure 36 or Figure 37 It is understood that the sealing layer 623 can be disposed between the sealing ring 627 and the outer cylinder 60a; alternatively, the number of sealing rings 627 can be multiple, for example, such as Figure 35 As shown, the number of sealing rings 627 can be 1; as Figure 36 As shown, the number of sealing rings 627 can be two; as Figure 37 or Figure 38 As shown, there can be three sealing rings 627. When there are multiple sealing rings 627, the sealing layer 623 can be located between two adjacent sealing rings and on the side of the third flow channel 624c and / or the first flow channel 624a near the collection section outlet 622.
[0217] For some specific examples, see reference Figure 37 and Figure 38It is understood that the inner cylinder 60b is provided with a second step 628 and a third step 629 connected in sequence on the side of the step 626 facing the collection section outlet 622. The second step 628 is connected to the step 626 and is located between the step 626 and the third step 629. The second step 628 and the third step 629 are independently connected to the inner wall of the inner cylinder 60b in the radial direction and extend into the inner cylinder 60b. They are both permeable to the collection section 511. The outer diameter of the second step 628 is larger than the outer diameter of the step 626, and the outer diameter of the third step 629 is larger than the outer diameter of the second step 628. The first flow channel 624a is provided at the end of the second step 628 facing the collection section outlet 622. The sealing ring 627 may include a first sealing ring 627a, a second sealing ring 627b, and a third sealing ring 627c. The inner diameters of the first sealing ring 627a, the second sealing ring 627b, and the third sealing ring 627c are each independently greater than or equal to the outer diameter of the collecting part 511, and: The first sealing ring 627a is configured to be embedded in the outlet enclosed by the second step portion 628 and abut against the side wall of the second step portion 628 and the step surface of the step portion 626 facing the collection outlet 622; optionally, the thickness of the first sealing ring 627a may be less than the difference between the extension distance of the second step portion 628 and the first flow channel 624a in the axial direction of the cylinder 60. A third flow channel 624c and a second flange 627b1 may be provided on one side of the second sealing ring 627b along its thickness direction. The third flow channel 624c penetrates the radial sidewall of the second sealing ring 627b. The second flange 627b1 protrudes radially from the second sealing ring 627b. The side of the second sealing ring 627b away from the second flange 627b1 in its thickness direction is configured to be able to be embedded in the outlet enclosed by the second step portion 628, and the outer peripheral wall of the embedded portion abuts against the inner wall of the second step portion 628. The second step portion 628 may also be provided with a limiting support port (not shown). The limiting support port is located at one end of the second step portion 628 near the outlet 622 of the collection section and is recessed radially into the sidewall of the second step portion 628 along the inner cylinder 60b, and limits... The support port and the second flange 627b1 can be used for support. The third flow channel 624c is configured to communicate with the first flow channel 624a when the second flange 627b1 is used for support in conjunction with the limiting support port. The thickness of the second flange 627b1 is greater than or equal to the recess depth of the limiting support port. The difference between the total thickness of the first sealing ring 627a and the second sealing ring 627b and the thickness of the second flange 627b1 is less than the extension distance of the second step portion 628 along the axial direction of the cylinder 60, and the total thickness of the first sealing ring 627a and the second sealing ring 627b is greater than or equal to the extension distance of the second step portion 628 along the axial direction of the cylinder 60. Optionally, it can be less than the total extension distance of the second step portion 628 and the third step portion 629 along the axial direction of the cylinder 60. The third sealing ring 627c is configured such that at least a portion of its thickness direction can be embedded within the outlet enclosed by the third step portion 629, and the outer peripheral wall of the embedded portion abuts against the inner wall of the third step portion 629. Optionally, the thickness of the third sealing ring 627c can be configured such that, after the outer cylinder 60a and inner cylinder 60b are connected and the first sealing ring 627a, second sealing ring 627b, and target material enrichment layer 70 are assembled, one side of its thickness direction abuts against the inner wall of the outer cylinder 60a, and the other side directly or indirectly abuts against the second sealing ring 627b. Further alternatively, the first thread 625b can extend along the outer peripheral wall of the cylinder where the third step portion 629 is located to the outer peripheral wall of the cylinder where the second step portion 628 is located or the outer peripheral wall of the cylinder where the step portion 626 is located.
[0218] Based on the above scheme, the target material enrichment layer 70 can be sandwiched between the first sealing ring 627a and the second sealing ring 627b. Optionally, the sealing layer 623 can be disposed on one side of the third sealing ring 627c along its thickness direction. For example, it can be connected by bonding or other means so that after the outer cylinder 60a and the inner cylinder 60b are connected, the sealing layer 623 is located on the side of the third sealing ring 627c facing or away from the push rod inlet 621.
[0219] It should be noted that the specific structures of the step portion 626, the second step portion 628, and the third step portion 629 in this application are not particularly limited. Those skilled in the art can flexibly choose according to actual needs, as long as they can be penetrated by the collection unit 511 and cooperate to fix the target material enrichment layer 70. For example, the step portion 626, the second step portion 628, and the third step portion 629 can each be an annular step portion independently, or include multiple sub-step portions spaced circumferentially along the inner cylinder 60b. The following is an example of the step portion 626: Optionally, the step portion 626 can be an annular step portion. Further, the annular step portion can be coaxially arranged with the inner cylinder 60b. Alternatively, the step portion 626 can include multiple sub-step portions, which are spaced circumferentially along the inner cylinder 60b. Each sub-step portion can be independently connected to the inner wall of the inner cylinder 60b in the radial direction of the inner cylinder 60b and extend into the inner cylinder 60b.
[0220] To facilitate understanding of the sample processing device in Scheme 1, please refer to the following: Figure 39 A method for sample processing using the sample processing apparatus of one embodiment of Scheme 1 will be described by way of example. (Refer to...) Figure 39 The sample processing method includes the following steps: (1) Transfer the liquid sample to be processed into the cylinder 60; (2) Press the push rod 50 into the cylinder 60. At this time, due to the downward pressure of the push rod 50, the liquid sample in the cylinder 60 will move downward, pass through the target material enrichment layer 70, and then flow into the first waste liquid chamber 60c. The liquid flow direction is as follows: Figure 39 As indicated by arrow ② in the diagram. During this process, the target substance enrichment layer 70 enriches the target substance in the liquid sample; (3) Press the push rod 50 completely into the cylinder 60. At this time, the peeling part 511a of the push rod 50 will peel off the target material enrichment layer 70 containing the target product and take it out of the cylinder 60. (4) Break the breakable part 514 of the push rod 50 so that the collection part 511 with the target material enrichment layer 70 is transferred to the liquid collection tube 21 of the detection device.
[0221] Furthermore, for Scheme 2, one or more of the following additional technical features may also be satisfied: In some embodiments of this application, reference is made to Figure 41 It is understood that the push rod 50 may have an open inner cavity 515a. The opening of the open inner cavity 515a may be located on the side of the collection section 511 away from the proximal operation section 513. The target substance enrichment layer 70 may be located on the push rod 50 and at the opening of the open inner cavity 515a or inside the open inner cavity 515a. Therefore, after the target substance enrichment layer 70 comes into contact with the liquid sample and enriches the target substance, it is convenient to push the push rod 50 to penetrate the sealing layer 623 and bring the target substance enrichment layer 70 out of the cylinder 60.
[0222] In some embodiments of this application, reference is made to Figure 41It is understood that the push rod 50 may be provided with a cavity 515. The cavity 515 may include a second waste liquid cavity 515b extending along the length direction of the push rod 50 and an open inner cavity 515a. The open inner cavity 515a is located on the side of the second waste liquid cavity 515b away from the proximal operating part 513 and is communicative with the second waste liquid cavity 515b. The opening of the open inner cavity 515a is located on the side of the collection part 511 away from the proximal operating part 513. The target material enrichment layer 70 may be provided on the push rod 50 and located at the opening of the open inner cavity 515a or in the open inner cavity 515a. The cavity 515 is configured such that when the push rod 50 is pushed to make the collection part 511 penetrate the sealing layer 623, the liquid in the cylinder 60 may enter the cavity 515 through the open inner cavity 515a under pressure. Current sample enrichment devices generally lack effective integrated waste liquid treatment or real-time monitoring functions, and waste liquid is usually discarded directly, which not only wastes unused sample resources but may also cause unnecessary pollution and risks to the environment. The above-described setup integrates sample pretreatment, target substance enrichment, and waste liquid collection, resulting in a compact and simple-to-operate device. Furthermore, the addition of a breakable part 514 on the push rod 50 enables contactless transfer of the enriched target substance, reducing the risk of target substance loss and / or cross-contamination during transfer, which could lead to decreased detection accuracy. This facilitates a more efficient, safe, and pollution-free process, overcoming the shortcomings of traditional technologies such as complex processing, susceptibility to cross-contamination, and low sample utilization efficiency.
[0223] In some implementations, reference Figure 41 It is understood that the push rod 50 may also be provided with a breakable part 514, which may be located on the outer wall of the open inner cavity 515a and on the side of the target material enrichment layer 70 near the proximal operating part 513. The second waste liquid chamber 515b may be located on the side of the breakable part 514 near the proximal operating part 513. This facilitates the effective separation of waste liquid and target material.
[0224] In some implementations, reference Figure 41 It is understood that a one-way valve 515c may be provided between the second waste liquid chamber 515b and the open inner chamber 515a. The one-way valve 515c is adapted to open when the pressure in the open inner chamber 515a is greater than that in the second waste liquid chamber 515b. Thus, when the pressure in the open inner chamber 515a is greater than that in the second waste liquid chamber 515b, the one-way valve 515c can open, and liquid will flow from the open inner chamber 515a into the second waste liquid chamber 515b. When the pressure in the open inner chamber 515a is less than or equal to that in the second waste liquid chamber 515b, the one-way valve 515c will close, and liquid will not be able to flow back from the second waste liquid chamber 515b into the open inner chamber 515a.
[0225] In some implementations, reference Figure 42It is understood that the second waste liquid chamber 515b may be equipped with a second waste liquid detection device 515d. Taking a chromatography test strip as an example, when liquid enters the waste liquid chamber, the liquid will contact the sample pad of the chromatography test strip to trigger detection. By setting the second waste liquid detection device 515d in the second waste liquid chamber 515b, necessary detection of the waste liquid can be performed before it is discarded, to assess and analyze the waste liquid condition in real time, and / or test the sample condition. This not only improves the overall sample information acquisition rate, but also determines whether the waste liquid needs to be treated before disposal, thereby reducing unnecessary pollution and risks to the environment that the waste liquid may cause. It should be noted that the specific type of the second waste liquid detection device 515d is not particularly limited; those skilled in the art can flexibly choose according to actual needs. For example, the second waste liquid detection device 515d may include, but is not limited to, one or more of pH test strips, chromatography test strips, and electrochemical detection devices. Optionally, the electrochemical detection device may include, but is not limited to, an electrochemical electrode.
[0226] In some implementations, reference Figure 42 It is understood that a second viewing window 516 may be provided on the push rod 50, and the second viewing window 516 is configured to display the detection results of the second waste liquid detection device 515d. This allows for a more intuitive understanding of the waste liquid detection results.
[0227] In some implementations, reference Figure 41 It is understood that the second waste liquid chamber 515b may be provided with a second vent 517, and the second vent 517 may be provided with a third waterproof and breathable layer (not shown). This can achieve air pressure balance in the second waste liquid chamber 515b, and further facilitate the transfer of waste liquid into the second waste liquid chamber 515b during the process of pushing the push rod 50 to make the collection part 511 penetrate the sealing layer 623.
[0228] In some embodiments, the target substance enrichment layer 70 can be fixed to the push rod 50 before the liquid sample is processed. Exemplarily, the target substance enrichment layer 70 can be bonded to the push rod 50, welded together, connected via a plastic structure, or connected via a sealing ring. Optionally, the welded connection can be achieved by ultrasonic welding, for example, by ultrasonically welding the edge of the target substance enrichment layer 70 to the push rod 50.
[0229] In some embodiments, the second waste liquid chamber 515b may be provided with waste liquid absorption material, thereby absorbing excess waste liquid and reducing the risk of waste liquid backflow.
[0230] To facilitate understanding of the sample processing device in Scheme 2, please refer to the following: Figure 43 A method for sample processing using the sample processing apparatus of one embodiment of Scheme 2 will be described by way of example. (Refer to...) Figure 43 The sample processing method includes the following steps: (1) Transfer the liquid sample to be processed into the cylinder 60; (2) Press the push rod 50 into the cylinder 60 so that the target substance enrichment layer 70 inside the push rod 50 comes into contact with the liquid sample, so as to enrich the target substance in the liquid sample; at this time, due to the downward pressure of the push rod 50, the liquid sample inside the cylinder 60 will move towards the open inner cavity 515a of the push rod, pass through the target substance enrichment layer 70, and then flow into the second waste liquid cavity 515b. The liquid flow direction is as follows: Figure 43 As indicated by arrow ② in the middle; (3) Press the push rod 50 completely into the cylinder 60. At this time, the collection part 511 of the push rod 50 will carry the target material enrichment layer 70 containing the target product out of the cylinder 60. (4) Break the breakable part 514 of the push rod 50 so that the collection part 511 with the target material enrichment layer 70 is transferred to the liquid collection tube 21 of the detection device.
[0231] Furthermore, Scheme 1 and Scheme 2 can each independently satisfy one or more of the following additional technical features: In some embodiments of this application, reference is made to Figure 44 It is understood that the push rod 50 may further include a deformable portion 518 extending between the proximal operating portion 513 and the distal sealing portion 512. The outer peripheral wall of the deformable portion 518 has a third latch 518a, which protrudes radially along the push rod 50. A groove 620f is provided at the push rod inlet 621 of the cylinder 60. The groove 620f includes a circumferential rotation groove 620f1 and an inclined groove 620f2. The circumferential rotation groove 620f1 is recessed from the inner wall of the cylinder 60 in a direction away from the axis of the cylinder 60. The inclined groove 620f2 is connected to the circumferential rotation groove 620f1 and faces towards the cylinder 60. The cylinder is inclined and extends towards the collection section outlet 622. The circumferential rotating groove 620f1 is provided with an inlet end 620f3, which is connected to the push rod inlet 621. The circumferential rotating groove 620f1 is configured to rotate and engage with the circumferential rotating groove 620f1 when the push rod 50 pushes the third buckle 518a from the inlet end 620f3 into the circumferential rotating groove 620f1. The inclined groove 620f2 is configured to press and engage with the third buckle 518a when the third buckle 518a passes through the inclined groove 620f2 to push the third buckle 518a and the push rod 50 downward.
[0232] In actual operation, the target material enrichment layer 70 is mostly made of porous material. When the liquid directly contacts the target material enrichment layer 70 to enrich the target material, a large amount of target material may be enriched on the side of the target material enrichment layer 70 facing the push rod inlet 621, while only a small amount of target material may pass through the surface of the target material enrichment layer 70 and enter its interior due to the gravity of the liquid. This poses a risk of low target material enrichment efficiency and / or incomplete enrichment of the target material in the liquid. However, by pushing the push rod 50 downward, pressure can be applied to the liquid to make it pass through the target material enrichment layer 70, allowing more target material to be enriched within the target material enrichment layer 70. Since it takes time for the liquid to pass through the target material enrichment layer 70 under the push of the push rod 50, the downward pressure of the push rod can be controlled by controlling the single advance distance of the push rod 50 within the cylinder 60. This ensures that while the liquid passes through the target material enrichment layer 70, the collection unit 511 does not prematurely contact the target material enrichment layer 70 and puncture the sealing layer 623, thus preventing the target material enrichment operation from failing. By adopting the above-mentioned structure of push rod 50 and cylinder 60, the third buckle 518a and the slide groove 620f cooperate with each other, and the liquid can be discharged by pushing the push rod once or multiple times when enriching the target substance in the liquid (that is, the liquid penetrates the target substance enrichment layer 70), and the single discharge volume of the liquid can be controlled (the discharge volume can be understood as the discharge volume that penetrates the target substance enrichment layer), thereby reducing the risk of problems such as low target substance enrichment efficiency, incomplete target substance enrichment, or target substance enrichment operation failure.
[0233] Therefore, the sample processing device can further achieve one or more of the following technical effects: (1) In the process of enriching the target substance, the third buckle 518a located on the deformable part 518 can be used in conjunction with the slide groove 620f to promote the liquid to pass through the target substance enrichment layer and control the quantitative liquid output. For example, the third buckle 518a can be used to adjust the depth of the push rod 50 pushed into the cylinder 60, and the circumferential rotation groove 620f1 can be used to suppress the third buckle 518a from popping up under the action of air pressure, which is conducive to accurately controlling the travel distance and stopping position of the push rod 50, which is conducive to controlling the liquid output rate of penetrating the target substance enrichment layer and controlling the quantitative liquid output, thereby improving the accuracy of quantitative liquid output. Compared with the existing manual direct liquid dispensing, it is not only simple to operate, but also conducive to the rapid and accurate quantitative dispensing of liquid, improving the stability of repeated operations (such as using multiple sample processing devices of the same specification to perform the same operation) or different personnel operation; (2) simple structure and low cost; (3) no additional measuring tools are required to quickly and accurately complete quantitative dispensing, which is conducive to parallel or control experiments; (4) good dispensing stability and uniformity; (5) easy to mass produce and promote; (6) suitable for widespread promotion and use in multiple industries such as medical, laboratory, biopharmaceutical, chemical and food industries.
[0234] In practice, refer to Figure 45 It is understood that the third latch 518a is adapted to extend into or disengage from the circumferential rotating groove 620f1 from the inlet end 620f3, either manually or automatically. Further, refer to... Figure 31 Understood, the 620f groove includes the 620f2 inclined groove (refer to...). Figure 45 (See detailed diagram G for understanding) Since the inclined groove 620f2 can apply a horizontal force to the right to the third buckle 518a and the deformable part 518, the deformable part 518 can deform, allowing the third buckle 518a to move along the inclined groove 620f2 in a direction perpendicular to the slide groove 620f. Therefore, the movement of the push rod 50 along the axial direction of the cylinder 60 is not restricted.
[0235] It is understood that the deformable part 518 can undergo recoverable or irrecoverable deformation under the action of external force. For example, the deformable part 518 can undergo recoverable or irrecoverable deformation at least under the action of an external force perpendicular to it.
[0236] It is understandable that the circumferential rotation groove 620f1 is a groove that opens towards the inside of the cylinder 60 and extends circumferentially along the cylinder 60 (see reference). Figure 45 Understanding and Figure 46 (Understanding), the extension distance of the circumferential rotating groove 620f1 on the inner wall of the cylinder 60 can be flexibly selected according to actual needs. For example, the arc corresponding to the circumferential rotating groove 620f1 can be 1°~359°, such as 1°, 5°, 10°, 20°, 30°, 40°, 50°, 60°, 70°, 80°, 90°, 100°, 110°, 120°, 130°, 140°, 150°, 180°, 210°, 240°, 270°, 300°, 330° or 359°, or any range of the above values. Optionally, the arc corresponding to the circumferential rotating groove 620f1 can be 10°~150°.
[0237] It is understandable that the groove depth of the circumferential rotating groove 620f1 (i.e., the depth to which the circumferential rotating groove 620f1 is recessed outward from the inner wall of the cylinder 60, refer to...) Figure 45 Understanding and Figure 46 (Understanding) The selection can be flexibly made according to the wall thickness of the cylinder 60, the inner diameter of the cylinder 60, the distance from the outer peripheral wall of the third buckle 518a to the axis of the push rod 50, etc., as long as the third buckle 518a can rotate with the push rod in the circumferential rotation groove 620f1.
[0238] Understandably, the height of the circumferential rotating groove 620f1 (i.e., the distance between the groove wall of the circumferential rotating groove 620f1 facing the push rod inlet 621 and the groove wall facing the collection section outlet 622) can be flexibly selected based on the extension distance of the third latch 518a along the length of the push rod 50 and the required accuracy of the single liquid output. It must be able to cooperate with the third latch 518a rotating with the push rod 50 within the circumferential rotating groove 620f1 and prevent the third latch 518a from springing up towards the push rod inlet 621 under air pressure. Furthermore, the liquid error caused by the fitting gap between the third latch 518a and the circumferential rotating groove 620f1 must be within an acceptable range. For example, the height of the circumferential rotating groove 620f1 can be slightly larger than the extension distance of the third latch 518a along the length of the push rod 50, such as by 0.02mm-1mm. Optionally, under general precision requirements, the height of the circumferential rotation groove 620f1 can be 0.5mm to 1mm greater than the extension distance of the third latch 518a along the length of the push rod 50 (e.g., 0.5mm, 0.6mm, 0.7mm, 0.8mm, 0.9mm, or 1mm, etc.). Under high precision requirements, this value can be set smaller based on the precision calculation results. However, considering the flexible rotation of the push rod 50 within the circumferential rotation groove 620f1, this distance should generally be greater than 0.02mm, such as 0.02mm-0.05mm. For example, it can be greater than 0.02mm, 0.05mm, 0.1mm, 0.2mm, 0.3mm, 0.4mm, or 0.45mm, etc.
[0239] It is understandable that the extension distance of the inclined groove 620f2 in the length direction of the cylinder 60 is not particularly limited. Those skilled in the art can choose flexibly according to actual needs, as long as it can achieve the pressing cooperation with the third buckle 518a to push the third buckle 518a and the push rod 50 downward.
[0240] It is understandable that the number and location of the slide grooves 620f are matched with the overall distribution and number of the third buckle 518a along the length and circumferential direction of the push rod 50.
[0241] In some embodiments of this application, the specific structure of the deformable part 518 is not particularly limited, and those skilled in the art can flexibly choose according to actual needs. For example, the deformable part 518 can achieve deformation under external force by setting a deformable column and a buckle, or it can achieve deformation under external force by setting a deformable beam and a buckle. For example, the deformable part may include a deformable column and a buckle provided on the outer peripheral wall of the deformable column. The deformable column can be an elastic column, which can be formed of an elastic material (such as rubber). This facilitates the deformation of the deformable part 518 under compression deformation under external force. For example, refer to... Figure 47 , Figure 48 or Figure 49 It is understood that the deformable part 518 may include a deformable beam 518b and a third latch 518a. The deformable beam 518b may extend along the length direction of the push rod 50, and the third latch 518a may be provided on the outer peripheral wall of the deformable beam 518b. This facilitates the deformable part 518 to undergo compression deformation under the action of external force, allowing the third latch 518a to move along the inclined plane or perpendicular to the inclined plane.
[0242] In some embodiments of this application, reference is made to Figure 47 , Figure 48 or Figure 49 It is understood that the distance between the outer peripheral wall of the deformable beam 518b and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50; the distance between the outer peripheral wall of the third latch 518a and the axis of the push rod 50 can be greater than the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50. Therefore, this facilitates the push rod 50's advancement into the cylinder 60, and also prevents the push rod 50 from springing up due to air pressure through the cooperation of the third latch 518a and the slide groove 620f.
[0243] In some embodiments of this application, the deformable portion 518 may include a third latch 518a (see reference). Figure 50 (Understanding) or multiple third clips 518a (refer to) Figure 44 or Figure 51 (Understanding). When the deformable part 518 includes multiple third latches 518a, the multiple third latches 518a can be spaced apart along the circumferential and / or length direction of the push rod 50. The number of times liquid is dispensed at a single metering rate and the metering volume can be controlled by adjusting the number and spacing of the third latches 518a along the length direction of the push rod 50. Furthermore, in the length direction of the push rod 50, after the distance of the third latches 518a near the far end sealing part 512 of the push rod 50 is fixed, the number and spacing angle of the third latches 518a along the circumferential direction of the push rod 50 can be adjusted to improve the fixing effect of the slide groove 620f on the third latches 518a and the push rod 50, and improve the stability of the push rod 50 maintaining a constant height after the third latches 518a enter the circumferential rotation groove 620f1.
[0244] In some embodiments of this application, the push rod 50 may include a third latch 518a (see reference). Figure 50 or Figure 51 (Understanding) or multi-layer third buckle 518a (reference) Figure 44(Understanding). When the push rod 50 includes multiple layers of third latches 518a, the multiple layers of third latches 518a can be spaced apart along the length direction of the push rod 50. The number of third latches 518a in each layer can be one or more. Multiple third latches 518a located in the same layer can be spaced apart along the circumference of the push rod 50, and in the length direction of the push rod 50, the distance between the third latches 518a located in the same layer and the distal sealing part 512 is equal.
[0245] For example, refer to Figure 50 Understood, push rod 50 may include only one layer of third latch 518a, and this layer of third latch 518a may include only one third latch 518a.
[0246] For example, refer to Figure 51 It is understood that the push rod 50 may consist of only one layer of third latches 518a, which may include multiple third latches 518a spaced apart circumferentially along the push rod 50. This improves the fixing effect of the slide groove 620f on the third latches 518a and the push rod 50, and enhances the stability of the push rod 50 at a constant height after the third latches 518a enter the circumferential rotation groove 620f1.
[0247] For example, the push rod 50 may include multiple layers of third snap fasteners 518a, each layer of third snap fasteners 518a may independently include only one third snap fastener 518a. Thus, the downward movement distance of the push rod 50 within the cylinder 60 can be controlled by adjusting the setting positions of different layers of snap fasteners along the length of the push rod and / or the distance between adjacent layers of third snap fasteners 518a, achieving multiple quantitative liquid dispensing. It is understood that the number of layers of third snap fasteners 518a on the push rod 50 and the spacing between adjacent layers of third snap fasteners 518a along the length of the push rod 50 can be flexibly selected according to actual needs. For example, the number of layers of third snap fasteners 518a can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 layers, etc.
[0248] For example, refer to Figure 44 It is understood that the push rod 50 may include multiple layers of third latches 518a, with at least one layer of third latches 518a including a plurality of third latches 518a spaced apart circumferentially along the push rod 50; or, the multiple layers of third latches 518a may each independently include a plurality of third latches 518a spaced apart circumferentially along the push rod 50. It is understood that the number of third latches 518a located in the same layer can be flexibly selected according to actual needs, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.
[0249] In some embodiments of this application, reference is made to Figure 44It is understood that the push rod 50 may include multiple layers of third latches 518a, with multiple third latches 518a in each layer. The number of third latches 518a in different layers is the same, and in two adjacent layers of third latches 518a, the curvature of two adjacent third latches 518a in one layer is the same as the curvature of two adjacent third latches 518a in the other layer. This allows for multiple quantitative dispensing of liquid, facilitates the smooth entry of each layer of third latches 518a into the slide groove 620f, improves the fixing effect of the slide groove 620f on the third latches 518a and the push rod 50, and enhances the stability of the push rod 50 maintaining a constant height after each layer of third latches 518a enters the circumferential rotation groove 620f1.
[0250] Further, refer to Figure 44 It is understood that there can be two third clips 518a in each layer. This not only improves the fixing effect of the slide groove 620f on the third clips 518a and the push rod 50, but also improves the stability of the push rod 50 after each layer of third clips 518a enters the circumferential rotation groove 620f1, and simplifies the structure of the device.
[0251] Further, refer to Figure 44 It is understood that among the third clips 518a located on the same layer, the arc corresponding to two adjacent third clips 518a can be 100°~180°, for example, it can be 100°, 120°, 135°, 150°, 165° or 180°, or it can be any range of the above values. Optionally, the arc corresponding to two adjacent third clips 518a can be 180°.
[0252] In some embodiments of this application, reference is made to Figure 44 It is understood that the push rod 50 may include two layers of third latches 518a, with two third latches 518a in each layer, and the arc corresponding to two adjacent third latches 518a in one layer is the same as the arc corresponding to two adjacent third latches 518a in the other layer.
[0253] It is understandable that in the sample processing device, the number and location of the chute 620f are matched with the number of layers of the third buckle 518a, and the number and location of the third buckle 518a in each layer.
[0254] In some embodiments of this application, reference is made to Figure 47 , Figure 48 or Figure 49It is understood that the deformable part 518 may include a plurality of deformable beams 518b spaced circumferentially along the push rod 50, and each deformable beam 518b may independently have at least one third latch 518a. Therefore, the overall distribution of the third latches 518a on the push rod 50 can be controlled by adjusting the number of deformable beams 518b and the distribution of the third latches 518a on the deformable beams 518b. Optionally, the third latches 518a may be arranged in a one-to-one correspondence with the deformable beams 518b, with one third latch 518a provided on each deformable beam 518b.
[0255] In some embodiments of this application, reference is made to Figure 46 It is understood that the distance between the outer peripheral wall of the inlet end 620f3 of the slide groove 620f and the axis of the cylinder 60 can be greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove 620f1 and the axis of the cylinder 60. Optionally, the distance between the outer peripheral wall of the inlet end 620f3 of the slide groove 620f and the axis of the cylinder 60 can be greater than the distance between the outer peripheral wall of the circumferential rotation groove 620f1 and the axis of the cylinder 60, which is more conducive to the third latch 518a extending into the circumferential rotation groove 620f1 through the inlet end 620f3.
[0256] In some embodiments of this application, reference is made to Figure 46 It is understood that the distance from the connection point between the inclined groove 620f2 of the slide groove 620f and the cylinder 60 near the push rod inlet 621 to the axis of the cylinder 60 gradually decreases in the direction away from the circumferential rotation groove 620f1. This facilitates a gradual increase in the compressive force on the third latch 518a and the deformable part 518, enabling the third latch 518a to move along the inclined plane or perpendicular to the inclined plane, thus fulfilling the downward pressing requirement of the push rod 50.
[0257] In some embodiments of this application, reference is made to Figure 46 It is understood that the distance from the connection point between the inclined groove 620f2 of the chute 620f and the cylinder 60 near the outlet 622 of the collection section to the axis of the cylinder 60 and the distance from the inner wall of the cylinder 60 to the axis of the cylinder 60 can be the same. This allows the overall inner diameter of the cylinder 60 to remain unchanged, further facilitating the movement of the push rod 50 along the length of the cylinder 60.
[0258] In some embodiments of this application, the inclined groove 620f2 of the chute 620f can be provided on the side of the circumferential rotation groove 620f1 extending circumferentially along the inner wall of the cylinder 60, or it can be provided on the side of the circumferential rotation groove 620f1 facing into the cylinder 60, or it can be provided on the side of the circumferential rotation groove 620f1 facing into the cylinder and close to the collection section outlet 622 and extending away from the circumferential rotation groove 620f1 in the direction of the cylinder 60.
[0259] In some embodiments of this application, the third latch 518a can be a deformable latch. This further facilitates the deformation of the deformable part 518 under the compression of the inclined groove 620f2, thereby fulfilling the downward pressing requirement of the push rod 50.
[0260] In some embodiments of this application, the deformable portion 518 may be an elastically deformable portion. For example, the deformable portion 518 may include an elastically deformable beam and / or an elastic buckle. It should be noted that the specific material of the elastically deformable portion is not particularly limited, and those skilled in the art can flexibly choose according to actual needs, for example, they can choose common elastically deformable materials in the field.
[0261] In some embodiments of this application, reference is made to Figure 49 It is understood that the deformable beam 518b may include a cantilever beam, and the third clip 518a located on the cantilever beam may be provided at the free end of the cantilever beam.
[0262] In some embodiments of this application, reference is made to Figure 47 or Figure 48 It is understood that the deformable beam 518b may include a double-ended fixed beam, and the third buckle 518a located on the double-ended fixed beam may be provided between the two ends of the double-ended fixed beam.
[0263] In some embodiments of this application, reference is made to Figure 52 It is understood that a second break 518c may be provided on the side of the double-ended fixed beam near the distal sealing part 512. This facilitates the deformation of the deformable part 518 after use, allowing it to undergo irreversible deformation. Figure 53 The diagram shows the deformable beam 518b undergoing irreversible deformation at the second fracture 518c after use, thus preventing the push rod 50 from being reused multiple times.
[0264] In some embodiments of this application, when the cylinder 60 includes an outer cylinder 60a and an inner cylinder 60b, and the outer cylinder 60a is sleeved on the inner cylinder 60b, the sliding groove 620f can be provided on the inner cylinder 60b.
[0265] To facilitate understanding of the specific method of controlling quantitative liquid output when the sample processing device of this application enriches the target substance in the liquid, Scheme 1 is used as an example for illustrative explanation below.
[0266] Specifically, refer to Figure 29 , Figure 31 and Figure 38To illustrate, consider a cylinder structure as follows: "The cylinder 60 includes an outer cylinder 60a and an inner cylinder 60b, with the outer cylinder 60a fitted onto the inner cylinder 60b, forming a first waste liquid chamber 60c between them. The side of the inner cylinder 60b near the collection section outlet 622 is communicatively connected to the first waste liquid chamber 60c." An aluminum membrane is provided as a sealing layer 623 at the collection section outlet 622, and a permeable membrane is provided as a target substance enrichment layer 70 near the push rod inlet at the connection between the inner cylinder 60b and the first waste liquid chamber 60c. (Refer to...) Figure 44 , Figure 45 and Figure 54 For example: Step S1: Add the liquid sample to be processed into the cylinder 60 through the push rod inlet 621; Step S2: Position the push rod 50 according to... Figure 54 Insert it into the cylinder 60 in the direction shown until the first layer third buckle 518a enters the inlet end 620f3 of the slide groove 620f and cannot be pressed down further; Step S3: Keep the height of push rod 50 unchanged and rotate clockwise so that the first layer third buckle 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to air pressure for the first time, flows through the permeation membrane and enters the first waste liquid chamber 60c. However, the first layer third buckle 518a is restricted by the circumferential rotation groove 620f1 and cannot bounce up in accordance with the air pressure. Step S4: Press down further. At this time, the first layer third buckle 518a is located at the inclined groove 620f2, and the push rod 50 can be pressed down until the second layer third buckle 518a enters the inlet end 620f3 of the slide groove 620f and cannot be pressed down further. Step S5: Keep the height of push rod 50 unchanged and rotate clockwise so that the second layer third buckle 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to air pressure for the second time, flows through the permeation membrane and enters the first waste liquid chamber 60c. However, the second layer third buckle 518a is restricted by the circumferential rotation groove 620f1 and cannot bounce up in accordance with the air pressure. Step S6: Press down further. At this point, the second layer third buckle 518a is located at the inclined groove 620f2. The push rod 50 can be pressed down until it is fully inserted. At this point, the liquid is subjected to air pressure for the third time, passing through the permeation membrane and flowing into the first waste liquid chamber 60c. During this process, the push rod 50 can be continuously and slowly pushed until the collection part 511 penetrates the sealing layer 623, extends out of the cylinder 60, and brings out the target substance enrichment layer 70, thus achieving the enrichment of the target substance. Then, the breakable part 514 of the push rod 50 is broken off, so that the collection part 511 with the target substance enrichment layer 70 is transferred to the liquid collection tube 21 of the detection device for subsequent detection.
[0267] It is understandable that when the sample processing device structure of Scheme 2 is adopted and a pusher with a waste gas chamber is used, the same operation can be used to achieve the enrichment and transfer of the target substance.
[0268] Therefore, the detection system of this application can integrate sample pretreatment, target substance enrichment and waste liquid collection into one integrated system. Not only is the device compact and easy to operate, but it can also achieve non-contact transfer and sealed detection of the enriched target substance, reducing the risk of target substance loss and / or cross-contamination during the transfer process, which may lead to a decrease in detection accuracy. This facilitates the efficient, safe and pollution-free execution of the entire process, overcoming the shortcomings of traditional technologies such as complex processing, easy cross-contamination and low sample utilization efficiency.
[0269] It should be noted that the features and advantages described above for the detection device also apply to this detection system, and will not be repeated here.
[0270] The experimental examples described below are exemplary and are used only to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the experimental examples, they should be performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0271] Experimental Example. Detection of novel coronavirus in upper respiratory tract saliva samples using the detection system of this application.
[0272] Instruments and Materials
[0273] 1. Sample processing device: including a matching push rod 50 and a cylinder 60, as well as a target material enrichment layer 70 and a sealing layer 623, wherein the assembly structure of the push rod 50 and the cylinder 60 is as follows: Figure 44 As shown, the cylinder 60 includes an inner cylinder 60b and an outer cylinder 60a, and the connection and assembly structure of the inner cylinder 60b and the outer cylinder 60a is the same as... Figure 29 As shown, the target substance enrichment layer 70 is made of polyethersulfone (PES) membrane (micropore size 0.45 µm, Corbett), and the sealing layer 623 is made of aluminum membrane. A cross-sectional view of the sample processing device near the outlet of the collection section after assembly is shown below. Figure 38 As shown.
[0274] 2. Saliva collection tube (Sarstedt, Germany); 3. Microcentrifuge tubes (1.5 mL, 0.1 mL); 4. Centrifuge (Thermofisher); 5. Pipettes and filter tips; 6. Thermofisher; 7. Detection device: including clamping mechanism 10, sealing mechanism 20, cutting mechanism 30 and detection mechanism 40, the assembly drawing of which is shown below. Figure 2 As shown, nucleic acid chromatography test strips are used in the detection modules of 40 testing institutions.
[0275] 8. Constant Potentiometer (Shanghai Chenhua); 9. Screen-printed carbon electrodes.
[0276] [Reagents]
[0277] 1. Novel coronavirus pseudoviruses (Fubai Ao), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), Bordetella pertussis (ATCC 9340)
[0278] 2. Saliva from healthy volunteers
[0279] 3. LAMP reaction system containing probes: LAMP reaction master mix (NEB) LAMP Primer Mix for Novel Coronavirus Testing (Sangon Biotech (Shanghai) Co., Ltd) Primer and probe sequences: E1-F3 TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 1) E1-B3 TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 2) E1-FIP ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG (SEQ ID NO: 3) E1-BIP TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO: 4) E1-LF FAM-CGCTATTAACTATTAACG (SEQ ID NO: 5) E1-LB Biotin-GCGCTTCGATTGTGTGCGT (SEQ ID NO: 6) Sample preparation and pretreatment 1. Place 10 6 Copy numbers of the novel coronavirus pseudoviruses (Fauci), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), and Bordetella pertussis (ATCC 9340) were added to 1 mL of saliva from healthy volunteers.
[0280] 2. The saliva sample containing the novel coronavirus pseudovirus was added to the saliva collection tube, with a ratio of approximately 4:1 to the preservation solution in the collection tube.
[0281] 3. Eddy oscillation for 5-10 seconds followed by instantaneous centrifugal force.
[0282] 4. Incubate at room temperature for 10 minutes.
[0283] [Enrichment of the analyte]
[0284] refer to Figure 54 : S1: Load the 1 mL sample obtained after sample pretreatment into the cylinder 60 of the sample processing device; S2: Press the push rod 50 into the cylinder 60 until the first layer third latch 518a enters the inlet end 620f3 of the slide groove 620f (reference). Figure 44 , Figure 45 (Understanding) but cannot push it down further.
[0285] S3: Keep the height of push rod 50 constant, and follow the direction from the inlet end 620f3 of the slide groove 620f to the circumferential rotation groove 620f1 (e.g. Figure 54 (As shown by the black arrow in S3) Rotate the push rod 50 so that the first layer third buckle 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to air pressure for the first time, passes through the target material enrichment layer 70 and enters the first waste liquid chamber 60c. However, the first layer third buckle 518a is restricted by the circumferential rotation groove 620f1 and cannot bounce up in accordance with the air pressure. S4: Press down further. At this time, the first layer third buckle 518a is located at the inclined groove 620f2. The push rod 50 can be pressed down until the second layer third buckle 518a enters the inlet end 620f3 of the slide groove 620f and cannot be pressed down further. S5: Keep the height of push rod 50 unchanged, rotate push rod 50 in the direction from the inlet end 620f3 of slide groove 620f to the circumferential rotation groove 620f1, so that the second layer third buckle 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to air pressure for the second time, passes through the target material enrichment layer 70 and enters the first waste liquid chamber 60c. However, the second layer third buckle 518a is restricted by the circumferential rotation groove 620f1 and cannot bounce up in accordance with the air pressure. S6: Press down further. At this point, the second layer third buckle 518a is located at the inclined groove 620f2. The push rod 50 can be pressed down until it is fully inserted. At this point, the liquid is subjected to air pressure for the third time, passing through the target material enrichment layer 70 and entering the first waste liquid chamber 60c. During this process, the push rod 50 can be pushed slowly until the peeling part 511a of the push rod 50 peels off the target material enrichment layer 70 and pierces the aluminum film, bringing the target material enrichment layer 70 out of the cylinder 60. At this point, the break point of the breakable part 514 is also located outside the cylinder 60. S7: Break the push rod 50 along the fracture point of the breakable part 514, so that the target material enrichment layer 70 is transferred with the collection part 511 for inspection.
[0286] [Detection of analyte]
[0287] S8: Transfer the target substance enrichment layer 70, which was broken off in S7, along with the collection unit 511 to the liquid collection tube 21 (the liquid collection tube 21 contains LAMP reactants, the composition of which is shown in Table 1, and the tube wall of the liquid collection tube 21 is provided with phase change material 211 paraffin near the tube opening, and the broken target substance enrichment layer 70 is placed in the liquid collection tube 21 along with the collection unit 511 to ensure that the target substance enrichment layer 70 is fully immersed), and then place the liquid collection tube 21 into the first mounting port 101 on the clamping mechanism 10, and turn on the heating component 12 (refer to...). Figure 8 (In step b, set the temperature to 37℃ for 5 minutes, then increase the temperature to 67℃ for 30 minutes). After the reaction is complete, remove the heating element 12. S9: Remove the support mechanism 223 and press down the clamping mechanism 10 in the first direction. The clamping mechanism 10 is pressed down in the first direction with the cooperation of the first groove 13 on it and the upper limit block 22 of the sealing mechanism 20, and with the cooperation of the through groove 103 on the clamping mechanism 10 and the guide post 23 on the sealing mechanism 20. After the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down again. The squeezing component 41 squeezes the liquid collection tube 21 to release liquid. When the reaction liquid in the liquid collection tube 21 flows through the sample pad 433, the reaction liquid will flow along the test strip 432. The result will be displayed on the display area of the test strip 432.
[0288] Table 1 LAMP reactants in the container
[0289]
result
[0290] refer to Figure 55 As the FAM and biotin probes are inserted into the double-stranded product during amplification, the antibodies on the detection band of the nucleic acid chromatography test strip can trap this product, resulting in a red colloidal gold aggregation band. Therefore, a positive amplification product should show two bands on the test strip, while a negative one should show only one band. The figure shows that after enrichment with this device, the pseudovirus of the novel coronavirus, after LAMP amplification, exhibits a distinct two-band characteristic on the test strip, while other test strips (Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), Bordetella pertussis (ATCC 9340) and the negative control) only show one band. This demonstrates that the detection system of this application can achieve the enrichment and detection of the target substance, the pseudovirus of the novel coronavirus.
[0291] The present application has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to it, and it can be combined arbitrarily as needed, which is obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present application fall within the scope of protection claimed in this application.
Claims
1. A detection device, comprising: A clamping mechanism, wherein a heating chamber is provided inside the clamping mechanism, a first through mounting port is provided at the top of the heating chamber, and a heating component is provided in the heating chamber; A sealing mechanism is located below the clamping mechanism. The sealing mechanism includes a through hole that extends through the sealing mechanism along a first direction. The through hole cooperates with the first mounting port to accommodate a liquid-containing tube. The inner wall of the liquid-containing tube near the port is provided with a phase change material. An elastic support assembly is provided at the upper end of the through hole. A cutting mechanism is located within the through hole and is configured to contact and cut the liquid-holding tube when the clamping mechanism is pressed down in the first direction. as well as The detection mechanism is located on the side of the cutting mechanism away from the clamping mechanism and is sealed to the sealing mechanism; the detection mechanism is provided with a squeezing component, which is configured to squeeze the liquid-holding tube to deform and release liquid after the clamping mechanism is pressed down along the first direction to the bottom of the liquid-holding tube and cut by the cutting mechanism; The extrusion assembly is located directly below the cutting mechanism.
2. The detection device according to claim 1, wherein, The heating chamber has a second mounting port on its first side wall, and the heating assembly is detachably mounted in the second mounting port.
3. The detection device according to claim 2, wherein, The heating component is configured to heat the phase change material inside the liquid-containing tube when it is inserted into the second mounting port.
4. The detection device according to any one of claims 1-3, wherein, The side wall of the heating chamber is also provided with a through groove extending along the first direction, and the sealing mechanism is provided with a guide post extending along the first direction. The through groove and the guide post are correspondingly arranged and adapted to be embedded in the through groove when the clamping mechanism is pressed down along the first direction.
5. The detection device according to claim 4, wherein, The heating chamber has a second mounting port on its first side wall, and the guide post is located on the sealing mechanism on the side away from the second mounting port.
6. The detection device according to claim 1 or 5, wherein, The upper end of the through hole is provided with a first elastic sealing ring, and a support component is provided on the first elastic sealing ring.
7. The detection device according to claim 1 or 5, wherein, The heating chamber further includes a second sidewall and a third sidewall disposed opposite to each other. The second sidewall and / or the third sidewall are provided with a first groove. The first groove extends from the side of the clamping mechanism near the sealing mechanism along the first direction through at least a portion of the second sidewall and / or the third sidewall.
8. The detection device according to claim 7, wherein, The sealing mechanism further includes a limiting block, which is disposed corresponding to the first groove and is adapted to be embedded in the first groove when the clamping mechanism is pressed down along the first direction.
9. The detection device according to claim 8, wherein, The first groove is provided on both the second sidewall and the third sidewall.
10. The detection device according to claim 1 or 9, wherein, The sidewall of the sealing mechanism is also provided with buckles spaced apart along the first direction. The bottom of the sidewall of the clamping mechanism forms a first flange facing the inside of the clamping mechanism. The buckles are configured to cooperate with the first flange to restrict the clamping mechanism from moving upward when the clamping mechanism is pressed down along the first direction.
11. The detection device according to claim 10, wherein, The latch includes a first latch and a second latch. The first latch is located above the second latch. The first latch is configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism when the clamping mechanism is pressed down along the first direction to the bottom of the liquid-holding tube and contacts the cutting mechanism. The second latch is configured to cooperate with the first flange to restrict the upward movement of the clamping mechanism after the clamping mechanism is pressed down along the first direction to the bottom of the liquid-holding tube and cut by the cutting mechanism.
12. The detection device according to claim 11, wherein, The sealing mechanism has multiple first buckles and / or multiple second buckles on its side wall.
13. The detection device according to claim 8 or 12, wherein, The heating chamber further includes a second sidewall and a third sidewall disposed opposite to each other, and the second sidewall and / or the third sidewall is provided with a first groove; the sealing mechanism further includes a limiting block, the limiting block including a first limiting block and a second limiting block disposed at intervals along the first direction, the first limiting block being disposed above the second limiting block, the first limiting block being configured to be embedded in the first groove when the clamping mechanism is not pressed down, and the second limiting block being configured to be embedded in the first groove along with the first limiting block when the clamping mechanism is pressed down along the first direction.
14. The detection device according to claim 13, wherein, The sealing mechanism further includes a support mechanism, which is detachably disposed between the first limiting block and the second limiting block. The support mechanism is configured to support the lower end of the clamping mechanism when the clamping mechanism is not pressed down.
15. The detection device according to claim 1 or 14, wherein, The clamping mechanism also includes an observation port.
16. The detection device according to claim 1 or 14, wherein, The melting point of the phase change material is 40℃-120℃.
17. The detection device according to claim 1 or 14, wherein, The top of the heating chamber is provided with one or more of the first mounting ports.
18. The detection device according to claim 2 or 14, wherein, The heating chamber has a second mounting port on its first side wall. The sealing mechanism includes a first sealing part and a second sealing part. The through hole is located in the first sealing part. The second sealing part is connected to the end of the first sealing part away from the second mounting port. The detection mechanism extends from the first sealing part to the second sealing part.
19. The detection device according to claim 18, wherein, The second sealing part is provided with an observation window.
20. The detection device according to claim 18, wherein, The side wall of the heating chamber is also provided with a through groove extending along the first direction, and the sealing mechanism is provided with a guide post extending along the first direction. The guide post is located on the first sealing part near the second sealing part.
21. The detection device according to claim 1 or 19, wherein, The testing mechanism includes a testing module, which includes one or more of a test strip testing module, an electrochemical testing module, and an optical testing module.
22. A detection system comprising the detection device according to any one of claims 1-21.
23. The detection system according to claim 22, wherein, It also includes a sample processing device, which is connected to the detection device.
24. The detection system according to claim 23, wherein, The sample processing device includes: A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part; A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling section at its end away from the proximal operating section. The peeling section is configured to peel off the target substance enrichment layer and carry it out of the cylinder when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device. Alternatively, the target substance enrichment layer is disposed on the side of the collection section away from the proximal operating section, and is configured to be carried out of the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device.
25. The detection system according to claim 24, wherein, The distance between the outer peripheral wall of the collecting part and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the axis of the push rod; and / or The sealing layer is a waterproof layer or a first waterproof and breathable layer; and / or, The push rod is also provided with a breakable part, which is located between the collection part and the remote sealing part.
26. The detection system according to claim 25, wherein, The push rod also has a breakable portion, the distance between the outer peripheral wall of the breakable portion and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the collection portion and the axis of the push rod; and / or The breakable portion includes a first fracture.
27. The detection system according to claim 26, wherein, The breakable portion includes one or more of the first fractures, which are continuous or spaced apart along the circumference of the push rod.
28. The detection system according to claim 24, wherein, The target material enrichment layer is a porous layer; and / or, The target substance enrichment layer includes filter materials and / or adsorption materials; and / or, The target substance enrichment layer is configured to allow the retention of natural biological carriers of nucleic acids in biological samples; and / or, The pore size of the target material enrichment layer is 0.1 μm to 5 μm; and / or, The target substance enrichment layer includes an adsorbent material adapted to specifically bind to the target substance; and / or, The target material enrichment layer includes one or more of the following: nitrocellulose (NC) layer, cellulose acetate (CA) layer, polyethersulfone (PES) layer, polytetrafluoroethylene (PTFE) layer, polyvinylidene fluoride (PVDF) layer, nylon layer, regenerated cellulose layer, modified cellulose layer, and glass fiber layer; and / or, The distal sealing portion is an elastic sealing portion; and / or, The distal sealing portion includes a sealing ring and / or a piston; and / or, A pressing part is provided on the side of the proximal operating part away from the distal sealing part.
29. The detection system according to claim 24, wherein, A pressing part is provided on the side of the proximal operating part away from the distal sealing part, and the distance from the outer peripheral wall of the pressing part to the axis of the push rod is greater than the distance from the outer peripheral wall of the distal sealing part to the axis of the push rod.
30. The detection system according to any one of claims 24-29, wherein, The end of the collection unit away from the proximal operating unit is provided with a peeling part, and the side of the peeling part away from the proximal operating unit is provided with a protrusion.
31. The detection system according to claim 30, wherein, The protrusion has a pointed tip; and / or, The peeling portion includes a plurality of protrusions, with adjacent protrusions spaced apart, and / or, The plurality of protrusions enclose a second groove on one side facing the proximal operating portion, the second groove being adapted to hold the target material enrichment layer.
32. The detection system according to claim 24 or 31, wherein, The cylinder includes an outer cylinder and an inner cylinder. The outer cylinder is sleeved on the inner cylinder. A first waste liquid chamber is provided between the outer cylinder and the inner cylinder. The side of the inner cylinder near the outlet of the collection section is connected to the first waste liquid chamber. The inner wall of the inner cylinder is sealed to the distal sealing part, and the inner wall of the inner cylinder is movable relative to the push rod.
33. The detection system according to claim 32, wherein, The inner cylinder is connected to the outer cylinder by thread, snap-fit, riveting, welding, or bonding; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device; and / or, The first waste liquid chamber is provided with a first vent, and a second waterproof and breathable layer is provided at the first vent; and / or, The target substance enrichment layer is disposed within the inner cylinder, and is located at the communication point between the inner cylinder and the first waste liquid chamber, or at the communication point between the inner cylinder and the first waste liquid chamber on the side near the push rod inlet; and / or, The inner cylinder has a flow channel on the side near the outlet of the collection section. The inner cylinder is connected to the first waste liquid chamber through the flow channel. The target substance enrichment layer is disposed in the inner cylinder and is located at the flow channel or on the side of the flow channel near the push rod inlet; and / or, The target material enrichment layer is bonded to the inner cylinder, welded together, connected through a plastic structure, or connected through a sealing ring.
34. The detection system according to claim 32, wherein, The inner cylinder has a flow channel on the side near the outlet of the collection section. The flow channel includes a first flow channel, which is located on the side wall of the inner cylinder and penetrates the side wall of the inner cylinder in the radial direction; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The first waste liquid chamber is equipped with a first waste liquid detection device, and the outer cylinder is equipped with a first viewing window, which is configured to display the detection result of the first waste liquid detection device; and / or, The first waste liquid chamber is equipped with waste liquid absorption material.
35. The detection system according to claim 34, wherein, The inner cylinder is provided with a first flow channel on the side facing the outlet of the collection section, and the outer peripheral wall of the inner cylinder is provided with a first thread on the side facing the outlet of the collection section. The inner peripheral wall of the outer cylinder is provided with a second thread on the side near the outlet of the collection section. The second thread is screwed into the first thread. The first thread and / or the second thread are provided with a second flow channel. The first flow channel is connected to the first waste liquid chamber through the second flow channel.
36. The detection system according to any one of claims 33-35, wherein, The inner cylinder has a first flow channel and a stepped portion on the side facing the outlet of the collection section. The stepped portion is connected to the inner wall of the inner cylinder in the radial direction and extends into the inner cylinder. The stepped portion is located on the side of the first flow channel near the push rod inlet and is permeable to the collection section, and satisfies one of the following conditions: (1) The target material enrichment layer is bonded to the step surface of the step portion; (2) The target material enrichment layer is fixed to the step surface of the step portion by a sealing ring; (3) The target material enrichment layer is fixed between the step portion and the first flow channel by a sealing ring. One side of the sealing ring along its thickness direction abuts against the step surface of the step portion, and the other side abuts against the inner wall of the outer cylinder. The sealing ring is provided with a third flow channel penetrating its radial side wall, and the third flow channel is connected to the first flow channel.
37. The detection system according to claim 36, wherein, The target material enrichment layer is fixed to the step surface of the step portion or between the step portion and the first flow channel by a sealing ring, and the sealing ring is a second elastic sealing ring.
38. The detection system according to any one of claims 24-29, wherein, The push rod has a cavity, which includes a second waste liquid cavity extending along the length of the push rod and an open inner cavity. The open inner cavity is located on the side of the second waste liquid cavity away from the proximal operating part and is communicative with the second waste liquid cavity. The opening of the open inner cavity is located on the side of the collection part away from the proximal operating part. The target substance enrichment layer is located on the push rod and at the opening of the open inner cavity or inside the open inner cavity.
39. The detection system according to claim 38, wherein, A one-way valve is provided between the second waste liquid chamber and the open inner cavity, the one-way valve being adapted to open when the pressure in the open inner cavity is greater than that in the second waste liquid chamber; and / or, The push rod also has a breakable portion, which is located on the outer wall of the open inner cavity and on the side of the target material enrichment layer near the proximal operating part; the second waste liquid chamber is located on the side of the breakable portion near the proximal operating part; and / or The second waste liquid chamber is equipped with a second waste liquid detection device; and / or, The second waste liquid chamber is provided with a second vent, and the second vent is provided with a third waterproof and breathable layer; and / or, The target material enrichment layer is bonded to the push rod, welded together, connected through a plastic structure, or connected through a sealing ring.
40. The detection system according to claim 39, wherein, The second waste liquid chamber is equipped with a second waste liquid detection device, which includes one or more of pH test paper, chromatography test paper, and electrochemical detection device; and / or, The second waste liquid chamber is equipped with a second waste liquid detection device, and the push rod is equipped with a second viewing window, which is configured to display the detection result of the second waste liquid detection device; and / or, The second waste liquid chamber is equipped with waste liquid absorption material.
41. The detection system according to any one of claims 24, 37 or 39, wherein, The push rod also includes a deformable portion extending between the proximal operating portion and the distal sealing portion, the outer peripheral wall of the deformable portion having a third latch that protrudes radially along the push rod; The cylinder has a sliding groove at the push rod inlet, which includes a circumferential rotating groove and an inclined groove. The circumferential rotating groove is recessed from the inner wall of the cylinder in a direction away from the axis of the cylinder. The inclined groove is connected to the circumferential rotating groove and is inclined towards the inside of the cylinder and extends towards the outlet of the collection section. The circumferential rotating groove has an inlet end, which is connected to the push rod inlet. The circumferential rotating groove is configured to rotate and engage with the circumferential rotating groove when the push rod is pushed to extend the third buckle from the inlet end into the circumferential rotating groove. The inclined groove is configured to press and engage with the third buckle when the third buckle passes through the inclined groove to push the third buckle and the push rod downward.
42. The detection system according to claim 41, wherein, The deformable portion includes a deformable beam and the third latch, the deformable beam extending along the length of the push rod, and the third latch being disposed on the outer peripheral wall of the deformable beam; and / or The distance between the outer peripheral wall of the inlet end and the axis of the cylinder is greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove and the axis of the cylinder; and / or, The distance from the connection point between the inclined groove near the push rod inlet and the cylinder to the cylinder axis gradually decreases in the direction away from the circumferential rotation groove; and / or, The distance from the connection point between the inclined groove and the cylinder near the outlet of the collecting section to the axis of the cylinder is the same as the distance from the inner wall of the cylinder to the axis of the cylinder; and / or, The height of the circumferential rotating groove is 0.02mm-1mm greater than the extension distance of the third buckle along the length of the push rod; and / or, The inclined groove is disposed on one side of the circumferential rotating groove extending circumferentially along the inner wall of the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder, or the inclined groove is disposed on the side of the circumferential rotating groove facing into the cylinder and near the outlet of the collecting part and in a direction away from the circumferential rotating groove in the circumferential direction of the cylinder; and / or, The deformable portion includes one or more of the third latches, and the plurality of third latches are spaced apart along the circumferential and / or length direction of the push rod; and / or, The deformable part includes one or more of the third buckles, wherein the third buckles are deformable buckles.
43. The detection system according to claim 41, wherein, The deformable part includes a deformable beam and the third buckle: The distance between the outer peripheral wall of the deformable beam and the axis of the push rod is less than or equal to the distance between the outer peripheral wall of the distal sealing portion and the axis of the push rod; the distance between the outer peripheral wall of the third buckle and the axis of the push rod is greater than the distance between the outer peripheral wall of the distal sealing portion and the axis of the push rod; and / or The deformable beam includes a cantilever beam, and the third latch located on the cantilever beam is disposed at the free end of the cantilever beam; and / or, The deformable beam includes a double-ended fixed beam, and the third buckle located on the double-ended fixed beam is disposed between the two ends of the double-ended fixed beam; and / or The deformable beam includes a double-ended fixed beam, and the double-ended fixed beam has a second break on the side near the distal sealing part.
44. The detection system according to claim 42 or 43, wherein, The deformable part includes a plurality of deformable beams spaced apart circumferentially along the push rod, and each deformable beam is independently provided with at least one third buckle.
45. The detection system according to claim 42 or 43, wherein, The push rod includes one or more third buckles, the multiple third buckles are spaced apart along the length of the push rod, each layer has one or more third buckles, and the multiple third buckles in the same layer are spaced apart along the circumference of the push rod, and the distance between the third buckles in the same layer and the distal sealing part is equal along the length of the push rod.
46. The detection system according to claim 45, wherein, The push rod includes multiple layers of the third buckle, with multiple third buckles in each layer. The number of third buckles in different layers is the same, and in two adjacent layers of the third buckle, the arc corresponding to two adjacent third buckles in one layer is the same as the arc corresponding to two adjacent third buckles in the other layer.
47. The detection system according to claim 45, wherein, The push rod includes one or more third latches, with each layer containing two third latches; and / or, There are multiple third buckles in each layer. Among the third buckles in the same layer, the arc of two adjacent third buckles is 100°-180°.