A multi-gene editing fragment / vector / cell line, its preparation method and application

CN120905222BActive Publication Date: 2026-09-01AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511074921.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-01
Publication Date
2026-09-01
Estimated Expiration
2045-08-01

AI Technical Summary

Technical Problem

但是目前只能针对单一1个基因进行编辑,如果需要研究多基因编辑,就需要逐个基因进行编辑,如此不仅花费的时间长,研究周期长,而且对于后期细胞的状态损伤较大(细胞反复经历基因编辑的转染和药物筛选等步骤,对于细胞的状态有较大影响)

Benefits of technology

[0026]1、通过设计和筛选出针对CMAH、ANPEP、MSTM、CD163和ANTXR1基因的高效sgRNA,并经过设计和验证,将上述5个基因的sgRNA串联形成多基因编辑片段。多基因编辑片段的设计中充分考虑sgRNA的表达效率和编辑效率,并尝试多种连接方式,相比于其它设计方法,本设计序列最短,编辑效率最高。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905222B_ABST
    Figure CN120905222B_ABST
Patent Text Reader

Abstract

This invention discloses a multi-gene editing fragment / vector / cell line, its preparation method, and its applications. This multi-gene editing fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1. This fragment can be used to prepare multi-gene editing vectors and cell lines, which can then be used to prepare multi-gene-edited pigs. This multi-gene editing fragment consists of a U6 promoter and five pairs of tandem sgRNAs. Each pair of sgRNAs has undergone extensive screening and is arranged in the optimal, shortest, and most efficient manner. It can be used to simultaneously delete fragments from the five porcine genes: CMAH, ANPEP, CD163, ANTXR1, and MSTN. Due to the inventive design of this fragment, it can simultaneously target and edit five genes, significantly improving the gene editing efficiency of multi-gene editing vectors and cell lines. This lays the foundation for subsequent high-efficiency gene editing research and further provides new materials and tools for pig gene improvement or new breed breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene editing, and in particular to a multi-gene editing fragment / vector / cell line, its preparation method, and its application. Background Technology

[0002] The discovery of the CRISPR system has led to the widespread development of gene editing tools. Compared to traditional editing tools such as zinc finger endonucleases and transcription activator-like effector nucleases, CRISPR editing tools are simpler to design while maintaining high editing efficiency. Furthermore, the in-depth development of the CRISPR system has resulted in various gene editing methods that rely on it, such as gene knockout, base substitution, and gene deletion. These methods all require high gene editing efficiency. Using the CRISPR / Cas9 system, a single sgRNA can be designed to target a gene, creating a double-strand break. The cell's own repair system then inserts or deletes bases at the break site, preventing the target gene from being expressed normally, thus successfully knocking out the target gene.

[0003] However, the knockout effect of a single sgRNA on some genes is limited (for example, while a single sgRNA can knock out a gene, the knockout fragment may be too short or cannot effectively delete both chromosomes simultaneously, resulting in limited knockout effectiveness). Dual sgRNA deletion, on the other hand, can achieve gene function knockout more effectively and efficiently. Therefore, using dual sgRNAs for gene segment deletion is of great significance for gene function research. Dual sgRNAs utilize two sgRNAs simultaneously targeting both ends of the target gene sequence, creating double-strand breaks in the target gene sequence. The cell's own repair function then deletes the DNA sequence between the two sgRNAs. Because two sgRNAs are required for segment deletion, each sgRNA needs to have high editing efficiency. Therefore, designing and screening two highly efficient sgRNAs is crucial for gene editing efficiency.

[0004] Existing research has shown that knocking out certain target genes in cells can effectively resist infection by corresponding viruses, or that knocking out certain target genes can produce more desirable traits. However, current methods can only edit a single gene. If multi-gene editing is to be studied, each gene must be edited individually. This is not only time-consuming and lengthy, but also causes significant damage to the cell state in the later stages (repeated gene editing transfection and drug screening steps have a significant impact on cell state). Therefore, how to achieve simultaneous multi-gene editing while maintaining high editing efficiency has not been reported or studied. Thus, designing fragments, vectors, or cell lines capable of multi-gene editing is of great significance for research on multi-gene editing and gene modification. Summary of the Invention

[0005] The purpose of this invention is to provide a multi-gene editing fragment / vector / cell line, its preparation method, and its application, which can simultaneously delete fragments of four disease-resistant genes (CMAH, ANPEP, CD163, and ANTXR1) and one pork quality-related gene (MSTN) in the field of pig breeding, providing materials and methods to improve the efficiency of multi-gene editing.

[0006] According to a first aspect of the present invention, a multi-gene editing fragment is provided, which can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1. Therefore, this multi-gene editing fragment can be used to prepare multi-gene editing vectors and cell lines, and can simultaneously target the deletion of five genes, greatly improving gene editing efficiency and providing new materials and tools for pig gene improvement and research. Furthermore, this multi-gene editing fragment consists of a U6 promoter and five pairs of tandem sgRNAs. Each pair of sgRNAs has undergone extensive screening and represents the optimal, shortest, and most efficient arrangement and connection method, which can be used to simultaneously delete fragments of the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes, laying the foundation for subsequent efficient gene editing research.

[0007] According to a second aspect of the present invention, an application of a multi-gene editing fragment in porcine gene editing is provided. This fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes, and the nucleotide sequence of this fragment is shown in SEQ ID No:1. Thus, this application allows for the simultaneous targeting of editing and deletion of five genes, significantly improving the efficiency and effectiveness of porcine gene editing.

[0008] According to a third aspect of the present invention, an application of a multi-gene editing fragment in the preparation of multi-gene editing vectors is provided. This fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes, and the nucleotide sequence of this fragment is shown in SEQ ID No:1. Therefore, due to the efficient design and innovative linkage of this multi-gene editing fragment (optimal, shortest, and most efficient arrangement and linkage), multi-gene editing vectors prepared using this fragment can achieve efficient and stable gene editing, providing tools and materials for subsequent research.

[0009] According to a fourth aspect of the present invention, an application of a multi-gene editing fragment in the preparation of multi-gene-edited cell lines is provided. This fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1. Therefore, due to the efficient design and innovative linkage of this multi-gene editing fragment (optimal, shortest, and most efficient arrangement and linkage), the multi-gene-edited cell lines prepared using this fragment can achieve targeted deletion of five genes. The prepared cell lines can be used for subsequent research, providing new methods and tools for pig gene improvement or new breed development.

[0010] According to a fifth aspect of the present invention, an application of a multi-gene editing fragment in the preparation of multi-gene-edited pigs is provided. This fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes, and the nucleotide sequence of this fragment is shown in SEQ ID No:1. Therefore, due to the efficient design and innovative linkage of this multi-gene editing fragment (optimal, shortest, and most efficient arrangement and linkage), multi-gene-edited pigs prepared using this fragment can serve as a tool for porcine disease research and genetic improvement, providing new research tools for breeding disease-resistant pigs or improving meat quality, and can be further used for the breeding of new pig breeds.

[0011] According to a sixth aspect of the present invention, a multi-gene editing vector is provided, comprising a multi-gene editing fragment that can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of the fragment is shown in SEQ ID No:1. This vector can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. Therefore, due to the efficient design and innovative connection method of this multi-gene editing fragment (optimal, shortest, and most efficient arrangement and connection method), the multi-gene editing vector containing this fragment can simultaneously target and knock out five genes, achieving efficient and stable gene editing, and providing tools and materials for subsequent research.

[0012] In some embodiments, the nucleotide sequence of the vector is shown in SEQ ID No:3. In this vector, a multi-gene editing fragment is ligated to the Gs12-7MAX editing system to prepare a multi-gene editing vector. Gs12-7MAX (disclosed in patent 202411320266.4 as the Gs12 protein and editing system) is a subtype of the Cas12 protein, smaller in size than the conventional gene editing protein Cas9. Furthermore, the PAM sequence recognized by this protein is TTTV, enriching the gene editing selection sites. Simultaneously, because the Cas12 protein does not require tracrRNA and has self-cleaving capabilities, the Gs12-7MAX protein also does not require tracrRNA, allowing it to be directly tandemly linked with sgRNA without the need for additional cleaving enzymes. This results in a shorter sgRNA tandem sequence for Gs12-7MAX compared to Cas9. Therefore, this vector can perform multiple sgRNA tandems and be used for targeted editing of five genes, with a shorter vector sequence, easier transfection, and higher editing efficiency.

[0013] In some embodiments, the nucleotide sequence of the vector is shown in SEQ ID No:2. The vector also contains epi replicon elements. Epi replicon elements include EBNA1 and Orip, which can significantly improve gene editing efficiency by extending the gene editing time window. After transfection into target cells, plasmids containing epi replicon elements can stably exist as episomes, possessing characteristics such as nuclear transport, enhanced transcription, and immune evasion, enabling the continuous expression of the target gene carried by the vector. A replicon is the smallest functional unit capable of independent replication during DNA replication. It typically begins at an origin of replication and ends at a terminus, completing one independent replication cycle. By utilizing epi replicon elements and sgRNA in tandem, plasmids containing replicon elements can persist in cells, thereby enabling the continuous expression of gene editing elements on the plasmid within the cell, thus improving the efficiency of multi-gene deletion.

[0014] According to a seventh aspect of the present invention, an application of a multi-gene editing vector in pig gene editing is provided. The vector contains a multi-gene editing fragment that can be used to simultaneously edit the pig CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of the fragment is shown in SEQ ID No:1, or the nucleotide sequence of the vector is shown in SEQ ID No:3, or the nucleotide sequence of the vector is shown in SEQ ID No:2. Therefore, by applying this multi-gene editing vector, simultaneous knockout of five genes can be achieved, significantly improving the efficiency of gene editing in pigs.

[0015] According to an eighth aspect of the present invention, an application of a multi-gene editing vector in the preparation of multi-gene editing cell lines is provided. The vector contains a multi-gene editing fragment that can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of the fragment is shown in SEQ ID No:1, or the nucleotide sequence of the vector is shown in SEQ ID No:3, or the nucleotide sequence of the vector is shown in SEQ ID No:2. Thus, the multi-gene editing cell lines prepared using this multi-gene editing vector can achieve simultaneous knockout of five genes. The prepared cell lines can be used for subsequent research, providing new methods and tools for pig gene improvement or new breed development.

[0016] According to a ninth aspect of the present invention, an application of a multi-gene editing vector in the preparation of multi-gene-edited pigs is provided. This vector contains a multi-gene editing fragment that can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1, or the nucleotide sequence of the vector is shown in SEQ ID No:3, or the nucleotide sequence of the vector is shown in SEQ ID No:2. Therefore, multi-gene-edited pigs prepared using this multi-gene editing vector can serve as a tool for porcine disease research and genetic improvement, providing new research tools for breeding disease-resistant pigs or improving meat quality, and can be further used for the breeding of new pig breeds.

[0017] According to a tenth aspect of the present invention, a multi-gene editing cell line is provided in which the CMAH, ANPEP, CD163, ANTXR1, and MSTN genes are simultaneously knocked out. Thus, because five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN) are simultaneously knocked out in this cell line, new materials and tools can be provided for subsequent genetic improvement of pigs or the breeding of new breeds.

[0018] According to an eleventh aspect of the present invention, a method for preparing a multi-gene-edited cell line is provided. This method includes ligating the multi-gene-editing fragment into a vector containing the Gs12-7MAX protein-coding sequence, then transfecting the vector into cells and performing drug screening to obtain a multi-gene-edited cell line; or transfecting cells with the multi-gene-editing vector and performing drug screening to obtain a multi-gene-edited cell line. Thus, the cell line prepared by this method allows for the simultaneous knockout of five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN), providing new materials and tools for subsequent genetic improvement or breeding of new pig breeds.

[0019] According to a twelfth aspect of the present invention, a multi-gene editing cell line prepared using a multi-gene editing fragment is provided. This fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes, the nucleotide sequence of which is shown in SEQ ID No:1. Thus, by using the cell line prepared using this multi-gene editing fragment, five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN) can be simultaneously knocked out, providing new materials and tools for subsequent genetic improvement or breeding of new pig breeds.

[0020] According to a thirteenth aspect of the present invention, a multi-gene editing cell line prepared using a multi-gene editing vector is provided. This vector contains a multi-gene editing fragment that can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1, or the nucleotide sequence of the vector is shown in SEQ ID No:3, or the nucleotide sequence of the vector is shown in SEQ ID No:2. Thus, by using the cell line prepared using this multi-gene editing vector, five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN) can be simultaneously knocked out, providing new materials and tools for subsequent genetic improvement or breeding of new pig breeds.

[0021] According to the fourteenth aspect of the present invention, a multi-gene editing cell line prepared using the aforementioned method is provided. Thus, by using the cell line prepared by the method, five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN) can be simultaneously knocked out, providing new materials and tools for subsequent genetic improvement or breeding of new pig breeds.

[0022] According to a fifteenth aspect of the present invention, the application of the aforementioned multi-gene-edited cell line in the preparation of multi-gene-edited pigs is provided. Thus, through this application, multi-gene-edited pigs with five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN) simultaneously knocked out can be prepared, greatly improving editing efficiency.

[0023] According to a sixteenth aspect of the present invention, the application of the aforementioned multi-gene-editing cell line in pig genetic improvement is provided. Thus, this cell line can be used for pig genetic improvement, and further for improving disease resistance or meat quality in pigs.

[0024] According to the seventeenth aspect of the present invention, the application of the aforementioned multi-gene editing cell line in the breeding of new pig breeds is provided. Thus, this cell line can be used to prepare new pig breeds, improve pig genes, and enhance the basic materials and tools for improving disease resistance and meat quality traits in pigs.

[0025] The beneficial effects of this invention are:

[0026] 1. Highly efficient sgRNAs targeting the CMAH, ANPEP, MSTM, CD163, and ANTXR1 genes were designed and screened. After design and validation, the sgRNAs of these five genes were tandemly linked to form a multi-gene editing fragment. The design of the multi-gene editing fragment fully considered the expression efficiency and editing efficiency of the sgRNAs and explored various ligation methods. Compared with other design methods, this design sequence is the shortest and has the highest editing efficiency.

[0027] 2. A multi-gene editing vector is provided that directly uses the tandem combination of Gs12-7MAX protein and sgRNA to achieve highly efficient fragment deletion targeting of five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN). This vector can achieve simultaneous editing of five genes, which is efficient and convenient, providing new materials and research tools for the preparation of multi-gene-edited cell lines or multi-gene-edited pigs. Because Gs12-7MAX and sgRNA are tandemly used, the vector size can be significantly reduced, improving transfection efficiency and gene editing efficiency.

[0028] 3. A tandem vector combining epi replicon elements with tandem sgRNA is provided to achieve highly efficient editing of targeted genes. The epi replicon elements include EBNA1 and Orip, which can significantly improve gene editing efficiency by extending the gene editing time window. After transfection into target cells, plasmids containing epi replicon elements can stably exist as episomes, possessing characteristics such as nuclear transport, enhanced transcription, and immune evasion, enabling the continuous expression of the target gene carried by the vector. A replicon is the smallest functional unit capable of independent replication during DNA replication. It typically begins at an origin of replication and ends at a terminus, completing an independent replication cycle. By utilizing the tandem combination of epi replicon elements and sgRNA, plasmids containing replicon elements can persist in cells, thereby continuously expressing gene editing elements on the plasmid within the cell, thus improving the efficiency of multi-gene deletion.

[0029] 4. This invention provides a multi-gene editing cell line and its preparation method. The multi-gene editing cell line prepared using the multi-gene editing fragments or vectors of this invention can efficiently achieve targeted deletion of five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN). For example, in the prepared ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line, ANTXR1 and ANPEP are homozygous deletions, CMAH and MSTN are heterozygous deletions, resulting in a KO of the homozygous gene; CD163 is a heterozygous deletion, also resulting in a KO of the heterozygous gene. This ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line not only demonstrates the high efficiency of the multi-gene editing fragment and vector deletion system, but also provides new methods and tools for subsequent research, enabling genetic improvement or new breed development in pigs. Attached Figure Description

[0030] Figure 1 The knockout efficiency comparison results between the epiGs12-7MAX-U6-10×sg vector and the Gs12-7MAX-U6-10×sg vector are shown below: where epi vector represents transfection with epiGs12-7MAX-U6-10×sg plasmid, and ordinary vector represents transfection with Gs12-7MAX-U6-10×sg plasmid. Figures A, E, and F represent the comparison results of CMAH, ANPEP, CD163, MSTN, and ANTXR1 gene knockout efficiency, respectively. * indicates p < 0.05, ** indicates p < 0.01, and ns indicates p > 0.05.

[0031] Figure 2Images of monoclonal cells: the images are results from a 40X microscope. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] Example 1: Design of amplification sequence primers for five gene target sites and construction of sgRNA expression vectors for five gene sites.

[0035] 1.1 Validate genomic SNPs and design sgRNAs at SNP-free locations.

[0036] One pair of primers was designed targeting exon 3 of the MSTN gene (MSTN myostatin [Sus scrofa(pig)] Gene ID: 399534), one pair of primers targeting exon 15 of the ANPEP gene (ANPEP alanyl aminopeptidase,membrane [Sus scrofa(pig)] Gene ID: 397520), one pair of primers targeting exon 7 of the CD163 gene (CD163CD163 molecule [Sus scrofa(pig)] Gene ID: 397031), two pairs of primers targeting exons 1, 2, and 16 of the ANTXR1 gene (ANTXR1 ANTXR cell adhesion molecule 1 [Sus scrofa(pig)] Gene ID: 100513853), and one pair of primers targeting the CMAH gene (cytidine monophospho-N-acetylneuraminic acid). A pair of primers was designed based on exon 1 of hydroxylase [Sus scrofa (pig)] Gene ID: 396918. The designed upstream and downstream primers (primer sequences are shown in Table 1 below) were used to amplify the genome of pig fetal fibroblasts (PFFs) by PCR, yielding PCR products. After sequencing the diffused PCR products, the sequencing results were compared with the sequences obtained from NCBI, and sgRNAs were designed at SNP-free locations.

[0037] Table 1 Primer sequences

[0038]

[0039]

[0040] 1.2 Construction of expression vectors.

[0041] 1.2.1 sgRNA sequence design.

[0042] Two sgRNAs (MSTN KO sg2 and MSTN KO sg3) were designed targeting exon 3 of the MSTN gene; two sgRNAs (ANPEP KO sg6 and ANPEP KO sg8) were designed targeting exon 16 of the ANPEP gene; seven sgRNAs (CMAH KO sg1-7) were designed targeting exon 1 of the CMAH gene; nineteen sgRNAs (ANTXR1 KO sg1-19) were designed targeting exons 1, 2, and 16 of the ANTXR1 gene; and two sgRNAs (CD163 KO sg2 and CD163 KO sg10) were designed targeting exon 7 of the CD163 gene, as shown in Table 2.

[0043] Table 2. sgRNA sequences of CMAH, ANPEP, MSTM, CD163, and ANTXR1 genes.

[0044]

[0045]

[0046] 1.2.2 Synthesis of sgRNA oligonucleotide sequences.

[0047] Design the corresponding annealing primers based on the sgRNA sequences in Table 2, as shown in Table 3.

[0048] Add 5 μL each of the upstream and downstream primers of the sgRNA annealing primer to a 200 μL centrifuge tube and mix thoroughly by pipetting. Anneal the mixture at 95°C for 10 min and 65°C for 30 min. Dilute the annealed sgRNA product 10-fold with 90 μL of ddH2O for later use.

[0049] Table 3 sgRNA primer sequences

[0050]

[0051]

[0052]

[0053] Note: Some sgRNAs of the ANTXR1 gene in Table 3 share the same primers.

[0054] 1.2.3 Connection and construction of expression vectors.

[0055] The annealing product from step 1.2.3 was ligated to the backbone of the sgRNA expression vector plenti-U6-crRNA-zsGreen (disclosed in CN202411320266.4, sequence shown in SEQ ID No: 98) using DNA ligase, as shown in Table 4 below. After mixing all components, the mixture was incubated at 25°C for 10 min in a constant temperature metal bath. After ligation, the mixture was added to competent cells, followed by a 5-min ice bath, a 45-s water bath at 42°C, and a 2-min ice bath. The cells were then plated onto solid culture medium for transformation. After overnight incubation, appropriately sized single colonies were picked and placed in 1.5 ml centrifuge tubes, and 700 μL of LB liquid medium was added. The cells were incubated at 37°C and 220 rpm for 8 h on a shaker. Sequencing was performed to confirm successful vector construction before scaling up the culture and extracting the sgRNA expression vector plasmid.

[0056] Table 4 Connection System

[0057] Plenti-U6-crRNA-zsGreen digestion product 50ng Annealed products 1μL DNAligationmix 5μL <![CDATA[H2O]]> up to 10 μL

[0058] Example 2: Cellular experiments to verify the editing efficiency of different sgRNAs for each gene.

[0059] PK15 cell lines were plated in 10cm dishes, and when the cell density reached 90%–100%, the sgRNA expression vector plasmid was electroporated. 10 μg of plasmid was electroporated per 1 / 3 10cm cell culture dish. After 72 hours, the cells were sorted by flow cytometry based on green fluorescent protein (GFP) to obtain a pool of cells exhibiting green fluorescence. The genomic DNA was extracted from these cells and amplified by PCR using the primers previously used for genomic DNA amplification. The amplified products were sent to a sequencing facility, and the editing efficiency of the sgRNA was analyzed using the online website https: / / ice.editco.bio / # / . The sgRNAs with the best activity at each gene locus were selected for subsequent multi-gene editing experiments. The final selected sgRNAs with the best activity are shown in Table 5 below.

[0060] Table 5. List of effective sgRNA sequences after screening.

[0061]

[0062]

[0063] Example 3: Construction of two tandem five-gene KO vectors.

[0064] 3.1 Construction of the epiGs12-7MAX-U6-10×sg vector.

[0065] The 10 selected sgRNA sequences underwent extensive permutation screening, with the optimal, shortest, and most efficient permutation and ligation method chosen. A U6 promoter was then added to the beginning of the sequence to obtain a multi-gene editing fragment, the sequence of which is shown below (SEQ ID No:1):

[0066]

[0067] Note: In this sequence, the regular font indicates the U6 promoter; the underlined text indicates sgRNA; and the italicized and bold text indicates scaffold. The scaffold sequence is an important component of sgRNA in the CRISPR-Cas system. Its main function is to bind to Cas proteins and stabilize the secondary structure of sgRNA, thereby promoting the recognition and binding of sgRNA to target DNA.

[0068] The above-mentioned multi-gene editing fragment was cloned into the epiGs12-7MAX vector, and gene sequences such as AMP were deleted, finally synthesizing the epiGs12-7MAX-U6-10×sg vector, the sequence of which is shown in SEQ ID No:2.

[0069] epiGs12-7MAX vector construction method:

[0070] (1) The epiPE2 plasmid was digested with NotI and PmeI (the epiPE2 plasmid and its construction method have been disclosed in the literature, which is Enhancing Prime Editing Efficiency through Modulation of Methylation on the Newly Synthesized DNA Strand and Prolonged Expression) to obtain the epi backbone;

[0071] (2) Homologous arm sequences corresponding to the epi backbone were added to both ends of the Gs12-7MAX protein coding sequence (as shown in SEQ ID No: 99), and then the sequence was synthesized.

[0072] (3) The synthesized Gs12-7MAX protein coding sequence containing homologous arms was cloned into the epi backbone using homologous recombinase to obtain the epiGs12-7MAX plasmid.

[0073] Construction of 3.2Gs12-7MAX-U6-10×sg tandem vector.

[0074] 3.2.1 Vector double digestion.

[0075] Based on the epiGs12-7MAX-U6-10×sg vector, the EBNA1 and oriP elements were digested. Double digestion was performed using the restriction endonucleases NheI and AscI, and the digestion system is shown in Table 6 below:

[0076] Table 6 Enzyme digestion system

[0077] 10×rCutSmartBuffer 5μL NheI-HF 1μL AscI-HF 1μL <![CDATA[H2O]]> up to 50μL

[0078] The enzyme was digested in a 37°C constant temperature metal bath for 30 min, followed by agarose gel electrophoresis. The vector backbone was then purified and recovered according to the instructions and stored at -20°C for later use.

[0079] 3.2.2 Design and synthesis of connection segments.

[0080] The fragments in Table 7 below were synthesized to ligate the double-digested backbone described above:

[0081] Table 7. List of Connected Fragment Sequences

[0082] NheIF CTAGCAATTACTCGCAGCCCGGAA(SEQ ID No:96) AscIR CGCGTTCCGGGCTGCGAGTAATTG(SEQ ID No:97)

[0083] Take 5 μL of each of the two synthesized linear fragments, centrifuge to mix, and then anneal in a PCR instrument. The annealing program is: 95℃ for 10 min, 65℃ for 30 min. Dilute the annealed product with 90 μL of sterile water.

[0084] 3.2.3 Connection.

[0085] The annealing product from 3.2.2 and the linearized double-digested vector from 3.2.1 were ligated using the DNA Ligation Kit. The ligation system is shown in Table 8 below:

[0086] Table 8 Connection System

[0087] Annealed products 1μL DNAligationmix 5μL <![CDATA[H2O]]> up to 10 μL

[0088] Ligation was performed at 25℃ for 10 min, followed by transformation and sequencing to identify positive clones. Endotoxin was removed, and plasmids were extracted for later use. Following these steps, the Gs12-7MAX-U6-10×sg vector was successfully constructed via sequencing, and its sequence is shown in SEQ ID No:3.

[0089] Example 4: Cellular experiments demonstrate that multi-gene editing vectors can achieve targeted deletion of fragments in five genes. 4.1 Yorkshire fibroblasts were transfected with epiGs12-7MAX-U6-10×sg plasmid and Gs12-7MAX-U6-10×sg plasmid.

[0090] Yorkshire PFF cells were revived in 10cm cell culture dishes and electroporated when the cell density reached 100%. When the cell density reached 100%, electroporation was performed in three groups: the epiGs12-7MAX-U6-10×sg plasmid group (epi vector group), the Gs12-7MAX-U6-10×sg plasmid group (ordinary vector group), and the control group. Specifically, in the epiGs12-7MAX-U6-10×sg plasmid group, cells from a 1 / 3 10 cm cell culture dish were electroporated with 10 μg of epiGs12-7MAX-U6-10×sg plasmid at 520 V; in the Gs12-7MAX-U6-10×sg plasmid group, cells from a 1 / 3 10 cm cell culture dish were electroporated with 10 μg of Gs12-7MAX-U6-10×sg plasmid at 520 V; and in the control group, cells from a 1 / 3 10 cm cell culture dish were electroporated directly at 520 V without plasmid addition, serving as a negative control.

[0091] After electroporation, the cells were transferred to antibiotic-free culture medium. The next day, after observing normal cell morphology, they were enriched using POO (POO concentration: 2.5 ug / ml). After 3 days, one-third of the cell density was collected to test the editing efficiency. Then, the cells were enriched again using POO (POO concentration: 1.25 ug / ml), and after another 3 days of enrichment, one-third of the cell density was collected to test the editing efficiency. The remaining cells were cultured for 3 days, and then another one-third of the cell density was collected to test the editing efficiency.

[0092] 4.2 Verify the efficiency of the multi-gene fragment deletion vector cell pool at 3 days, 6 days, and 9 days.

[0093] The target fragment of the gene to be edited was amplified by PCR, and the amplification products were subjected to agarose gel electrophoresis. ImageLab grayscale analysis was used to determine the editing efficiency of each gene locus. Results are as follows: Figure 1 As shown: Figure 1 The epi vector indicates transfection with the epiGs12-7MAX-U6-10×sg plasmid, while the ordinary vector indicates transfection with the Gs12-7MAX-U6-10×sg plasmid. Figure 1 Figure A shows the comparison results of CMAH gene deletion efficiency. It can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector, especially on day 6, it is significantly higher than that of Gs12-7MAX-U6-10×sg vector (p<0.05). Figure 1 B shows the comparison results of ANPEP gene deletion efficiency. It can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector. Figure 1C represents the comparison results of CD163 gene deletion efficiency. It can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector, especially on day 9, it is significantly higher than that of Gs12-7MAX-U6-10×sg vector (p<0.05). Figure 1 D represents the comparison results of MSTN gene deletion efficiency. It can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector, especially on day 9, it is extremely significantly higher than that of Gs12-7MAX-U6-10×sg vector (p<0.01). Figure 1 Figure E shows the comparison results of ANTXR1 gene deletion efficiency. It is evident that the deletion efficiency of the epiGs12-7MAX-U6-10×sg vector is significantly better than that of the Gs12-7MAX-U6-10×sg vector, especially on day 6, where it is extremely significantly higher (p<0.01). These results indicate that both multi-gene editing vectors have fragment deletion efficiency at the target site, but the epiGs12-7MAX-U6-10×sg vector is significantly more efficient than the Gs12-7MAX-U6-10×sg vector. This suggests that epiGs12-7MAX-U6-10×sg can significantly improve gene fragment deletion efficiency, and the editing (deletion) advantage and efficiency of the epiGs12-7MAX-U6-10×sg vector become more pronounced and higher over time. This indicates that the epi element in the epiGs12-7MAX-U6-10×sg vector can significantly improve gene editing efficiency by extending the gene editing time window.

[0094] Example 5: Screening of cell lines with all 5 gene fragments deleted.

[0095] After electroporating Yorkshire pig PFF cells with the epiGs12-7MAX-U6-10×sg vector, serial dilutions were used to obtain 10cm cell culture dishes containing 4000 cells each. The cells were cultured in medium with a high concentration of serum (20%, normal serum concentration is 10%), with the medium changed every 2 days. After 9 days, individual cells formed clusters, such as... Figure 2As shown, cell clones were picked using a cloning loop and transferred to 48-well plates for culture. After the cells reached confluence, half of the cells were used for genotyping, while the remaining cells were transferred to 24-well plates for culture. A positive cell line was obtained and named ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line. In this cell line, the ANTXR1 and ANPEP genes were homozygous deletions (homozygous deletion: deletion occurred on both chromosomes), while the CMAH, CD163, and MSTN genes were heterozygous deletions (heterozygous deletion: deletion occurred on only one chromosome). The sequencing alignment results are shown below.

[0096] 5.1. ANTXR1 gene sequence alignment.

[0097] Wild-type cell line sequence:

[0098] ATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCATAAA

[0099] TTCATCAGGTGAGAACCATAACATGTACTTCTCTGTCATGAGTGAAACCAGCCTATGTTCGCTGT

[0100] TCCGCTAATTACTAACTGCTTTGGGGATGCTTTTTGACTAAGATAGACTCTCGGGTCTTGGAATAGAGA.

[0101] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (148bp deletion on both chromosomes): ATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTA………………………TGGAATAGAGA. 5.2, ANPEP gene sequence alignment.

[0102] Wild-type cell line sequence:

[0103] AAATACCTCAGGAAGCAGGTCGAACCCCTCTTCCAACATTTCGAAACTCTCACTAAAAACTGG

[0104] ACCGAGCGCCCAGAAAATCTGATGGACCAGTGAGTATGAGCTCGCTTGGTCTGGAGATCATGG

[0105] GTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0106] CAACTCCTGGCCGGACCAGGGCCACAGTCAGGGAGAGCGACCCCTCCCAACCCCACTCCCGG

[0107] CCCCAGGAGTAGGGACTCTGCTCTGAGGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGG

[0108] CAAAGGACCAAACTGAACCTCTGAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGC.

[0109] Sequence of ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line (chromosome 1, 279bp deletion): AAATACCTCAGGAAGCAGGTCGAACCCCTCTT………TGGGCAAAGGACCAAACTGAACCTC TGAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGC.

[0110] Sequence of ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line (chromosome 2, 281bp deletion): AAATACCTCAGGAAGCAGGTCGAACCCCT……………………TTGGGCAAAGGACCAAACTGA ACCTCTGAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGC.

[0111] 5.3. Sequence alignment of CD163 gene.

[0112] Sequence of wild-type cell line:

[0113] CCTCCTGGGGGGAGCTCACTTTGGAGAAGGAAGTGGACAGATCTGGGCTGAAGAATTCCAGT

[0114] GTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGCACCCCGCCCTGACGGGACATGTA GCC.

[0115] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 1, 88bp deletion): CCTCCTGGGGGGAGCTC……………………………………….CCGCCCTGACGGGACATGTAGCC. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, base insertion / deletion at the sg position):

[0116] CCTCCTGGGGG…………TGGAGAAGGAAGTGGACAGATCTGGGCTGAAGAATTCCAGTGTG AGGGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGC..CCCCGCCCTGACGGGACATGTAGCC. 5.4. CMAH gene sequence comparison.

[0117] Wild-type cell line sequence:

[0118] TATTTAAGAATAAGAGCCGCCTGAAGGCATGTAAGAACATGTGCAAGCACCAAGGAGGCCTCT

[0119] TCATTAAAGACATTGAGGATCTAAATGGAAGGTACTGAGAATCCTTTGCTTTCTCCCTGGCGATC

[0120] CTTTCTCCCAATTAGGTTTGGCAGGAAATGTGCTCATTGAGAAAATTTTAAATGATCCAATCAACATGCT.

[0121] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 1, 146bp deletion): TATTTTAAGAATAAGAGCCG………………………AGAGAAATTTTAAATGATCCAATCAACATGCT. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, base insertion / deletion at the sg position):

[0122] TATTTAAGAATAAGAGCC…………………AGGCATGTAAGAACATGTGCAAGCACCAAGGAGGCCTCTTCATTAAAGACATTGAGGATCTAAATGGAAGGTACTGAGAATCCTTTGCTTTCTCCCTGGC GATCCTTTCTCCCAATTAGATTTGGCAGGAAATGTGCTCAT………………………CAACATGCT. 5.5, MSTN gene sequence alignment.

[0123] Wild-type cell line sequence:

[0124] GACTCGACTGTGATGAGCACTCAACAGAATCTCGATGCTGTCGTTACCCTCTAACTGTGGATTT

[0125] TGAAGCTTTTGGATGGGACTGGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGA GAG.

[0126] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (base insertion / deletion at chromosome 1, sg position):

[0127] GACTCGACTGTGAT……TCACAGAATCTCGATGCTGTCGTTACCCTCTAACTGTGGATTTTGAAGCTTTTG……ATGC.TCTGGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGAGAG. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, 69bp deletion): GACTCGACTGTGCTC………………………………………………GGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGAGAG.

[0128] Therefore, the ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line not only demonstrates the high efficiency of multi-gene editing fragment and multi-gene editing vector deletion systems, but also provides new methods and tools for subsequent research, enabling genetic improvement or breeding of new pig breeds.

[0129] In summary, this invention discloses a multi-gene editing fragment / vector / cell line, its preparation method, and its applications. This multi-gene editing fragment can be used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1, and MSTN genes. The nucleotide sequence of this fragment is shown in SEQ ID No:1. Multi-gene editing vectors and cell lines can be prepared using this fragment, which can then be used to prepare multi-gene-edited pigs. Because the sgRNA in this multi-gene editing fragment has undergone extensive screening and creative arrangement to determine the optimal, shortest, and most efficient connection method, the final multi-gene editing fragment shown in SEQ ID No:1 is formed. Due to the creative design of this fragment, it can simultaneously target and edit five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN genes), and can greatly improve the gene editing efficiency of multi-gene editing vectors and cell lines, laying the foundation for subsequent efficient gene editing research and providing new methods and tools for pig gene improvement or new breed breeding.

Claims

1. A multi-gene editing fragment, characterized in that, The fragment is used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment is shown in SEQ ID No:

1.

2. The application of the fragment described in claim 1 in pig gene editing, or in the preparation of multi-gene editing vectors, or in the preparation of multi-gene editing cell lines, or in the preparation of multi-gene edited pigs.

3. A multi-gene editing vector, characterized in that, The vector contains the fragment described in claim 1, and the vector is used to simultaneously edit the porcine CMAH, ANPEP, CD163, ANTXR1 and MSTN genes.

4. The carrier according to claim 3, characterized in that, The nucleotide sequence of the vector is shown in SEQ ID No:

3.

5. The carrier according to claim 3, characterized in that, The nucleotide sequence of the vector is shown in SEQ ID No:

2.

6. The use of the vector described in any one of claims 3-5 in pig gene editing, in the preparation of multi-gene-edited cell lines, or in the preparation of multi-gene-edited pigs.

7. A method for preparing a multi-gene-edited cell line, characterized in that, The method includes: ligating the fragment described in claim 1 into a vector containing the Gs12-7MAX protein coding sequence as shown in SEQ ID No:99, and then transfecting the vector into cells and screening for drugs to obtain a multi-gene editing cell line; or transfecting cells into cells with the vector described in any one of claims 3-5 and screening for drugs to obtain a multi-gene editing cell line.

8. A multi-gene editing cell line prepared using the fragment described in claim 1, or a multi-gene editing cell line prepared using the vector described in any one of claims 3-5, or a multi-gene editing cell line prepared using the method described in claim 7.

9. The use of the multi-gene-edited cell line as described in claim 8 in the preparation of multi-gene-edited pigs, in pig genetic improvement, or in the breeding of new pig breeds.

Citation Information

Patent Citations

  • Endonuclease Gs12-7MAX Variant and Gene Editing System Mediated Thereby

    CN118979028B

  • Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene

    CN105518135A

  • Vector system as well as method for preparing porcine fibroblasts and gene-edited pigs

    CN113403337A

  • Disease-resistant and quality-improved pig breeding method capable of simultaneously knocking out CD163, pAPN and MSTN genes

    CN116855539A

  • Development and application of multi-gene accurate and efficient editing system

    CN118460613A