A molecular marker primer set, kit, and application for identifying the macadamia nut variety Yunyan 10.

Abstract

This invention discloses a molecular marker primer set, a kit, and its application for identifying the macadamia nut variety Yunyan 10. The molecular marker primer set consists of three pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing. The upstream primer of the third pair is shown in SEQ ID NO:5 of the sequence listing, and the downstream primer of the third pair is shown in SEQ ID NO:6 of the sequence listing. This molecular marker primer set can accurately identify the macadamia nut variety Yunyan 10.

Description

Technical Field

[0001] This disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer set, kit, and application for identifying the macadamia nut variety Yunyan 10. Background Technology

[0002] Macadamia nuts (Macadamia spp.), native to Australia, are a globally recognized premium edible nut and woody oilseed, earning them the title of "King of Nuts." Macadamia kernels are rich in nutrients, high in fat, primarily unsaturated fatty acids, which are beneficial for cardiovascular health. The market demand for macadamia nuts is strong, but global annual production falls far short of demand, resulting in a significant supply-demand gap. Therefore, the macadamia nut industry has a very promising future.

[0003] In recent years, my country has become a major global producer and consumer of macadamia nuts. However, the main cultivated varieties currently rely heavily on imports. The poor climate adaptability of some imported varieties leads to low yields, with yields per unit area only one-third to one-half of those in their native regions, severely restricting the industry's profitability. Simultaneously, with changes in the international trade environment and increased protection of variety rights in countries of origin, the introduction of foreign macadamia nut varieties into my country is limited, necessitating the development of new varieties with independent intellectual property rights that are adapted to the local environment.

[0004] Plant variety identification can be based on morphological characteristics, physiological and ecological traits, biochemical markers, and molecular markers. Morphological identification is intuitive and simple, but it is easily affected by environmental and human factors, has a long cycle, and is subject to seasonality. Molecular marker identification has significant advantages, is not affected by season or developmental stage, has rich polymorphism and high specificity, is rapid, efficient, and highly accurate, and has been applied to DUS testing of various plants and identification of substantial derivative varieties. Currently, macadamia nuts commonly suffer from the phenomenon of "different species with the same name" and "different names for the same species," which hinders variety breeding, intellectual property protection, and industrial promotion. Impure or incorrect seedling varieties can also harm the economic interests of practitioners, seriously affecting the healthy development of the macadamia nut industry.

[0005] Yunyan 10 is a new macadamia nut variety bred by the Yunnan Provincial Tropical Crops Research Institute. It received the Yunnan Provincial Horticultural Plant Variety Registration Certificate on January 6, 2023, certificate number: Yunlinyuanzhixindeng 20230012. Variety information can be found in: Announcement No. 2202 of the Yunnan Provincial Forestry and Grassland Bureau Horticultural Plant Variety Registration Office, 2022. Accurate identification of Yunyan 10 is crucial for its promotion and application.

[0006] Public content

[0007] To address the issue of inaccurate identification of the macadamia nut variety Yunyan 10, this disclosure provides a molecular marker primer set, kit, and application for identifying Yunyan 10. The technical solution is as follows:

[0008] On one hand, this disclosure provides a molecular marker primer set for identifying macadamia nut Yunyan 10. The molecular marker primer set consists of three pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing. The upstream primer of the third pair is shown in SEQ ID NO:5 of the sequence listing, and the downstream primer of the third pair is shown in SEQ ID NO:6 of the sequence listing.

[0009] On the other hand, this disclosure provides a kit for identifying the macadamia nut variety Yunyan 10, the kit comprising the aforementioned molecular marker primer set.

[0010] On another aspect, this disclosure provides an application of a molecular marker primer set for identifying the macadamia nut variety Yunyan 10, characterized in that the application includes: using the above-mentioned molecular marker primer set to amplify the sample to be tested and obtain the amplification product;

[0011] The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data;

[0012] The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested;

[0013] The sequencing results were analyzed to obtain different sequence types as shown in SEQ ID NO: 7 to SEQ ID NO: 44 in the sequence listing;

[0014] When the obtained sequence type is as shown in SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 32 and SEQ ID NO: 40 in the sequence list, the sample to be tested is identified as the macadamia nut variety Yunyan 10.

[0015] The application also includes: the molecular marker primer set distinguishing macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Gui Re 1, Nan Ya 116, Nan Ya 1, Nan Ya 2, Nan Ya 3 and Yun Yan 4.

[0016] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides a molecular marker primer set, kit, and application for identifying the macadamia nut variety Yunyan 10. The molecular marker primer set is used to amplify the test sample, and the obtained amplification products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Yunyan 10. Simultaneously, these differences can be used to effectively distinguish Yunyan 10 from 30 other macadamia nut cultivars: 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Gui Re 1, Nan Ya 116, Nan Ya 1, Nan Ya 2, Nan Ya 3, and Yunyan 4. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a sequence alignment diagram of the first pair of primers provided in Embodiment 3 of this disclosure.

[0019] Figure 2 This is a sequence alignment diagram of the second pair of primers provided in Embodiment 3 of this disclosure.

[0020] Figure 3 This is a sequence alignment diagram of the third pair of primers provided in Embodiment 3 of this disclosure. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below.

[0022] Example 1

[0023] This embodiment provides a molecular marker primer set for identifying the macadamia nut variety Yunyan 10. The molecular marker primer set consists of three pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first primer pair is shown in SEQ ID NO:1 of the sequence listing, specifically: GCATAGCCGTTCCCTTGAAATTTAT; the downstream primer of the first primer pair is shown in SEQ ID NO:2 of the sequence listing, specifically: GGGTTTATACGTGTCGAAGGTTAGG; the upstream primer of the second primer pair is shown in SEQ ID NO:3 of the sequence listing, specifically: CAAAATAGTTCACAACACCCACTCA; the downstream primer of the second primer pair is shown in SEQ ID NO:4 of the sequence listing, specifically: ACCTAAAATGGTTGAACAATGAGGT; the upstream primer of the third primer pair is shown in SEQ ID NO:5 of the sequence listing, specifically: AGCAACATAAGGTATATCAGTCCACA; the downstream primer of the third primer pair is shown in SEQ ID NO:6 of the sequence listing, specifically: TTGAGCTCGTTTAAAAACTATGTACT. Information regarding the three primer pairs is shown in Table 1.

[0024] Table 1 shows the relevant information for the three pairs of primers.

[0025]

[0026] Example 2

[0027] This disclosure provides a kit for identifying the macadamia nut variety Yunyan 10, which includes the molecular marker primer set provided in Example 1.

[0028] Example 3

[0029] This disclosure provides an application of a molecular marker primer set for identifying the macadamia nut variety Yunyan 10. The application includes using the molecular marker primer set provided in Example 1 to identify the macadamia nut variety Yunyan 10.

[0030] Furthermore, the application also includes: effectively distinguishing 30 macadamia nut cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Gui Re 1, Nan Ya 116, Nan Ya 1, Nan Ya 2, Nan Ya 3, and Yun Yan 4 using the molecular marker primer set provided in Example 1.

[0031] Specifically, 31 macadamia nut varieties were used as test samples, and the variety names are shown in Table 2. All 31 test samples were obtained from the Jinghong Macadamia Nursery of the Ministry of Agriculture and Rural Affairs. This nursery has complete germplasm preservation conditions and standardized management measures, and all macadamia nut varieties involved in this embodiment are planted and preserved there.

[0032] Table 2 lists the variety names of the 31 samples to be tested.

[0033]

[0034] DNA was extracted from the 31 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were performed according to the instructions for this novel plant genomic DNA extraction kit.

[0035] The DNA of 31 test samples was amplified using the molecular marker primer set provided in Example 1 of this invention. Specifically, the amplification system included: 50 ng of DNA from the test sample, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min.

[0036] After amplification, the amplification products are obtained. The amplification products are then subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data are then aligned to the macadamia nut reference genome (version number GWHBAUK00000000.1) using Bowtie2 software to obtain the sequencing results for each sample to be tested.

[0037] Based on the upstream and downstream primer sequences of the molecular marker primer pairs, e-PCR was performed using the TBtools software to verify that all three primer pairs were for specific amplification.

[0038] Based on the upstream and downstream primer sequences of the molecular marker primer pairs and the relevant information in Table 1, the target sequences of the three primer pairs on the reference genome were extracted using the software TBtools, and are represented by the numbers 01, 02 and 03, respectively.

[0039] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained 11 different sequence types. These 11 different sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, i1, j1, and k1, as shown in SEQ ID NO:7 to SEQ ID NO:17 in the sequence listing.

[0040] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 1 As shown, in Figure 1 In the sequence, the number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: GCATAGCCGTTCCCTTGAAATTTATATCACATGTTTGACTGTCCATCCGAAATCTCACGATTTCCACGTGTCGGAAAGATGCTAGCCAACCCGATACTTTATATAGCTGTTTCCTTCCCGAATTCCGACTGTAGAATGATCGTACAAAGAGTGAGAACTGTGTGAGAAGAGACTCTGCTAGAGAGACAGAAAAGGTTAGAAAGGCATCTAGTCATCAGTGAGTTTTCCTTAACGGTGGTAGCAGAATCCTAACCTTCGACACGTATAAACCC (as shown in SEQ ID NO:8 in the sequence listing), where sequence b1 is the same as the target sequence 01 on the reference genome, and the remaining sequences are different.

[0041] The second primer pair has 13 different sequence types, which are named a2, b2, c2, d2, e2, f2, g2, h2, i2, j2, k2, l2 and m2, as shown in SEQ ID NO:18~SEQ ID NO:30 in the sequence listing.

[0042] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 2As shown, the number 02 represents the target sequence of the second pair of primers on the reference genome, specifically: CAAAATAGTTCACAACACCCACTCACCTGTTGTCCCTATGAGTTGCGTATTGCCGATGACTTCATGTCGAGTTTCCTCACCGCTTGACAGCTCTATTTATAGGAAACATAAATGGTTTCTAGGTCAAGCAATATACACTCCTAATTCTCTCTTCTTATGGTGTTGATCATAACCCCCACCTCATTGTTCAACCATTTTAGGT (as shown in SEQ ID NO:21 in the sequence listing), where sequence d2 is the same as the target sequence 02 on the reference genome, and the rest of the sequences are different.

[0043] The third primer pair contains 14 different sequence types, which are named a3, b3, c3, d3, e3, f3, g3, h3, i3, j3, k3, l3, m3, and n3, as shown in SEQ ID NO:31 to SEQ ID NO:44 in the sequence listing.

[0044] The number 03 indicates the target sequence of the third pair of primers on the reference genome, specifically: AGCAACATAAGGTATATCAGTCCACAAAATTAGAATTCAATTGTCAATAACTTATTGAGACAATCCCATGTAGGACTAACTACTGGTATCAACTAGTCTCAATTGTTTTCAGTCAAGCTAACGCCATTACTGCTCATTTAGGTAATCAAGCCTCAAAGGCCAAGGTGTAGACACATTTCTATTCGTTTGGTTACTGCTCATAATTAGGCTTATACATCTTTATCAAACTATATAGTACATAGTTTTTAAACGAGCTCAA (as shown in SEQ ID NO:45 in the sequence listing).

[0045] When performing sequence alignment using the DNAMAN software, the results showed that sequence e3 was identical to target sequence 03 on the reference genome. Due to the large number of sequence types and the large size of the sequence alignment diagram, it was not clearly displayed on a single page after compression.

[0046] Variety identification involves comparing the differences between different varieties. To ensure the sequence alignment diagrams are clearly presented on one page, data processing is performed. First, 26 identical base sequences at the 5' end of 14 sequences and the 03 sequence are removed, which are the upstream primer sequences: AGCAACATAAGGTATATCAGTCCACA (as shown in SEQ ID NO:7 in the sequence listing). Then, 26 identical base sequences at the 3' end are removed, which are the reverse complementary sequences of the downstream primer sequences: AGCAACATAGTTTTTAAACGAGCTCAA (as shown in SEQ ID NO:46 in the sequence listing). These two sequences belong to the homogeneous portion of all samples tested, and the processing does not affect the variety identification results.

[0047] The sequence alignment results after removing the two ends are as follows: Figure 3 As shown, the processed sequence e3 is the same as the processed sequence 03, while the other sequences are different.

[0048] The specific genotypes of the 31 samples to be tested are shown in Table 3. To improve the efficiency of variety identification, identical genotypes of the same primer pair were not listed; that is, duplicate values ​​in the same column of genotypes in Table 3 have been removed and are only displayed as blank spaces. The only unique genotype amplified by the same primer pair, i.e., the non-blank unique value in the same column of genotypes in Table 3, is considered as the specific genotype.

[0049] Table 3 lists the specific genotypes of the 31 samples to be tested.

[0050]

[0051] As shown in Table 3, each of the 31 samples has at least one specific genotype, indicating that the molecular marker primer set provided in Example 1 of this invention can distinguish the 31 samples to be tested.

[0052] Specifically, sample number 1, which is also variety 294, has one and only one specific genotype, namely the specific genotype of the third primer pair is b3c3. Sample number 30, which is also variety Yunyan 10, has a specific genotype of b3j3 for the third primer pair. c3 and j3 are different, indicating that the third primer pair can distinguish between variety 294 and Yunyan 10.

[0053] For example, sample number 30, also a variety of Yunyan 10, has a different specific genotype from the first pair of primers used for samples numbered 2, 4, 5, 7, 12, 13, 15, 16, 18, 19, 23, 26, 27, 28, and 29. This indicates that the first pair of primers can distinguish sample number 30, also a variety of Yunyan 10, from samples numbered 2, 4, 5, 7, 12, 13, 15, 16, 18, 19, 23, 26, 27, 28, and 29.

[0054] Yunyan 10 has three specific genotypes, with the specific genotype combination being f1i1+a2e2+b3j3, which allows for accurate identification of Yunyan 10. Furthermore, based on the differences in specific genotypes and combinations, it can effectively distinguish 30 other macadamia nut varieties: 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Guire 1, Nanya 116, Nanya 1, Nanya 2, Nanya 3, and Yunyan 4.

[0055] Accuracy analysis of molecular marker primer set identification

[0056] Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of macadamia nuts. The high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.

[0057] A reproducibility experiment was conducted using 31 test samples. The results of each experiment were analyzed, and specific genotypes and combinations were recorded. See Table 4 for details.

[0058] Table 4 shows the results of the two repeated experiments.

[0059]

[0060] As shown in Table 4, the specific genotypes and combinations were identical in both replicate experiments. Therefore, the accuracy of the molecular marker primer set provided by this invention is 100%.

[0061] The third embodiment of the present invention shows that the variety identification conclusions between different laboratories or different batches of the same laboratory have a high degree of consistency, thus eliminating the need to use parallel experiments to reduce experimental errors, which greatly facilitates the identification of macadamia varieties.

[0062] This invention provides a molecular marker primer set, kit, and application for identifying the macadamia nut variety Yunyan 10. The molecular marker primer set is used to amplify the test sample, and the amplified products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Yunyan 10. Simultaneously, these differences can be used to effectively distinguish Yunyan 10 from 30 other macadamia nut cultivars: 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Gui Re 1, Nan Ya 116, Nan Ya 1, Nan Ya 2, Nan Ya 3, and Yunyan 4. The identification results are unaffected by environmental or other human factors.

[0063] This invention uses a set of highly polymorphic molecular marker primers to amplify the target sequence and compares the base differences between different varieties, thereby achieving efficient identification of macadamia nut varieties. Reproducibility experiments further verify the accuracy and reliability of this technology.

[0064] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A molecular marker primer set for identifying the macadamia nut variety Yunyan 10, characterized in that, The molecular marker primer set consists of three pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing. The upstream primer of the third pair is shown in SEQ ID NO:5 of the sequence listing, and the downstream primer of the third pair is shown in SEQ ID NO:6 of the sequence listing.

2. A kit for identifying the macadamia nut variety Yunyan 10, characterized in that, The kit includes the molecular marker primer set as described in claim 1.

3. The application of a molecular marker primer set for identifying the macadamia nut variety Yunyan 10, characterized in that, The application includes: amplifying a sample to be tested using the molecular marker primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types; When the obtained sequence type is as shown in SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 32 and SEQ ID NO: 40 in the sequence list, the sample to be tested is identified as the macadamia nut variety Yunyan 10.

Images