A method for evaluating the biological potency of mesenchymal stem cells

Abstract

The present application relates to a kind of mesenchymal stem cell biological potency evaluation method, belong to the field of biotechnology.The method first respectively collects different donor source mesenchymal stem cell and the conditional medium of mesenchymal stem cell of silencing TSP2 expression, detects the concentration of TSP2 in culture medium using enzyme-linked immunosorbent assay method;Further, using inflammatory factor to induce chondrocyte, replaces conditional medium and is cultured for 24h, collects cell, detects its type II collagen protein messenger RNA (mRNA) expression change, establishes the correlation of conditional medium TSP2 concentration and chondrocyte type II collagen protein mRNA expression abundance;Measure the concentration of TSP2 in mesenchymal stem cell culture supernatant, can be used to evaluate the biological potency of mesenchymal stem cell in the treatment of osteoarthritis and other degenerative diseases in cartilage regeneration and protection, provide reliable basis for the standardization and quality control of mesenchymal stem cell treatment.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically providing a method for evaluating the biological efficacy of mesenchymal stem cells. Background Technology

[0002] Osteoarthritis is a chronic joint disease characterized by degeneration and damage of articular cartilage, involving multiple pathological changes such as bone hyperplasia, synovial lesions, and joint capsule contracture (Ann. Rheum. Dis. 2001, 60, 91-97). It is one of the common causes of mobility impairment and disability in the elderly. Degeneration of articular cartilage is the core pathological process of osteoarthritis. Multiple factors, including metabolic imbalance of chondrocytes, destruction of the extracellular matrix, and release of inflammatory factors, work together to lead to gradual wear and thinning of articular cartilage, exposure of subchondral bone, and ultimately, joint pain, stiffness, deformity, and functional impairment (Caspian J. Intern. Med. 2011, 2, 205-212). The challenge in treatment lies in how to immunomodulate the inflammatory microenvironment to achieve anti-inflammatory effects, promote cartilage regeneration, and thus repair damaged cartilage.

[0003] Mesenchymal stem cells (MSCs) can be isolated from various tissues and possess anti-inflammatory, antioxidant, cell proliferation-promoting, and tissue-repairing effects. They can also improve the immune microenvironment of diseased tissues to some extent. MSCs have strong differentiation potential and can differentiate into chondrocyte cell lines both in vitro and in vivo (Cell Tissue Res. 2015, 361, 769-778). For many years, research on the clinical application of various surgical procedures using MSCs in bone regeneration has been ongoing (Acta Biomater. 2016, 42, 341-350) and has made progress (Stem Cells Int. 2019, 2019, 1-16). However, the biopotency of MSC preparations varies depending on the source, culture conditions, and batch differences, and the lack of standardized evaluation methods limits the standardization of their clinical application.

[0004] Platelet-reactive protein 2 (TSP2) is a secreted protein belonging to the thrombus spongin family, whose members perform various biological functions in the extracellular matrix (Brain Res. 2019, 1718, 223-230). As a paracrine factor of MSCs, TSP2 promotes chondrogenesis and differentiation of chondrocyte progenitors, leading to increased expression of cartilage-specific markers such as type II collagen, ultimately resulting in cartilage regeneration (Stem Cells 2013, 31, 2136-2148). Studies have found that TSP2 expression levels are significantly higher in MSCs with high chondrogenesis potential than in those with low chondrogenesis potential. This indicates a close correlation between TSP2 expression levels and the chondrogenesis potential of MSCs (Stem Cells 2015, 33, 3291-3303). By detecting the secretion level of TSP2, the cartilage regeneration potential of MSCs can be predicted, thereby improving the efficacy of MSCs in the treatment of osteoarthritis (AmJ Sports Med 2023, 51, 2254-2266). Enzyme-linked immunosorbent assay (ELISA), as a highly sensitive and specific detection technique, is suitable for quantitative analysis of TSP2 levels in MSC supernatant.

[0005] Type II collagen is the main collagen synthesized by chondrocytes and is a characteristic collagen of articular cartilage (Rev. Mutat. Res. 2016, 768, 1-13). Under inflammatory conditions, Col II expression in chondrocytes is an important indicator for evaluating cartilage regeneration capacity (Am J Sports Med 2011, 39, 2362-2370). Type II collagen consists of three identical α-1 chains and is a major component of cartilage. The COL2A1 gene is responsible for encoding the collagen α-1 chain (Clin. Genet. 2020, 97, 383-395). Therefore, detecting the COL2A1 gene content indicates the abundance of type II collagen expression. RT-qPCR (Reverse Transcription-Polymerase Chain Reaction) is a technique that uses reverse transcriptase to catalyze the synthesis of cDNA from RNA, and then uses the cDNA as a template to amplify and synthesize the target fragment under the action of DNA polymerase. It is used to detect the expression level of gene mRNA in cells and can accurately detect the mRNA level of COL2A1.

[0006] Currently, there is no method to evaluate the bioavailability of MSCs in treating osteoarthritis, thus making it impossible to accurately assess the quality of MSCs or predict their efficacy in osteoarthritis treatment. This invention utilizes ELISA to detect TSP2 levels in MSC supernatant and verifies the correlation between TSP2 levels secreted by MSCs and type II collagen expression using an IL-1β-induced SW1353 cell inflammation model, establishing an accurate and standardized method for evaluating MSC quality and bioavailability. Summary of the Invention

[0007] This invention discloses a method for evaluating the bioavailability of mesenchymal stem cells (MSCs). Conditioned culture media from MSCs of different donor sources and MSCs with silenced TSP2 expression are collected. The concentration of TSP2 in the culture medium is quantitatively detected using enzyme-linked immunosorbent assay (ELISA). Chondrocytes are induced with inflammatory factors to establish an inflammatory environment. The collected conditioned culture medium is then replaced, and the cells are cultured for 24 hours. Chondrocytes are collected, and the expression abundance of type II collagen messenger RNA (mRNA), a characteristic collagen protein, is detected. A correlation is established between the TSP2 concentration in the conditioned culture medium and the type II collagen mRNA expression abundance in chondrocytes. Measuring the TSP2 concentration in the MSC culture supernatant can be used to evaluate the bioefficacy of MSCs in protecting cartilage and promoting cartilage regeneration during the treatment of osteoarthritis and other degenerative diseases.

[0008] Preferably, the method specifically includes the following steps. S100, mesenchymal stem cell culture and conditioned medium collection; The level of TSP2 in the conditioned medium of collected MSCs was detected by S200 and ELISA. S300. The expression abundance of COL2A1 gene in SW1353 chondrocytes was analyzed by RT-qPCR. S400. TSP2 expression was inhibited using small interfering RNA (siRNA), and the level of TSP2 in the supernatant of MSCs cells was measured by ELISA. S500. The expression abundance of COL2A1 gene in SW1353 cells after TSP2 silencing was analyzed by RT-qPCR.

[0009] Preferably, step S100 specifically involves: S110. Obtain MSCs from healthy donors using umbilical cord, bone marrow, adipose tissue or other sources. After culturing to the fourth generation, culture them in complete medium at 37°C in a CO2 incubator for 24 hours, then replace with basal medium and continue culturing for another 24 hours before collecting the cell supernatant. S120. Collect the cell supernatant from step S110 by centrifuging at 2000 rpm and room temperature for 10 min to remove cell debris and collect the supernatant. S130. Take the supernatant from step S120, filter it through a 0.22μm filter membrane, collect it, and store it in a -80℃ freezer. The collected liquid is a conditioned medium.

[0010] Preferably, step S200 specifically involves: S210. Add the conditioned medium and TSP2 standard solution to a 96-well plate pre-coated with anti-TSP2 antibody. The mixed solution obtained in steps S220 and S210 was incubated on a shaker at room temperature for 2 hours at a speed of 500±50 rpm. The mixture was then removed, and the solution was washed four times with washing solution. The supernatant was discarded, and the precipitate was retained. S230. Add 200 μL of TSP2 conjugate to each well and incubate on a shaker for 2 hours. After incubation, remove the liquid from the plate and wash 4 times. S240. Add substrate solution to the plate, 200 μL per well, and incubate on a shaker at room temperature in the dark for 30 min. Using S250 and 570nm as the calibration wavelength, a standard curve was created by measuring the optical density (OD value) of each well at a wavelength of 450nm using an ELISA reader, and the TSP2 concentration was calculated.

[0011] Preferably, step S300 specifically involves: S310. SW1353 chondrocytes were cultured in DMEM / F12 medium containing 10% FBS in a CO2 incubator at 37°C. S320: Discard the culture medium from step S310, replace it with conditioned medium, and culture at 37°C in a CO2 incubator for 72 hours. Collect the cells after trypsin digestion for 1 minute. S330. Extract RNA from cells in step S320 and synthesize cDNA using reverse transcription. S340. The expression abundance of COL2A1 gene in SW1353 was detected by RT-qPCR. S350. The effect of TSP2 concentration on COL2A1 expression was evaluated by fitting linear curves.

[0012] Preferably, step S400 specifically involves: S410. Use complete culture medium to culture MSCs in a CO2 incubator at 37°C for 24 hours. S420. On the second day, MSCs were transfected with different concentrations (0, 25, 75 pmol) of siRNA in the culture medium to inhibit the expression of TSP2, and cultured in a CO2 incubator at 37°C for 24 h. S430, On the third day, discard the supernatant, replace the culture medium with the basal culture medium, and incubate at 37°C in a CO2 incubator for 24 hours. S440. Collect the cell supernatant from step S430 by centrifuging at 2000 rpm and room temperature for 10 min to remove cell debris and collect the supernatant. S450. Take the supernatant from step S440, filter it through a 0.22μm filter membrane, collect it, and store it in a -80℃ freezer. The collected liquid is the conditioned medium. S460. Using 570nm as the calibration wavelength, measure the OD value of each well at 450nm using an ELISA reader to create a standard curve and calculate the TSP2 concentration.

[0013] Preferably, step S500 specifically involves: S510. SW1353 chondrocytes were cultured in DMEM / F12 medium containing 10% FBS in a CO2 incubator at 37℃. The medium was supplemented with 10 ng / mL IL-1β to simulate the inflammatory environment of osteoarthritis. S520: Discard the culture medium from step S510, replace it with the conditioned medium after TSP2 silencing, and culture in a CO2 incubator at 37°C for 48 hours. After washing with DPBS, collect the cells. S530. Extract RNA from cells in step S520 and synthesize cDNA using reverse transcription. S540. The expression abundance of the COL2A1 gene in SW1353 was detected by RT-qPCR.

[0014] Preferably, the COL2A1 and internal reference primer sequences are as follows: COL2A1 forward: CCAGATGACCTTCCTACGCC; COL2A1 reverse: TTCAGGGCAGTGTACGTGAAC; GAPDH forward: GGGAAGGTGAAGGTCGGAGT; GAPDH reverse: GGGGTCATTGATGGCAACA.

[0015] Preferably, the biological efficacy of mesenchymal stem cells in promoting the expression of chondrocyte-specific collagen Col II is evaluated based on the TSP2 secretion level of mesenchymal stem cells.

[0016] The above methods were used to evaluate the application of mesenchymal stem cells in the treatment of osteoarthritis and other degenerative diseases in the areas of cartilage regeneration and protective bioavailability.

[0017] A method for quality control or predicting the efficacy of mesenchymal stem cell therapy for osteoarthritis.

[0018] Beneficial effects (1) The process of this invention is simple, with high sensitivity and specificity. It combines ELISA and RT-qPCR to accurately detect TSP2 concentration and COL2A1 expression, respectively. (2) This invention has the relevance of an inflammation model. It uses the IL-1β-induced SW1353 model to simulate the microenvironment of osteoarthritis, thereby enhancing the clinical relevance of the evaluation method. (3) This invention has the ability to standardize the evaluation of the correlation between the level of TSP2 secreted by MSCs and the expression of type II collagen in chondrocytes. It uses the concentration of TSP2 secreted by MSCs as a quantitative indicator, which facilitates batch-to-batch comparison and quality control, predicts the ability of MSCs to promote the expression of Col II, a characteristic protein of chondrocyte extracellular matrix, and has clinical translation potential. It can be used as a standard method for quality control of MSCs preparations and prediction of the biological efficacy of MSCs in treating osteoarthritis.

[0019] (4) This invention establishes the criteria for evaluating the biological efficacy of MSCs and can accurately evaluate their biological efficacy in promoting the expression of ColII in chondrocytes. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the method flow of this application; Figure 2 A schematic diagram illustrating the preparation method for TSP2 ELISA analytical standards; Figure 3 A schematic diagram comparing the results of ELISA measurements of TSP2 concentration in the supernatant of different batches of MSCs; Figure 4 This is a schematic diagram showing the results of RT-qPCR detection of COL2A1 gene expression abundance in SW1353 cells cultured in conditioned medium from different batches of MSCs under IL-1β induction. Figure 5 Correlation analysis curves of TSP2 concentration and COL2A1 expression; Figure 6 A schematic diagram showing the comparison of TSP2 concentration in the supernatant of MSCs after ELISA treatment with different concentrations of TSP2-siRNA. Figure 7 This is a schematic diagram of the RT-qPCR results of COL2A1 mRNA expression in SW1353 cells cultured in conditioned medium containing different concentrations of TSP2-siRNA under IL-1β induction. Detailed Implementation

[0021] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application.

[0022] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. This application will now be described in detail with reference to the accompanying drawings and embodiments.

[0023] Example 1

[0024] Description of relevant raw materials and equipment: MSCs were obtained from Wharton's jelly in the umbilical cords of healthy newborns. Human chondrocytes (SW1353) were obtained from the Cell Bank of the Chinese Academy of Sciences. MSC Suppl Mix, MSC Basal Medium, DMEM / F12 medium, and 0.25% Trypsin-EDTA were obtained from Gibco Life Sciences (California, CA). UltraGRO-50 was purchased from AventaCell BiomedicalCrop. (Taipei, China). 0.22 μm needle filters were purchased from Guangzhou Jetech Biofiltration Co., Ltd. Human Thrombospondin-2 Quantikine ELISA Kit was purchased from Bio-Techne R&D Systems (Minnesota, MN). Fetal Bovine Serum (FBS) was purchased from Suzhou Ecosun Biotechnology Co., Ltd. RNAeasy™ Animal RNA Extraction Kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd. Evo M-MLV reverse transcription reagent premix (for qPCR) and SYBR Green Pro Taq HS premixed qPCR kit were purchased from Hunan Aikerui Biotechnology Co., Ltd. TSP2 siRNA was purchased from Nanjing Genscript Biotech Co., Ltd. Interleukin-1β (IL-1β) was purchased from Thermo Fisher Scientific (Waltham, MA).

[0025] The SpectraMax® iD3 multifunction plate reader was purchased from Shanghai Meigu Molecular Instruments Co., Ltd. The ABI 7500 real-time PCR instrument and the Dual Flat Block GeneAmp™ PCR System 9700 were both purchased from Thermo Fisher Scientific (Waltham, MA). All water with a resistivity higher than 18.2 MΩ·cm used in the experiments was purified using the Barnstead GenPure Pro UV / UF ultrapure water system (Thermofisher).

[0026] The specific method and process are as follows: I. Collection of conditioned culture media Resuscitate different batches of MSCs at a rate of 5000 cells / cm³. 2 T175 cells were seeded at a density in culture flasks and cultured at 37°C with 5% CO2. Once cell confluence reached 80%, the original culture medium was discarded, and the cells were washed once with 1×DPBS, after which the DPBS was removed. Basal culture was added, and the cells were cultured for another 24 hours at 37°C with 5% CO2. The cell supernatant was collected by centrifugation at 2000 rpm for 10 minutes at room temperature, and filtered through a 0.22 μm filter to remove impurities. The filtrate was then stored at -80°C. The basal culture medium served as a negative control.

[0027] 2. Perform ELISA detection on TSP2 expression according to standard operating procedures.

[0028] (1) Prepare the standard and sample diluents according to the standard operating procedure. Remove the collected conditioned medium and control samples from the -80°C freezer, thoroughly dissolve and mix, and then mix the conditioned medium or control samples with the standard and sample diluents at a 1:1 ratio. Take the ELISA strip coated with TSP2 and proceed according to... Figure 2 The procedure shown involves preparing standard samples by adding 100 μL of Assay Diluent RD1-75 and 50 μL of the aforementioned standard, reference, or sample to each well of the plate. After covering the wells with a sealing film, incubate the plate at room temperature for 2 hours on a horizontal shaker at a speed of 500 ± 50 rpm.

[0029] (2) After incubation, drain the liquid from the ELISA plate from step (1), add 400 μL of 1× washing buffer to each well, gently shake to remove the detergent, and repeat 4 times. Add 200 μL of human platelet-reactive protein-2 conjugate to each well and incubate on a shaker for 2 h. After incubation, drain the liquid from the plate, add 400 μL of 1× washing buffer to each well, gently shake to remove the detergent, and repeat 4 times. Add 200 μL of substrate solution to each well and incubate on a shaker at room temperature in the dark for 30 min. Add 50 μL of stop solution to each well. Using 570 nm as the calibration wavelength, measure the optical density (OD value) of each well at a wavelength of 450 nm using a microplate reader. Construct a standard curve and calculate the fitted concentration, multiply it by the sample dilution factor to obtain the measured concentration of the sample. The results are as follows: Figure 3 As shown, the cell supernatant of batch 4 had the lowest TSP2 expression concentration, while the cell supernatant of batch 2 had the highest TSP2 expression concentration.

[0030] III. Verify the correlation between TSP2 concentration and COL2A1 expression abundance. SW1353 cells (human chondrosarcoma cells) in logarithmic growth phase were collected and cultured at a rate of 2.5 × 10⁻⁶ cells / year. 5 Cells were seeded at a density of 10% per well in 6-well plates using DMEM / F12 medium containing 10% FBS (v / v) and incubated at 37°C with 5% CO2 for 24 h. Subsequently, the medium was replaced with fresh medium containing 10 ng / mL IL-1β and co-incubated for 24 h to induce an inflammatory environment for osteoarthritis. A blank control group was added to complete medium without IL-1β. Different batches of conditioned medium were added and cultured for 24 h. The medium was discarded, and the cells were washed once with 1×DPBS, removing the DPBS. Total RNA was extracted from the cells using a kit. Using the total RNA as a template, cDNA was obtained by reverse transcription using a premixed reverse transcription reagent.

[0031] Real-time quantitative PCR was performed using cDNA as a template and GAPDH as an internal control. The sequences of the COL2A1 and internal control primers are as follows: COL2A1 forward: CCAGATGACCTTCCTACGCC; COL2A1 reverse: TTCAGGGCAGTGTACGTGAAC; GAPDH forward: GGGAAGGTGAAGGTCGGAGT; GAPDH reverse: GGGGTCATTGATGGCAACA.

[0032] After reacting at 95℃ for 30 seconds, the reaction was repeated 40 times under the following conditions: 95℃ for 5 seconds, 60℃ for 35 seconds. The results are attached. Figure 4As shown, inflammatory stimulation causes downregulation of COL2A1 expression in SW1353 chondrocytes, while incubation in MSC conditioned medium reverses this downregulation. Linear curves were plotted with TSP2 concentration and COL2A1 mRNA abundance as the x and y axes, respectively, to evaluate the correlation between TSP2 concentration and type II collagen expression in SW1353 cells. The coefficient of determination R0 was used. 2 It is 0.6425. For example... Figure 5 As shown in the curve, the higher the TSP2 concentration, the higher the COL2A1 expression, indicating a positive correlation between TSP2 concentration and COL2A1 expression. This is because TSP2 in the culture medium can promote the expression of type II collagen, improve the inflammatory environment of osteoarthritis, and thus promote cartilage regeneration.

[0033] IV. Expression of TSP2 in Silent Mesenchymal Stem Cells Resuscitate different batches of MSCs at a rate of 5000 cells / cm³. 2 MSCs were evenly seeded in six-well plates and cultured at 5% CO2 and 37°C. Subsequently, the medium was replaced with medium containing the same concentrations of siRNA (0, 25, and 75 pmol) to silence TSP2 expression. Cells were cultured for 24 hours, with 0 pmol serving as a blank control. The medium was then replaced with basal medium and cultured for another 24 hours, after which the supernatant was collected. The TSP2 content in the supernatant was detected by ELISA. Results are shown below. Figure 6 As shown, siRNA effectively silenced the expression of TSP2 in MSCs.

[0034] V. Analysis of the effect of TSP2 silencing conditioned medium on COL2A1 gene expression in SW1353 cells SW1353 cells in logarithmic growth phase were collected and cultured at a rate of 2.5 × 10⁻⁶ cells / cells. 5 Cells were seeded at a density of 100 cells per well in 6-well plates using DMEM / F12 medium containing 10% FBS and incubated at 37°C for 24 h at 5% CO2. Subsequently, the medium was replaced with fresh medium containing 10 ng / mL IL-1β and co-incubated for 24 h to induce an inflammatory environment for osteoarthritis. A blank control group was added with complete medium without IL-1β. The supernatant was discarded, and the medium was replaced with the supernatant of MSCs treated with collected siRNA. The cells were incubated at 37°C for 24 h at 5% CO2. The medium was then discarded, and the cells were washed once with 1×DPBS, after which the DPBS was removed. RNA extraction, cDNA reverse transcription, and qPCR were performed sequentially to detect COL2A1 expression. Results are as follows: Figure 7 As shown, when the TSP2 concentration was reduced by siRNA to ≤1.004 ng / mL, the supernatant could not reverse the inflammation-induced downregulation of COL2A1 expression in chondrocytes. Therefore, detecting TSP2 levels can serve as a predictive indicator of biological potency.

[0035] VI. Accuracy of predicting the biological titer of mesenchymal stem cells We continued to collect conditioned medium, measured the TSP2 concentration using ELISA, and after culturing SW1353 cells in conditioned medium, collected the cells and measured their corresponding COL2A1 expression levels. We predicted that samples with TSP2 concentrations >1.004 ng / mL would have a cartilage regeneration and protective effect, i.e., promote the upregulation of COL2A1 expression in SW1353 cells; samples with TSP concentrations <1.004 ng / mL would not promote COL2A1 expression in SW1353 cells. We actually measured the COL2A1 expression level after culturing SW1353 cells in multiple conditioned media.

[0036] Table 1. Results of TSP2 prediction accuracy for type II collagen expression.

[0037]

[0038] The results are shown in Table 1. Based on the test results, the test results of the test reagents were compared with the results, and the concordance rate is as follows: Sensitivity = 30 / (30+0)×100%=100% Specificity = 12 / (1+12) × 100% = 92.31% Positive predictive value = 30 / (30+1)×100% = 96.77% Negative predictive value = 12 / (0 + 12) × 100% = 100% Overall compliance rate = (30+12) / (30+1+0+12)×100%=97.67%.

[0039] In summary: This invention uses ELISA to quantitatively detect the level of TSP2 in MSC supernatant and RT-qPCR to detect the effect of the supernatant on COL2A1 mRNA expression in SW1353 cells, thereby evaluating the effect of MSCs on extracellular matrix regeneration of chondrocytes in osteoarthritis (OA). The process is simple and convenient, combining ELISA and RT-qPCR to accurately detect the concentration of TSP2 in the MSC culture supernatant and the expression of type II collagen in SW353 cells. The concentration of TSP2 in the MSC supernatant can predict the effect of MSCs on ColII expression in chondrocytes with a prediction accuracy of up to 97.67%. The level of TSP2 in the MSC supernatant becomes an important indicator for evaluating MSC quality. This invention selects representative COL2A1 as an indicator of cartilage regeneration capacity, facilitating batch comparison and quality control. The strategy provided by this invention has good development prospects and application value in controlling the quality of mesenchymal stem cell preparations or evaluating the therapeutic effect of osteoarthritis, and has good clinical translational potential.

[0040] The above-described embodiments are merely illustrative of certain implementations of the present invention, and are described in a relatively specific and detailed manner. However, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements are all within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A method for evaluating the biological efficacy of mesenchymal stem cells, characterized in that: Conditioned culture media were collected from different donor sources and from mesenchymal stem cells with silenced TSP2 expression. The concentration of TSP2 in the conditioned culture media was quantitatively detected using enzyme-linked immunosorbent assay (ELISA). SW1353 cells were induced with the inflammatory cytokine IL-1β to establish an inflammatory environment. After culturing in the collected conditioned culture medium for 24 hours, SW1353 cells were collected, and the abundance of type II collagen mRNA expression was detected. The correlation between TSP2 concentration in the conditioned culture medium and the abundance of type II collagen mRNA expression in SW1353 cells was established. Based on the TSP2 secretion level of mesenchymal stem cells, the biological efficacy of mesenchymal stem cells in promoting the expression of cartilage-specific collagen Col II in SW1353 cells was evaluated. Samples with TSP2 concentrations >1.004 ng / mL promoted the upregulation of COL2A1 expression in SW1353 cells; samples with TSP concentrations <1.004 ng / mL did not promote COL2A1 expression in SW1353 cells. The conditioned medium was collected according to the following method: Resuscitate different batches of MSCs at a rate of 5000 cells / cm³. 2 T175 cells were seeded at a density in culture flasks and cultured at 5% CO2 and 37°C. Once the cell confluence reached 80%, the original culture medium was discarded, the cells were washed once with 1×DPBS, and the DPBS was removed. The cells were then added to the basal culture medium and cultured for another 24 hours at 5% CO2 and 37°C. The cell supernatant was collected by centrifugation at 2000 rpm at room temperature for 10 min and filtered through a 0.22 μm filter to remove impurities. The method is used for quality control of mesenchymal stem cell preparations and is intended for non-diagnostic and non-therapeutic purposes.

2. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 1, characterized in that: The method specifically includes the following steps. S100, mesenchymal stem cell culture and conditioned medium collection; The level of TSP2 in the conditioned medium of collected MSCs was detected by S200 and ELISA. S300. The expression abundance of COL2A1 gene in SW1353 cells was analyzed by RT-qPCR. S400, TSP2 expression was inhibited using small interfering RNA, and the level of TSP2 in the supernatant of MSCs was measured by ELISA; S500. The expression abundance of COL2A1 gene in SW1353 cells cultured in conditioned medium after TSP2 silencing was analyzed by RT-qPCR.

3. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 2, characterized in that: The specific steps S100 are as follows: S110. Obtain MSCs from healthy donors using umbilical cord, bone marrow, adipose tissue or other sources. After culturing to the fourth generation, culture them in complete medium at 37°C in a CO2 incubator for 24 hours, then replace with basal medium and continue culturing for another 24 hours before collecting the cell supernatant. S120. Collect the cell supernatant from step S110 by centrifuging at 2000 rpm and room temperature for 10 min to remove cell debris and collect the supernatant. S130. Take the supernatant from step S120, filter it through a 0.22μm filter membrane, collect it, and store it in a -80℃ freezer. The collected liquid is a conditioned medium.

4. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 2, characterized in that: The specific steps of S200 are as follows: S210. Add the conditioned medium and TSP2 standard solution to a 96-well plate pre-coated with anti-TSP2 antibody. The mixed solution obtained in steps S220 and S210 was incubated on a shaker at room temperature for 2 hours at a speed of 500±50 rpm. The mixture was then removed, and the solution was washed four times with washing solution. The supernatant was discarded, and the precipitate was retained. S230. Add 200 μL LSP2 coupling agent to each well and incubate on a shaker for 2 hours. After incubation, remove the liquid from the plate and wash 4 times. S240. Add substrate solution to the plate, 200 μL per well, and incubate on a shaker at room temperature in the dark for 30 min. Using S250 and 570nm as the calibration wavelength, a standard curve was created by measuring the optical density (OD) value of each well at a wavelength of 450nm using an ELISA reader, and the TSP2 concentration was calculated.

5. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 2, characterized in that: The specific steps S300 are as follows: S310. SW1353 cells were cultured in DMEM / F12 medium containing 10% FBS in a CO2 incubator at 37°C. S320: Discard the culture medium from step S310, replace it with conditioned medium, and culture at 37°C in a CO2 incubator for 72 hours. Collect the cells after trypsin digestion for 1 minute. S330. Extract RNA from cells in step S320 and synthesize cDNA using reverse transcription. S340. The expression abundance of COL2A1 gene in SW1353 was detected by RT-qPCR. S350. The effect of TSP2 concentration on COL2A1 expression was evaluated by fitting linear curves.

6. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 2, characterized in that: The specific step S400 is as follows: S410. Use complete culture medium to culture MSCs in a CO2 incubator at 37°C for 24 hours. S420. On the second day, MSCs were transfected with siRNA at different concentrations of 0, 25, and 75 pmol to inhibit TSP2 expression and cultured at 37°C in a CO2 incubator for 24 h. S430, On the third day, discard the supernatant, replace the culture medium with the basal culture medium, and incubate at 37°C in a CO2 incubator for 24 hours. S440. Collect the cell supernatant from step S430 by centrifuging at 2000 rpm and room temperature for 10 min to remove cell debris and collect the supernatant. S450. Take the supernatant from step S440, filter it through a 0.22μm filter membrane, collect it, and store it in a -80℃ freezer. The collected liquid is a conditioned medium. S460. Using 570nm as the calibration wavelength, measure the OD value of each well at 450nm using an ELISA reader to create a standard curve and calculate the TSP2 concentration.

7. The method for evaluating the biological efficacy of mesenchymal stem cells according to claim 2, characterized in that: The specific steps S500 are as follows: S510. SW1353 cells were cultured in DMEM / F12 medium containing 10% FBS in a CO2 incubator at 37℃. The medium was supplemented with 10 ng / mL IL-1β to simulate the inflammatory environment of osteoarthritis. S520: Discard the culture medium from step S510, replace it with the conditioned medium after TSP2 silencing, and culture in a CO2 incubator at 37°C for 48 hours. After washing with DPBS, collect the cells. S530. Extract RNA from cells in step S520 and synthesize cDNA using reverse transcription. S540. The expression abundance of the COL2A1 gene in SW1353 was detected by RT-qPCR.

Images