PIK3R1 gene molecular marker related to chicken egg laying quantity character and application of PIK3R1 gene molecular marker
By using genome-wide association analysis and low-depth resequencing technology, the molecular marker of the PIK3R1 gene at position 22138894 on chromosome Z of the chicken genome was discovered. Specific primers were designed for PCR amplification, which solved the problem of low breeding efficiency of the quantitative trait of chicken egg production in existing technologies, and achieved rapid and accurate breeding selection, thus improving the egg production performance in the mid-to-late stages.
Patent Information
- Application Number
- CN202511091743.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are inefficient in the selection of egg production traits in chickens, making it difficult to quickly and accurately screen out single nucleotide polymorphism sites related to mid-to-late stage egg production performance, thus affecting the breeding process and efficiency.
By using genome-wide association analysis and low-depth resequencing technology, the PIK3R1 gene molecular marker at locus 22138894 on chromosome Z of the chicken genome was discovered. Specific primers were designed for PCR amplification, and chickens with the dominant allele type were screened for breeding selection.
It enables rapid and accurate identification of quantitative traits in chicken egg production during the mid-to-late stages, improving breeding efficiency, extending the economic production cycle of laying hens, and enhancing farming benefits.
Smart Images

Figure CN120905397A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a PIK3R1 gene molecular marker related to egg number traits of chickens and an application thereof, and belongs to the technical field of biotechnology. BACKGROUND
[0002] At present, the total annual egg production in China is continuously increasing, and the poultry breeding industry has also entered a stable development stage, and it is urgent to explore new development approaches. Through the implementation of traditional breeding techniques, commercial egg chicken breeds have achieved a high level of production. Egg production performance, as an important economic trait of chicken breeding, has a significant impact on the economic benefits of the poultry industry. Although in recent decades, significant progress has been made in the selection of egg production traits through conventional breeding techniques, the selection process requires more time and resources compared to other production traits. Therefore, how to achieve a new breakthrough and improve the selection efficiency has become a top priority. Under the background of the continuous progress of animal breeding technology, perfecting the genetic improvement system of poultry breeding and providing high-precision theoretical guidance and technical methods for the poultry breeding technology system are of great significance for promoting the sustainable growth of economic benefits of the poultry breeding industry in China.
[0003] Molecular markers are important materials for genetic research. Single nucleotide polymorphism markers are widely used in human and animal genetic research due to their large number, wide distribution, and ease of accurate identification, including genetic map construction, linkage analysis, association analysis, genome prediction, etc. Single nucleotide polymorphism (SNP) markers are the third generation of genetic markers, which refer to a polymorphism caused by a single base mutation in the genomic DNA sequence. This mutation includes single base transversion, transition, insertion, and deletion. SNPs have the advantages of large quantity, high frequency, and low mutation rate, and are widely used in genome analysis, automated biological information detection, genetic research of simple and complex diseases, livestock breeding markers, and global ethnic genetics. SNP site assisted selection breeding is a selection method at the molecular level for target traits, which can be unaffected by the environment, reduce linkage drag through genetic background selection, and thus accelerate the breeding process and precision.
[0004] Genome-wide association studies (GWAS) is an important method for genetic improvement and mechanism analysis of economic traits of livestock and poultry. With the development of second-generation sequencing technology, whole-genome resequencing technology has become a powerful tool for high-throughput SNP typing. For the study of a small number of samples, the genomic information of the sample can be fully obtained through high-depth whole-genome sequencing, but for population genetics, high-depth whole-genome sequencing for large-scale samples is still too expensive. Under this background, researchers have developed a new sequencing strategy for large-scale low-depth resequencing. The strategy first performs whole-genome low-depth sequencing and variation finding on all individuals in the population, then infers the missing genotypes according to the linkage disequilibrium (LD) between SNP sites, and finally obtains high-density genetic markers at the whole-genome level for large-scale samples.
[0005] In the whole egg-laying period of chickens, it can be divided into three stages: pre-egg-laying period, peak period and late period. Among them, the number of eggs laid in the middle and late periods is one of the key indicators to measure the production performance of the laying hen population, which has a direct impact on the economic benefits of poultry production. With the growth of the age of laying hens, the egg production shows a gradually declining trend, therefore, the egg production performance in the middle and late periods is particularly critical. Maintaining a high level of egg production in the middle and late periods not only can prolong the economic production cycle of the laying hen population, but also can improve the breeding benefit. By optimizing the feeding management strategy and improving the nutritional supply, the sustained egg production of the laying hen population can be effectively promoted, thereby enhancing the market competitiveness. If single nucleotide polymorphism (SNP) sites or SNP molecular markers related to the egg production performance of hens in the middle and late periods can be screened out, it will help to provide strong theoretical support for marker-assisted selection breeding of laying hens. SUMMARY
[0006] The purpose of the present application is to provide a PIK3R1 gene molecular marker primer related to the egg number trait of chickens and its application, which provides a new way for the selection of laying hens.
[0007] The present application solves the technical problem by the following technical scheme: The present application first provides a PIK3R1 gene molecular marker related to the egg number trait of chickens, which is located at the 22138894th base of the Z chromosome of the chicken genome version Chicken(bGalGal1.broiler.GRCg7b) and exists in alleles C or T, has two genotypes of C / C and T / T, and is located upstream of the PIK3R1 gene. The nucleotide sequence of the primer corresponding to the molecular marker is shown in SEQ ID NO:1 and SEQ ID NO:2, The application obtains the above-mentioned molecular marker by the following method: determining and recording the number of eggs laid by the recessive white chicken between 210 days and 400 days, performing low-depth resequencing on 4527 hens, identifying 8,507,801 SNPs covering the entire chicken genome, using the SNPs for GWAS research on the number of eggs laid in the later period in the 4527 hen population, obtaining an extremely significantly related SNP (ChrZ:22138894) site. The SNP frequency of the SNP site in the population is counted, and it is found that the SNP site is at a medium-high frequency, and the dominant allele is T, wherein the C allele can increase the number of eggs laid in the medium-late period by 0.799, and by co-localization with the alternative splicing QTL, it is known that the site affects the number of eggs laid by affecting the alternative splicing of the PIK3R1 gene in the ovary.
[0008] The application further uses the above-mentioned molecular marker for detection of the SNP genotype related to the number of eggs laid in the middle-late period in chickens. The detection method comprises the following steps, Step 1: detecting the genotype of the sample chicken at the SNP site, collecting the biological information of the sample chicken population, and extracting DNA and then performing PCR amplification using the molecular marker primer; Step 2: performing gene detection analysis on the product obtained after amplification; Step 3: selecting the sample chicken with the dominant allele genotype from the analysis results obtained in Step 2 for breeding of the dominant line.
[0009] The length of the amplification product of the first step is 501 bp, and the amplification product contains the 22138894th base on the Z chromosome of the chicken genome version Chicken(bGalGal1.broiler.GRCg7b), and the nucleotide sequence of the amplification product is shown as SEQ ID NO:3 and SEQ ID NO:4. The amplification reaction system comprises, in a 25 μL reaction system, 1.0 μL of template DNA with a concentration of 50 ng / μL 0.5 μL of an upstream primer Forward Primer, 10 μmol / L 0.5 μL of a downstream primer Reverse Primer, 10 μmol / L 12.5 μL of 2× Taq PCR Master Mix containing Taq DNA polymerase, dNTPs, and Mg²⁺ 10.5 μL of deionized water ddH2O.
[0010] The conditions of PCR amplification reaction are initial denaturation at 95℃ for 3 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, repeating the above steps for 35 cycles, final extension at 72℃ for 5 min, and incubation at 4℃.
[0011] The screening criteria are that the SNP site is C / C genotype in the chicken with a large number of egg production in the middle and late stages.
[0012] The application has the beneficial effects of screening a molecular marker capable of rapidly and accurately identifying the genotype of an individual; the molecular marker can be used as a genetic marker for chicken breeding, and chickens with the trait of a large number of egg production in the middle and late stages are selected, thereby providing a new approach for the selection of laying hens. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 The Manhattan plot of GWAS ZOOM results of the number of eggs laid by the chicken in the middle and late stages of an embodiment of the application and the results of co-localization with the PIK3R1 gene variable splicing QTL. DETAILED DESCRIPTION
[0014] Embodiment 1 Genome-wide association analysis of the number of eggs laid by a laying hen in the middle and late stages 1. Test material A laying hen matching line is taken as the research object, blood samples of 4257 hens and phenotype records of the number of eggs laid in the middle and late stages are collected, as shown in Table 1, and applied to the application. Figure 1
[0015] 2. Chicken whole genome SNP typing and association analysis based on low-depth sequencing technology (1) TN5 transposase is used to establish a gene library for sample chickens, and whole genome resequencing is performed, all samples are sequenced on a BGI platform, the number of sequenced samples is 4527, and the sequencing depth is 0.94x; (2) Basevar is used for genotyping on the whole genome resequencing result of step (1), and STITCH is used to fill in SNP site gene data; (3) Whole genome association analysis is performed on the number of eggs laid in the middle and late stages of all sample chickens and the SNP site gene data obtained in step (2).
[0016] (4) SNP sites significantly related to the number of eggs laid in the middle and late stages: the detection of significant sites at the genome level is performed by using Bonferroni correction of independent marker numbers, and the independent marker numbers are calculated by using the PLINK indep-pairwise command.
[0017] (5) According to the standard, a QTL region that reaches the Bonferroni-corrected 5% genome-wide significance level for the number of eggs in the later stage of laying in chickens is obtained. The most significant ChrZ:22138894 site is a newly discovered SNP site, and the Manhattan plot obtained by GWAS analysis is shown in Figure 1 .
[0018] Sample collection: Collect blood or other available tissues from the sample chicken population, ensure that the samples are not contaminated, and mark the number of each sample.
[0019] DNA extraction: Use commercial DNA extraction kits (such as Tiangen, QIAGEN, etc.) to extract genomic DNA from the collected samples, and ensure that the DNA quality meets the requirements of PCR amplification.
[0020] Primer design: Design specific primers corresponding to the target SNP site, usually use online tools (such as Primer3, Primer-BLAST, etc.) for primer design, ensure that the primers can effectively amplify the target region.
[0021] PCR amplification: Use the designed primers for PCR amplification, ensure that the SNP site of each sample is amplified under appropriate temperature and time conditions.
[0022] PCR product purification: After the PCR reaction is completed, use a DNA purification kit to remove primers, dNTPs and other impurities in the reaction system to obtain purified PCR products.
[0023] Genotype detection: Use appropriate detection methods such as restriction fragment length polymorphism (RFLP), high-resolution melting curve analysis (HRM), Sanger sequencing, etc. to analyze the genotypes of PCR products and determine the genotype of each sample at the target SNP site.
[0024] Second step, select sample chickens with dominant allele genotypes for breeding of dominant lines Dominant allele screening: Screen for chickens carrying dominant alleles (such as alleles that promote egg production) from genotype data.
[0025] Breeding program design and implementation: According to the screened dominant genotypes, design breeding programs and breed dominant lines to ensure that the offspring have higher egg production performance.
[0026] Offspring evaluation and improvement: Evaluate the offspring of the breeding, continue to screen and improve the next generation according to the target traits. In the breeding population, systematically evaluate the candidate individuals, the specific operation is as follows: 1. Phenotype determination: Egg number recording period: record the total egg number of each hen in the later stage of egg production continuously; Environmental control: ensure that all candidate individuals are in consistent rearing conditions (temperature 21-23℃, light 16 h / d); Feed formula: use the national recommended standard layer feed uniformly; 2. Genotype detection: Use the obtained molecular markers for genotyping, and screen the target alleles in combination with KASP or PCR method; Sample source: about 100 µL of wing tip blood, use commercial DNA extraction kit to extract genomic DNA; DNA quality requirement: OD260 / 280 ratio between 1.8-2.0, total amount not less than 50 ng; 3. Selection and improvement strategy: Calculate GEBV by using multi-generation egg production trait phenotype and genotype joint analysis (GWAS + Genomic Selection); According to the breeding goal (such as high egg production, high stability), screen the top 30% of candidate cocks with GEBV for the next generation breeding; Carry out multi-generation continuous selection, and calculate the genetic gain per generation; When using the molecular markers to detect the target alleles, the target fragment is amplified by polymerase chain reaction (PCR), and the specific conditions of the PCR reaction are as follows: 1. The PCR reaction system (for example, 25 μL reaction system) includes: Template DNA: 1.0 μL (concentration 50 ng / μL) Forward primer (10 μmol / L): 0.5 μL Reverse primer (10 μmol / L): 0.5 μL 2× Taq PCR Master Mix: 12.5 μL (containing Taq DNA polymerase, dNTPs, Mg²⁺, etc.) Deionized water (ddH2O): 10.5 μL 2. The PCR reaction program is set as follows: Initial denaturation: 95℃, 3 min; Denaturation: 95℃, 30 s; Annealing: 58℃, 30 s; Extension: 72℃, 30 s; Cycling: The above steps were repeated for 35 cycles. Final extension: 72°C, 5 min. Hold: 4°C.
[0027] 3. PCR product detection method: The PCR amplification product was detected by 1.5% agarose gel electrophoresis; The electrophoresis condition was 120 V for 30 min using 1x TAE buffer. According to the size of the amplified fragment (e.g. 200-300 bp) combined with Marker to judge.
[0028] 4. Primer sequence and target information: Marker site: SNP ChrZ: 22138894 located on chicken chromosome Z; Forward primer (F): 5'-TTTTTACAGTTTTCCAGGGACT-3'; Reverse primer (R): 5'-TGGTCTGGTAACAGACAGCTA-3'; Amplification product length: 501 bp.
[0029] Product sequence as SEQ ID NO: 3 TTTTTACAGTTTTCCAGGGACTGGACTCTGCTACCCCATGGCTGCAGCCTTGCCCTGCTGTCACACCCTTGCGTGGTCAGATCCGTGCTCCTGCTTCAAGAGGCCTCAGGAGCTGTCATCTTCTCTCATATGCAGCTCTGAAGGGAAGCAAGTCCCAATGAATCAATGCAGAAAGGGTTAATGGGTGTCAGGAAGCATGCCAGTGCATCAGAGAAGCTTGCAAAGTCATTAACTCAATGGGGGGAAAAATTGTCTCCAAAGTAAAAGGAAGAAGCCGTGGAGGAGTATGCTTCAAAGAAATTATAACTGATAAGAGATTTCAACTACTTCCTAACACTCCAGATTTCTTGTTTTAGAACATTTTTCAGCAAAAATACCTCCAAAACCTGAAGATTCCAGAAGCATGCATATTACCTCTACCACACTTCATCAAAACCCGTTAACACCATGTTGCAGTAGAACTG TTCTCACTTTTTTTCATAGCTGTCTGTTACCAGACCA, or SEQ ID NO: 4 TTTTTACAGTTTTCCAGGGACTGGACTCTGCTACCCCATGGCTGCAGCCTTGCCCTGCTGTCACACCCTTGCGTGGTCAGATCCGTGCTCCTGCTTCAAGAGGCCTCAGGAGCTGTCATCTTCTCTCATATGCAGCTCTGAAGGGAAGCAAGTCCCAATGAATCAATGCAGAAAGGGTTAATGGGTGTCAGGAAGCATGCCAGTGCATCAGAGAAGCTTGCAAAGTCATTAACTCAATGGGGGGAAAAATCGTCTCCAAAGTAAAAGGAAGAAGCCGTGGAGGAGTATGCTTCAAAGAAATTATAACTGATAAGAGATTTCAACTACTTCCTAACACTCCAGATTTCTTGTTTTAGAACATTTTTCAGCAAAAATACCTCCAAAACCTGAAGATTCCAGAAGCATGCATATTACCTCTACCACACTTCATCAAAACCCGTTAACACCATGTTGCAGTAGAACTGTTCTCACTTTTTTTCATAGCTGTCTGTTACCAGACCA
[0030] Example 2 The SNP site (ChrZ: 22138894) was applied in the breeding of the late egg number trait in chickens. Specifically, the SNP site was detected in 4257 hens with phenotypic determination by using a low-depth resequencing method. Then, the degree of association between the site and the phenotype was detected by using whole genome association analysis. Further, variable splicing events located in the Z chromosome region were detected and quantified by using transcriptome sequencing data. The variable splicing QTL located in the Z chromosome was detected. Finally, the functional mutation site ChrZ: 22138894 was determined by using the method of colocalization.
[0031] Test materials The egg chicken complete line was taken as the research object. Blood samples of 4257 hens and mid-late egg number phenotype records were collected as shown in Table 1, and the GWAS results in Example 1. The samples were from the Guangdong Wens Group white broiler hen breeding population. Figure 1
[0032] 2. Test method The frequency of different genotypes and the effect size of alleles are calculated statistically with the most significant sites as the center.
[0033] The results show that allele C is a minor allele with a medium-high frequency of 0.32, and the allele substitution effect is -0.799, i.e. the number of eggs laid in the later stage of the hen carrying the C allele is increased by 0.799.
[0034] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and are not limited thereto; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions described in the foregoing examples can still be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
[0035] It should be additionally noted that the functional sites identified by the present application are suitable for but not limited to white-feathered broilers. Based on the principle of similarity of intraspecific genome function, other varieties of chickens are also suitable for the functional sites discovered in the present study. In addition, the examples described in the present application are only a part of the examples, not all the examples. Based on the examples in the present application, all other examples obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
Claims
1. A PIK3R1 gene molecular marker associated with chicken egg number traits, characterized in that: The molecular marker is located at the base position 22138894 of Z chromosome of chicken genome version Chicken (bGalGal1.broiler.GRCg7b), and there are alleles C or T.
2. The PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 1, characterized in that: The nucleotide sequences of the primers corresponding to the molecular marker are shown as SEQ ID NO:1 and SEQ ID NO:
2.
3. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 1, characterized in that: Detection of SNP genotype related to late-stage egg number trait in chicken.
4. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 2, characterized in that: The detection method comprises the following steps, In the first step, the genotype of the sample chicken at the SNP site is detected, the biological information of the sample chicken population is collected, and after DNA extraction, PCR amplification is performed using the molecular marker primers; In the second step, the product obtained after amplification is subjected to gene detection analysis; In the third step, the sample chickens with dominant allele genotypes are screened from the analysis results obtained in the second step for breeding of dominant lines.
5. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 3, characterized in that: The length of the amplification product in the first step is 501 bp, which contains the base position 22138894 of Z chromosome of chicken genome version Chicken (bGalGal1.broiler.GRCg7b), and the nucleotide sequence of the amplification product is shown as SEQ ID NO:3 and SEQ ID NO:
4.
6. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 3, characterized in that: The amplification reaction system in the first step comprises, in a 25 μL reaction system, Template DNA at a concentration of 50 ng / μL 1.0 μL Forward Primer, 10 μmol / L 0.5 μL Reverse Primer, 10 μmol / L 0.5 μL 2× Taq PCR Master Mix containing Taq DNA polymerase, dNTPs, and Mg²⁺ 12.5 μL Deionized water ddH2O 10.5 μL.
7. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 5, characterized in that: The PCR amplification reaction conditions are initial denaturation at 95℃ for 3 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, repeating the above steps for 35 cycles, final extension at 72℃ for 5 min, and incubation at 4℃.
8. The use of the PIK3R1 gene molecular marker related to the egg number trait of chicken according to claim 3, characterized in that: The screening standard is that the SNP site is C / C genotype chicken with more late-stage egg number.
Citation Information
Cited By
KIF26B gene molecular marker primer related to chicken continuous production character and application of KIF26B gene molecular marker primer
CN121109616A
Kif26b gene molecular marker primer associated with chicken connected trait and application thereof
CN121109616B