Aβ-tau polyepitope vaccine for preventing or treating alzheimer's disease and use thereof

Abstract

The present application relates to an A beta-Tau multi-epitope vaccine for preventing or treating Alzheimer's disease and application thereof, the immunogenic composition comprises: it comprises A beta1-16 short peptide and Tau299-303 / 362-366 short peptide; optionally, the A beta1-16 short peptide has the amino acid sequence shown as SEQ ID NO:1, and optionally, the Tau299-303 / 362-366 short peptide has the amino acid sequence shown as SEQ ID NO:2. The effect of the present application on multi-target intervention by A beta, Tau antigen epitope is better than that of single target, and experiments prove that the A beta-Tau multi-epitope vaccine targeted intervention can effectively improve the cognitive function of AD mice, and a new method is provided for the active immunotherapy of Alzheimer's disease.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to an immunogenic composition for the prevention or treatment of Alzheimer's disease, an mRNA immunogenic composition, biomaterials related to the mRNA immunogenic composition, an mRNA-lipid complex, a vaccine for the prevention or treatment of Alzheimer's disease, a pharmaceutical composition, a method for preparing an mRNA vaccine, and the use of the aforementioned mRNA immunogenic composition and related products in the preparation of medicaments for the prevention or treatment of Alzheimer's disease. Background Technology

[0002] Alzheimer's disease (AD) is the most common chronic neurodegenerative disease, characterized by progressive and comprehensive cognitive impairment, resulting in a heavy social and economic burden (PMID: 31494009). Existing marketed drugs are mostly symptom-relieving measures and cannot fundamentally prevent the disease's progression. β-amyloid (Aβ) deposition and Tau protein hyperphosphorylation are the main pathological mechanisms of AD, and immunotherapy targeting these mechanisms is key to modifying AD treatment, including active and passive immunization. Passive immunotherapy using anti-Aβ monoclonal antibodies, such as lecanemab and aducanumab, has received accelerated approval from the US FDA (PMID: 34324167, 36449413). However, passive immunotherapy has drawbacks such as insufficient efficacy and low bioavailability. Active immunization therapy with Aβ vaccines stimulates the immune system to produce endogenous antibodies by Aβ or fragments thereof, and has advantages such as higher efficacy, lower cost, and higher safety (PMID: 24476230).

[0003] However, obtaining vaccines with precise targeting, high immunogenicity, and high safety remains a research challenge. Summary of the Invention

[0004] Purpose of the invention

[0005] The present invention aims to provide an immunogenic composition for the prevention or treatment of Alzheimer's disease, an mRNA immunogenic composition, biomaterials related to the mRNA immunogenic composition, an mRNA-lipid complex, a vaccine for the prevention or treatment of Alzheimer's disease, a pharmaceutical composition, a method for preparing an mRNA vaccine, and the use of the aforementioned mRNA immunogenic composition and related products in the preparation of a medicament for the prevention or treatment of Alzheimer's disease.

[0006] The Aβ-Tau multi-epitope vaccine developed in this invention represents a more effective treatment strategy compared to single-target therapy, as it targets both pathological Aβ and Tau simultaneously.

[0007] Solution

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] In a first aspect, the present invention provides an immunogenic composition for the prevention or treatment of Alzheimer's disease, comprising a short peptide Aβ1-16 and a short peptide Tau299-303 / 362-366.

[0010] Optionally, the Aβ1-16 short peptide has the amino acid sequence shown in SEQ ID NO:1:

[0011] DAEFRHDSGYEVHHQK

[0012] Optionally, the Tau299-303 / 362-366 short peptide has the amino acid sequence shown in SEQ ID NO:2: HVPGG;

[0013] Optionally, the mass ratio of Aβ1-16 short peptide to Tau299-303 / 362-366 short peptide is 1:(0.05-5), or alternatively 1:(0.25-2), or alternatively 1:(0.25-1).

[0014] In a second aspect, an mRNA immunogenic composition for the prevention or treatment of Alzheimer's disease is provided, comprising:

[0015] i) mRNA encoding the short peptide Aβ1-16 or an antigenic fragment thereof, or an amino acid sequence having at least 85%, 90%, 92%, or 95% identity with and having the same or substantially the same immunogenicity as that peptide; and,

[0016] ii) mRNA encoding the short peptide Tau299-303 / 362-366 or its antigenic fragment, or an amino acid sequence that has at least 80% identity with it and has the same or substantially the same immunogenicity.

[0017] Further, the Aβ1-16 short peptide or its antigenic fragment has an amino acid sequence as shown in SEQ ID NO:1, or an amino acid sequence that has at least 85%, 90%, 92% or 95% identity with the sequence shown in SEQ ID NO:1 and has the same or substantially the same immunogenicity as it.

[0018] And / or, the Tau299-303 / 362-366 short peptide or its antigenic fragment has an amino acid sequence as shown in SEQ ID NO:2, or an amino acid sequence that has at least 80% identity with the sequence shown in SEQ ID NO:2 and has the same or substantially the same immunogenicity as it.

[0019] Further, i) the mRNA sequence encoding the short peptide Aβ1-16 or its antigenic fragment, or the amino acid sequence having at least 85%, 90%, 92% or 95% identity with it and having the same or substantially the same immunogenicity as it, as shown in SEQ ID NO:3 or SEQ ID NO:5;

[0020] The nucleotide sequence of SEQ ID NO:3 is as follows:

[0021] GAUGCCGAAUUCAGACACGACAGCGGCUACGAGGUGCACCACCAGAAG;

[0022] The nucleotide sequence of SEQ ID NO:5 is as follows:

[0023] GAΨGCCGAAΨΨCAGACACGACAGCGGCΨACGAGGΨGCACCACCAGAAG, where Ψ

[0024] It is N1-methylpseudouridine triphosphate;

[0025] And / or, the mRNA sequence encoding the short peptide Tau299-303 / 362-366 or its antigenic fragment, or the amino acid sequence having at least 80% identity with it and having the same or substantially the same immunogenicity as it, as shown in SEQ ID NO:4 or SEQ ID NO:6;

[0026] The nucleotide sequence of SEQ ID NO:4 is as follows:

[0027] CACGUGCCUGGCGGC;

[0028] The nucleotide sequence of SEQ ID NO:6 is as follows:

[0029] CACGΨGCCΨGGCGGC, where Ψ is N1-methylpseudouridine triphosphate;

[0030] Preferably, in the mRNA immunogenic composition, the mass ratio of mRNA i) to ii) is 1:(0.05-5), optionally 1:(0.25-2), or optionally 1:(0.25-1).

[0031] Furthermore, each mRNA sequence includes, from the 5' end to the 3' end, the following in sequence: a 5' cap structure, a 5' UTR sequence, an mRNA sequence encoding either the Aβ1-16 short peptide or the tau299-303 / 362-366 short peptide, a 3' UTR sequence, and a polyadenylate sequence;

[0032] And / or, each mRNA sequence includes a 5' cap modification;

[0033] And / or, one or more nucleotides in the mRNA are each independently replaced with naturally occurring or synthetically produced nucleotide analogs; optionally, one or more uridine triphosphates (UTPs) in at least one mRNA are each independently replaced with N1-methylpseudouridine triphosphates; optionally, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the uridine triphosphates in each mRNA are replaced with N1-methylpseudouridine triphosphates.

[0034] And / or, the mRNA immunogenic composition includes mRNA as shown in SEQ ID NO:9 or SEQ ID NO:11, and mRNA as shown in SEQ ID NO:10 or SEQ ID NO:12;

[0035] Optionally, the mass ratio of the mRNA shown in SEQ ID NO:9 or SEQ ID NO:11 to the mRNA shown in SEQ ID NO:10 or SEQ ID NO:12 is 1:(0.2 to 5), or alternatively 1:(0.5 to 2), or alternatively 1:(0.5 to 1).

[0036] Anti-Aβ vaccines can have mRNA as shown in SEQ ID NO:9 (U is modified to Ψ(N1-methylpseudouridine triphosphate)):

[0037]

[0038] Alternatively, an anti-Aβ vaccine may have mRNA as shown in SEQ ID NO:11:

[0039]

[0040] Anti-Tau vaccines can have mRNA as shown in SEQ ID NO:10 (U is modified with Ψ(N1-methylpseudouridine triphosphate)):

[0041]

[0042] Alternatively, an anti-Tau vaccine may have mRNA as shown in SEQ ID NO:12:

[0043]

[0044]

[0045] In the above SEQ ID NO:9~12, m 7 GpppAm is a 5' cap structure. The underlined part is the ORF (corresponding to start codon + Aβ1-16 + stop codon and start codon + Tau 299-303 / 362-366 + stop codon, respectively). The sequence before the underline is the 5' UTR, the bold part is the 3' UTR, and the A after the bold sequence is a poly(A) tail structure.

[0046] Thirdly, a biomaterial is provided in relation to the immunogenic composition described in the first aspect or the mRNA immunogenic composition described in the second aspect, characterized in that the biomaterial is any one of B1) to B5):

[0047] B1) A nucleic acid molecule encoding the immunogenic composition of the first aspect, or a nucleic acid molecule encoding the RNA immunogenic composition of the second aspect; optionally having a nucleotide sequence as shown in SEQ ID NO:7 or SEQ ID NO:8;

[0048] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0049] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0050] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0051] B5) A transgenic cell line containing the nucleic acid molecule described in B1), or a transgenic cell line containing the expression cassette described in B2), or a transgenic cell line containing the recombinant vector described in B3).

[0052] Fourthly, an mRNA-lipid complex is provided, the mRNA-lipid complex comprising a delivery carrier and the mRNA immunogenic composition described in the second aspect;

[0053] Optionally, the delivery carrier comprises at least one of ionizable liposomes, phosphatidylcholine, cholesterol and polyethylene glycol lipids, ionizable micelles and ionizable lipid nanoparticles; optionally, the ionizable liposomes are ionizable cationic liposomes.

[0054] Optionally, the delivery carrier includes ionizable cationic lipids, phosphatidylcholine, cholesterol, and PEG-lipids;

[0055] Optionally, the molar ratio of cationic lipids, phosphatidylcholine, cholesterol and PEG-lipids is 50:8-12:35-40:1.2-2, or alternatively, the molar ratio is 50:10:38.5:1.5.

[0056] Optionally, the mass ratio of the mRNA-lipid complex containing Aβ1-16 mRNA and Tau299-303 / 362-366 mRNA is 1:(0.2-5), or alternatively 1:(0.5-2).

[0057] Fifthly, a vaccine, pharmaceutical composition, or kit for the prevention or treatment of Alzheimer's disease is provided, wherein the active ingredient of the vaccine comprises an immunogenic composition as described in the first aspect, an mRNA immunogenic composition as described in the second aspect, a biomaterial as described in the third aspect, or an mRNA-lipid complex as described in the fourth aspect.

[0058] Sixthly, a method for preparing an mRNA vaccine is provided, the method comprising: encapsulating mRNA with ionized lipids, phosphatidylcholine, polyethylene glycol-modified lipids, and cholesterol to form lipid nanoparticles encapsulating mRNA;

[0059] Wherein, the mRNA includes the mRNA immunogenic composition described in the second aspect;

[0060] Optionally, the Aβ1-16 mRNA of i) and the Tau299-303 / 362-366 mRNA of ii) are encapsulated and then mixed separately;

[0061] Optionally, the molar ratio of cationic lipids, phosphatidylcholine, cholesterol and polyethylene glycol lipids is 50:8-12:35-40:1.2-2, or alternatively, the molar ratio is 50:10:38.5:1.5.

[0062] In a seventh aspect, the use of the immunogenic composition of the first aspect, the mRNA immunogenic composition of the second aspect, the biomaterial of the third aspect, the mRNA-lipid complex of the fourth aspect, the vaccine, pharmaceutical composition or kit of the fifth aspect, and the mRNA vaccine prepared by the method of the sixth aspect in the preparation of a medicament for the prevention or treatment of Alzheimer's disease is provided.

[0063] Preferably, the drug is a vaccine.

[0064] Eighthly, a method for preventing or treating Alzheimer's disease is provided, comprising administering to the subject an effective dose of the immunogenic composition of the first aspect, the mRNA immunogenic composition of the second aspect, the biomaterial of the third aspect, the mRNA-lipid complex of the fourth aspect, the vaccine of the fifth aspect, a pharmaceutical composition or kit, or an mRNA vaccine prepared by the method of the sixth aspect.

[0065] Beneficial effects

[0066] This invention utilizes Aβ and Tau antigenic epitopes for multi-target intervention, which is more effective than single-target intervention. Experiments have demonstrated that Aβ-Tau multi-epitope vaccine-targeted intervention can effectively improve cognitive function in AD mice, providing a new method for active immunotherapy of Alzheimer's disease.

[0067] The Aβ-Tau mRNA vaccine of the present invention can synthesize target antigens using the cell's translation system, stimulating the body to produce a specific immune response, and has precise targeting, high immunogenicity, and high safety. Attached Figure Description

[0068] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative examples are not intended to limit the embodiments. The term "illustrative" as used herein means "serving as an example, embodiment, or illustration." Any embodiment illustrated herein as "illustrative" is not necessarily to be construed as superior to or better than other embodiments.

[0069] Figure 1 This refers to the serum antibody titer of a short peptide containing a key epitope of the Aβ protein used in Experiment Example 1 of this invention, two weeks after immunization.

[0070] Figure 2 This refers to the serum antibody titer of a short peptide containing a key epitope of Tau protein two weeks after immunization, as used in Experiment Example 1 of this invention.

[0071] Figure 3 This is a schematic diagram of the mRNA vaccine sequence in Experimental Example 2 of the present invention, where A is a schematic diagram of the construction of the anti-Aβ vaccine; and B is a schematic diagram of the construction of the anti-Tau vaccine.

[0072] Figure 4 The results of the water maze test for immunized mice in Test Example 1 of this invention are shown below. In this test, A represents the escape latency of the control group and mice vaccinated with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau vaccines; B represents the number of times the control group and mice vaccinated with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau vaccines crossed the platform; and C represents the time spent in the target quadrant of the control group and mice vaccinated with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau vaccines.

[0073] Figure 5 The Aβ and Tau protein loads in the brain tissue of immunized mice in Test Example 1 of this invention are: A represents the Aβ40 content in the brain tissue of the control group and mice vaccinated with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau vaccines; and B represents the p-Tau217 content in the brain tissue of the control group and mice vaccinated with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau vaccines. Detailed Implementation

[0074] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprising of," etc., will be understood to include the stated elements or components, and does not exclude other elements or other components.

[0075] Furthermore, to better illustrate the present invention, numerous specific details are provided in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In some embodiments, materials, elements, methods, and means well known to those skilled in the art are not described in detail in order to highlight the spirit of the invention.

[0076] The present invention will now be described in detail.

[0077] The term "ionizable cationic lipid" in this invention refers to a class of lipid molecules with pH-responsive properties. Its core design lies in achieving efficient mRNA delivery and low toxicity by precisely controlling pKa, tail chain length, and degradability.

[0078] The term "lipid nanoparticles" (LNP) in this invention refers to particles having a size on the nanometer scale that contain at least one lipid.

[0079] The term "vaccine" in this invention refers to a composition suitable for use in animals (including humans) that, upon administration, induces an immune response strong enough to help prevent, improve or cure Alzheimer's disease to a minimum.

[0080] The reagents, enzymes, culture media, and other chemical materials used in the following embodiments of the present invention are all commercially available products.

[0081] Some commonly used biological materials, such as female Balb / c mice and 5×FAD transgenic mice, are also commercially available products.

[0082] Some synthetic biological materials, such as the DNA sequences of various antigens, which require artificial synthesis, are outsourced to synthetic companies.

[0083] Since U and Ψ are not displayed in the sequence list, T is displayed in the sequence list.

[0084] Experimental Example 1: Screening of Aβ and Tau dominant antigenic epitopes

[0085] Immunoinformatics prediction of dominant antigenic epitopes of Aβ and Tau proteins

[0086] Dominant antigenic epitopes of Aβ and Tau proteins were comprehensively screened using databases and tools such as Bcepred, ABCpred, IEDB, ALPHA FOLD2, Discotope, and SOMPA. The specific research methods are as follows: The amino acid sequences of Aβ and Tau proteins were obtained from GenBank. High-resolution crystal structures of Aβ and Tau proteins were searched in Protein Data Bank. Combined with the full-length protein three-dimensional structures predicted by the ALPHAFOLD2 tool, multi-parameter comprehensive analysis was performed on the structures of Aβ proteins with different aggregation types (monomers, oligomers, fibrils, and long amyloid fibrils) and Tau proteins with different phosphorylation sites. Then, the Discotope-Prediction of epitopes from protein structure software was used to predict the structurally dominant antigenic epitopes of the proteins, and the Bcepred, ABCpred, and Epitope Prediction tools in IEDB were used to predict the linearly dominant antigenic epitopes. Simultaneously, their physicochemical properties, such as hydrophilicity, flexibility, antigenicity, and antigen-exposed surface regionality, were analyzed. By comparing the analysis results of different software, dominant antigenic epitopes targeting pathological Aβ and Tau proteins were preliminarily screened, while antigenic epitopes that may cause adverse reactions or affect the normal physiological function of the proteins were excluded.

[0087] 1.1 Immunogenicity detection of dominant antigenic epitopes and peptides of Aβ protein

[0088] Through literature review and AI-based simulation, epitope analysis of Aβ protein was performed. Key epitopes were selected to verify immunogenicity, and four short peptides with different epitopes were synthesized as shown in Table 1:

[0089] Table 1. Four short peptides with different epitopes of Aβ protein

[0090] Aβ16-20 SEQ ID NO:13 KLVFF Aβ3-7 SEQ ID NO:14 EFRHD Aβ1-16 SEQ ID NO:1 DAEFRHDSGYEVHHQK Aβ1-15 SEQ ID NO:15 DAEFRHDSGYEVHHQ

[0091] To enhance the immunogenicity of the short peptides, keyhole lipoteihemocyanin (KLH, sequence reference NCBI 47169655) was conjugated to the N-terminus of each short peptide. The conjugated short peptides were then fused with a water-soluble adjuvant (QuickAntibody-Mouse5W) and administered to mice at a dose of 50 μg / 100 μL. Five mice (female Balb / c mice, 6-8 weeks old, weighing 16-18 g) were immunized with each antigen, with immunizations every two weeks. Starting from the second immunization, serum antibody titers for the four short peptides were measured two weeks post-immunization.

[0092] The results are as follows Figure 1 The results showed that Aβ1-16 could induce a stronger immune response in mice.

[0093] 1.2 Immunogenicity Detection of Dominant Antigenic Epitopes and Peptides of Tau Protein

[0094] Based on literature review and AI simulation, epitope analysis was performed on the Tau protein, and key epitopes were selected to verify immunogenicity. Four short peptides with different epitopes were synthesized as shown in Table 2.

[0095] Table 2. Four short peptides with different epitopes of Tau protein

[0096] Tau294-305 SEQ ID NO:16 KDNIKHVPGGGS Tau299-303 / 362-366 SEQ ID NO:2 HVPGG Tau25-30 SEQ ID NO:17 DQGGYT PT217 / T

[0097] Following the method in 1.1, serum antibody titers were measured two weeks after immunization with the four short peptides. The results are as follows: Figure 2 The results showed that Tau299-303 / 362-366 were more likely to induce an immune response in mice.

[0098] Example 2: Preparation of a multi-epitope Aβ-Tau mRNA / LNP vaccine

[0099] Based on a humanized codon optimization strategy, gene sequences targeting the Aβ1-16 and Tau (299-303 / 362-366) antigenic epitopes were designed respectively: a 5' UTR and a start codon were introduced at the 5' end of the gene fragment encoding the short peptide, and a stop codon, a 3' UTR domain, and a 100-120 nt poly(A) tail were added to the 3' end to construct an mRNA transcription unit (to enhance mRNA stability and translation efficiency). Figure 3As shown, the above transcription units were cloned into a plasmid vector to construct a recombinant plasmid, which was then screened and identified as a positive clone. Subsequently, the high-purity recombinant plasmid was transfected into human embryonic kidney 293T cells (HEK293T cells) for initial expression verification. Western blot was used to detect the expression of the target protein and verify the accuracy of the mRNA sequence. The recombinant plasmid was linearized using the restriction endonuclease BspQI, and in vitro transcription (IVT) technology was used to generate complete mRNAs targeting Aβ1-16 and Tau (299-303 / 362-366) with a 5' cap structure. Subsequently, the two target mRNAs were encapsulated with lipid nanoparticles (LNPs) to prepare LNP-mRNA complexes, which were then mixed in a predetermined ratio to form a bivalent mRNA vaccine. After physicochemical characterization of the vaccine (including particle size, PDI, encapsulation efficiency, and mRNA integrity), mice were immunized and the following indicators were evaluated: ① Aβ and Tau protein load in the mouse brain, Aβ and Tau protein levels in cerebrospinal fluid, synapse density, neuron density, glial cell density, brain synapse-related protein content, and inflammatory marker levels, to clarify the improvement of AD-related pathological changes after active immunization and to screen the optimal vaccine epitopes based on the vaccine's preventive and therapeutic effects; ② Serum-specific antibody titers and affinity, serum and spleen cell-secreted cytokine levels, spleen cell proliferation response, and T cell subsets; ③ Antibody concentrations in mouse peripheral blood and cerebrospinal fluid to explore whether increasing peripheral antibody levels can increase central antibody levels, and whether higher central antibody levels are associated with lower brain Aβ and Tau levels and better cognitive performance.

[0100] 2.1 Constructing plasmids for Aβ-Tau multi-epitope mRNA transcription

[0101] Constructing plasmids for Aβ-Tau multi-epitope mRNA transcription :

[0102] An improvement was made to the classic plasmid construction method (Yang et al., J Med Virol, 2023): the coding sequences of the Aβ1-16 and Tau299-303 / 362-366 antigenic epitopes were obtained from GenBank and humanized codons were optimized to significantly improve their translation efficiency and protein expression levels in human cells. A 5' UTR and a start codon were introduced at the 5' end of the codon-optimized gene fragments encoding Aβ1-16 (SEQ ID NO:1) and the Tau 299-303 / 362-366 short peptide (SEQ ID NO:2), respectively, and a stop codon, a 3' UTR domain, and a 100-120 nt poly(A) tail were added to the 3' end to construct mRNA transcription units (to enhance mRNA stability and translation efficiency). These two gene elements were cloned into the pVAX1(+) plasmid vector to construct recombinant plasmids for subsequent high-efficiency in vitro mRNA transcription.

[0103] The gene fragment sequence encoding the short peptide Aβ1-16 is shown in SEQ ID NO:7:

[0104] GATGCCGAATTCAGACACGACAGCGGCTACGAGGTGCACCACCAGAAG.

[0105] The gene fragment sequence encoding the short peptide Tau 299-303 / 362-366 is shown in SEQ ID NO:8:

[0106] CACGTGCCTGGCGGC.

[0107] The recombinant plasmids were then transformed into TOP10 *E. coli* and inoculated onto Kanamycin-containing agar plates for screening positive clones. Recombinant plasmids with successfully inserted target genes were selected, and the correctness and integrity of the inserted sequences were verified using DNA sequencing. The sequenced-verified recombinant plasmids were then transformed into TOP10 *E. coli* and further cultured. High-concentration recombinant plasmid DNA was then extracted using a plasmid extraction kit and named pVAX1-Aβ and pVAX1-pVAX1-Tau, respectively.

[0108] In vitro transcription of mRNA

[0109] This method is an improvement on the classic in vitro mRNA transcription method (Prompetchara et al., Nat Commun, 2023). First, the recombinant plasmid is linearized using the restriction endonuclease BspQI to obtain a linear DNA template for in vitro mRNA transcription. The linearized plasmid is then analyzed by DNA agarose gel electrophoresis to confirm complete digestion and that the band positions and sizes are as expected. Subsequently, T7 RNA polymerase, nucleoside triphosphates (NTPs), an RNase inhibitor, and pyrophosphatase are added to the reaction system for in vitro mRNA transcription. N1-methylpseudouridine (m1Ψ) triphosphate is used instead of the conventional uridine triphosphate (UTP) to improve mRNA translation efficiency and reduce innate immune response activation. After transcription, a Cap1 capping system is used to add a Cap1 structure to the 5′ end of the mRNA to enhance translation efficiency and prevent exonuclease degradation. The mRNA product is then processed... RNA was purified using a purification kit, and its integrity and concentration were analyzed by agarose gel electrophoresis and Nanodrop 2000c. Strict quality control was required before mRNA encapsulation to ensure the absence of double-stranded RNA contamination and endotoxin residues, thus guaranteeing the safety and efficacy of subsequent applications. The sequences of the obtained mRNA vaccines are shown in Table 3.

[0110] Table 1. mRNA sequences of vaccines

[0111]

[0112] Where, m 7 GpppAm is a 5' cap structure. The underlined part is the ORF (corresponding to start codon + Aβ1-16 + stop codon and start codon + Tau 299-303 / 362-366 + stop codon, respectively). The sequence before the underline is the 5' UTR, the bold part is the 3' UTR, and the A after the bold sequence is a poly(A) tail structure (the cap structure m is not displayed in the sequence listing due to software limitations). 7 GpppAm-, and Ψ in SEQ ID NO:5 and 6 in the sequence list is shown as T).

[0113] mRNA / LNP encapsulation and characterization :

[0114] A modified version of the classic mRNA / LNP synthesis and identification method (Zeng et al., Emerg Microbes Infect. 2023) was developed: Ionizable cationic lipids (ICLs), phosphatidylcholine, cholesterol, and PEG-lipids were mixed in a molar ratio of 50:10:38.5:1.5 to encapsulate the mRNA, thus preparing Anti-Aβ and Anti-Tau mRNA / LNP vaccines, respectively. These vaccines were then tested using the Quant-iT kit. TM Encapsulation efficiency was determined using an RNA Reagent and Kit. The average particle size and zeta potential of mRNA / LNP were measured using a Litesizer, and morphological analysis was performed using transmission electron microscopy to characterize the nanoparticles. In vivo imaging was used to track the biodistribution of Luc mRNA / LNP in the brain, and its fluorescence intensity and duration in the brain were analyzed.

[0115] Test Example 1: Identification of the therapeutic effect of Aβ-Tau multiepitope vaccine on AD mice

[0116] Six-month-old female 5×FAD transgenic mice (weighing 21-23g) were selected and immunized intramuscularly with the prepared Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau mRNA / LNP vaccines (Anti-Aβ and Anti-Tau vaccines mixed at a volume ratio of 1:1), with 5 mice in each group. The single injection dose was 50 μl (concentration 50 μg / mL), and immunization was performed every two weeks for a total of 4 times. Phosphate-buffered saline (PBS) was used as a control group. At week 8 post-vaccination, behavioral tests were performed on the mice, and the Aβ and Tau protein load in the mouse brain was measured after the behavioral tests.

[0117] Behavioral tests on immunized mice:

[0118] After vaccination, a water maze cognitive function test was performed to assess the extent to which the mRNA / LNP vaccine improved AD cognitive function.

[0119] The experimental setup consisted of a black cylindrical pool divided into four quadrants: N, E, S, and W. A hidden platform (approximately 10 cm in diameter) was located in the center of the pool. Mice needed to learn and memorize the platform to stop swimming. For the first three days, mice were trained using a strainer to adapt to the process of being retrieved, reducing unnecessary stress. One day before the experiment, the water maze was cleaned, and water was added to 1.5 cm above the platform. Non-toxic white dye was added to enhance contrast, and a heater was used to maintain the water temperature at 20 ± 1℃. The first five days were the training period, and the sixth day was the testing period. Each day, mice were placed into the pool from different quadrants, for a total of four training sessions. The specific training sequence was as follows:

[0120] Table 2. Quadrant Training Sequence during the Water Maze Training Period

[0121]

[0122] In this context, SE and NW represent the midpoint between two adjacent quadrants.

[0123] During training, the time it took for the mice to find the platform was recorded. If they failed to find it within 1 minute, they were guided to the platform using a strainer and allowed to stay for 10 seconds to reinforce their memory. On day 6 (test day), the platform was removed, and the mice were gently placed back into the water. Their swimming trajectory was recorded within 1 minute using a camera, and the Any-maze software was used to analyze the following: the number of times the mice crossed the target platform area, the time spent in the platform quadrant, the proportion of the distance traveled in the platform quadrant to the total distance, and the escape latency (escape latency refers to the time required for the experimental animal (in this case, the mouse) to successfully find and climb onto the platform hidden underwater from the moment it is placed in the water maze. The shorter this time, the stronger the mouse's ability to learn and remember the platform's location, i.e., the better its spatial learning and memory ability). This was used to assess the mice's spatial memory ability.

[0124] The results are as follows Figure 4 The results showed that the spatial learning and memory abilities of mice immunized with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau mRNA / LNP were all improved compared with the control group. Furthermore, the cognitive improvement of mice immunized with Anti-Aβ+Tau mRNA / LNP vaccine was significantly better than that of mice immunized with Anti-Aβ or Anti-Tau vaccine alone, indicating that Anti-Aβ and Tau produced a synergistic effect.

[0125] Detection of Aβ and Tau protein load in the brains of immunized mice

[0126] After behavioral testing, mice were anesthetized with 4% chloral hydrate and injected intraperitoneally at a dose of 0.1 mL / 10 g body weight. After cardiac perfusion, the mice were decapitated and their brains were removed and placed on an ice tray. The hippocampus and cortex were precisely separated, and pre-prepared lysis buffer (containing RIPA, PMSF, and a phosphatase inhibitor in a volume ratio of 100:1:1) was added. The mixture was thoroughly homogenized and then placed on ice for 30 min for lysis. Before the experiment, a high-speed centrifuge was pre-cooled and centrifuged at 4°C and 12000 rpm for 15 min. The supernatant was collected and transferred to a new EP tube, ensuring the protein sample remained intact and uncontaminated. Western blot analysis was used to detect AD-related pathological changes, including the levels of Aβ and phosphorylated Tau proteins in the hippocampus and cortex.

[0127] The results are as follows Figure 5 As shown, the results indicated that the levels of Aβ40 and p-Tau217 in the brain tissue of mice immunized with Anti-Aβ, Anti-Tau, and Anti-Aβ+Tau mRNA / LNP were lower than those in the control group. Furthermore, the Aβ and Tau protein load in the brains of mice immunized with Anti-Aβ+Tau mRNA / LNP vaccine was significantly lower than that in mice immunized with Anti-Aβ or Anti-Tau vaccine, indicating that Anti-Aβ and Tau produced a synergistic effect.

[0128] In summary, this invention identifies Aβ1-16 and Tau299-303 / 362-366 as dominant antigenic epitopes, prepares a novel multi-epitope Aβ-Tau mRNA / LNP vaccine, and demonstrates that targeted intervention with the Aβ-Tau multi-epitope vaccine can effectively improve cognitive function in AD mice, providing a new method for active immunotherapy of Alzheimer's disease.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An mRNA immunogenic composition for the prevention or treatment of Alzheimer's disease, comprising: i) mRNA encoding the short peptide Aβ1-16; the short peptide Aβ1-16 has the amino acid sequence shown in SEQ ID NO:1; and, ii) mRNA encoding the short peptide Tau299-303 / 362-366; the short peptide Tau299-303 / 362-366 has the amino acid sequence shown in SEQ ID NO:2; In the mRNA immunogenic composition, the mass ratio of mRNA in i):ii) is 1:(0.05~5).

2. The mRNA immunogenic composition according to claim 1, characterized in that, The mRNA sequence encoding the short peptide Aβ1-16 is shown in SEQ ID NO:3 or SEQ ID NO:5; The nucleotide sequence of SEQ ID NO:3 is as follows: GAUGCCGAAUUCAGACACGACAGCGGCUACGAGGUGCACCACCAGAAG; The nucleotide sequence of SEQ ID NO:5 is as follows: GAΨGCCGAAΨΨCAGACACGACAGCGGCΨACGAGGΨGCACCACCAGAAG, where Ψ is N1-methylpseudouridine triphosphate.

3. The mRNA immunogenic composition according to claim 2, characterized in that, The mRNA sequence encoding the short peptide Tau299-303 / 362-366 in ii) is shown in SEQ ID NO:4 or SEQ ID NO:6; The nucleotide sequence of SEQ ID NO:4 is as follows: CACGUGCCUGGCGGC; The nucleotide sequence of SEQ ID NO:6 is as follows: CACGΨGCCΨGGCGGC, where Ψ represents N1-methylpseudouridine triphosphate.

4. The mRNA immunogenic composition according to any one of claims 1 to 3, characterized in that, In the mRNA immunogenic composition, the mass ratio of mRNA i):ii) is 1:(0.25~1).

5. The mRNA immunogenic composition according to any one of claims 1 to 3, characterized in that, Each mRNA sequence includes, from the 5' end to the 3' end, the following sequence: 5' cap structure, 5' UTR sequence, mRNA sequence encoding short peptide Aβ1-16 or short peptide tau299-303 / 362-366, 3' UTR sequence, and polyadenylated nucleotide sequence.

6. The mRNA immunogenic composition according to claim 5, characterized in that, Each mRNA sequence includes a 5' cap modification.

7. The mRNA immunogenic composition according to any one of claims 1 to 3, characterized in that, In each mRNA, uridine triphosphate was 100% replaced with N1-methylpseudouridine triphosphate.

8. The mRNA immunogenic composition according to any one of claims 1 to 3, characterized in that, The mRNA immunogenic composition includes mRNAs as shown in SEQ ID NO:9 or SEQ ID NO:11, and mRNAs as shown in SEQ ID NO:10 or SEQ ID NO:

12.

9. The mRNA immunogenic composition according to claim 8, characterized in that, The mass ratio of the mRNA shown in SEQ ID NO:9 or SEQ ID NO:11 to the mRNA shown in SEQ ID NO:10 or SEQ ID NO:12 is 1:(0.2~5).

10. The mRNA immunogenic composition according to claim 8, characterized in that, The mass ratio of the mRNA shown in SEQ ID NO:9 or SEQ ID NO:11 to the mRNA shown in SEQ ID NO:10 or SEQ ID NO:12 is 1:(0.5~2).

11. The mRNA immunogenic composition according to claim 8, characterized in that, The mass ratio of the mRNA shown in SEQ ID NO:9 or SEQ ID NO:11 to the mRNA shown in SEQ ID NO:10 or SEQ ID NO:12 is 1:(0.5~1).

12. An mRNA-lipid complex, characterized in that, The mRNA-lipid complex comprises a delivery carrier and the mRNA immunogenic composition according to any one of claims 1 to 11.

13. The mRNA-lipid complex according to claim 12, characterized in that, The delivery carrier includes at least one of ionizable liposomes and ionizable micelles.

14. The mRNA-lipid complex according to claim 13, characterized in that, The ionizable liposomes are ionizable cationic liposomes.

15. The mRNA-lipid complex according to claim 12, characterized in that, The delivery carrier comprises ionizable lipid nanoparticles.

16. The mRNA-lipid complex according to claim 12, characterized in that, The delivery carrier includes one or more of phosphatidylcholine, cholesterol, and polyethylene glycol lipids.

17. The mRNA-lipid complex according to claim 12, characterized in that, The delivery carriers include ionizable cationic lipids, phosphatidylcholine, cholesterol, and PEG-lipids.

18. The mRNA-lipid complex according to claim 17, characterized in that, The molar ratio of cationic lipids, phosphatidylcholine, cholesterol, and PEG-lipids is 50:10:38.5:1.

5.

19. The mRNA-lipid complex according to claim 17, characterized in that, The mass ratio of the mRNA-lipid complex containing Aβ1-16 mRNA and Tau299-303 / 362-366 mRNA was 1:(0.2~5).

20. The mRNA-lipid complex according to claim 17, characterized in that, The mass ratio of the mRNA-lipid complex containing Aβ1-16 mRNA and Tau299-303 / 362-366 mRNA was 1:(0.5~2).

21. The mRNA-lipid complex according to claim 17, characterized in that, The mass ratio of the mRNA-lipid complex containing Aβ1-16 mRNA and Tau299-303 / 362-366 mRNA was 1:(0.2~1).

22. A vaccine for the prevention or treatment of Alzheimer's disease, characterized in that, The active ingredient of the vaccine comprises the mRNA immunogenic composition as described in any one of claims 1 to 11 or the mRNA-lipid complex as described in any one of claims 12 to 21.

23. A pharmaceutical composition for the prevention or treatment of Alzheimer's disease, characterized in that, The active ingredient of the pharmaceutical composition comprises the mRNA immunogenic composition as described in any one of claims 1 to 11 or the mRNA-lipid complex as described in any one of claims 12 to 21.

24. A reagent kit for the prevention or treatment of Alzheimer's disease, characterized in that, The active ingredient of the kit comprises the mRNA immunogenic composition as described in any one of claims 1 to 11 or the mRNA-lipid complex as described in any one of claims 12 to 21.

25. A method for preparing an mRNA vaccine, the method comprising: Ionized lipids, phosphatidylcholine, polyethylene glycol-modified lipids, and cholesterol are used to encapsulate mRNA, forming lipid nanoparticles that encapsulate mRNA. Wherein, the mRNA includes the mRNA immunogenic composition according to any one of claims 1 to 11.

26. The method according to claim 25, characterized in that, The Aβ1-16 mRNA (i) and the Tau299-303 / 362-366 mRNA (ii) were encapsulated and then mixed.

27. The method according to claim 25, characterized in that, The molar ratio of cationic lipids, phosphatidylcholine, cholesterol, and polyethylene glycol lipids is 50:10:38.5:1.

5.

28. The use of an mRNA immunogenic composition according to any one of claims 1 to 11, an mRNA-lipid complex according to any one of claims 12 to 21, a vaccine according to claim 22, or an mRNA vaccine prepared by the method according to any one of claims 25 to 27 in the preparation of a medicament for the prevention or treatment of Alzheimer's disease.

Images