Double-end modified probe for detecting single nucleotide polymorphism, design method and application thereof

Abstract

The application discloses a double-end modified probe for detecting single nucleotide polymorphism, a design method and application thereof. Through the synergistic effect of thio modification and locked nucleic acid modification, the SNP site and 3' end artificial mutation design are combined to improve the discrimination degree and detection sensitivity of the probe to the wild type and the mutant type. Experiments show that the probe can detect a mutation ratio as low as 0.1%, the difference between the wild type and the mutant type in the melting temperature is greater than 4 DEG C, and is suitable for multiple detection of drug resistance genes or strain identification of pathogenic microorganisms such as Mycobacterium tuberculosis.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection, and in particular to a doubly modified probe for detecting single nucleotide polymorphisms, its design method, and its application. Background Technology

[0002] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. Numerous studies have shown that SNPs in some pathogenic bacteria are associated with antibiotic resistance. For example, SNPs in genes such as rpob in Mycobacterium tuberculosis are associated with rifampicin resistance, SNPs in the inhA gene are associated with isoniazid resistance, and SNPs in the gyrA gene are associated with fluoroquinolone resistance. Detecting mutations in these genes is crucial for determining bacterial resistance and provides important guidance for clinical medication. Current techniques for detecting SNPs include sequencing, TaqMan probe assays, ARMS-PCR, and high-resolution melting curve analysis. Multiplex melting curve analysis is also a primary method for SNP detection.

[0003] Multiplex melting curve technology offers significant advantages for the detection of known SNP types. This technique utilizes primers and paired-end labeled molecular beacon probes. By adjusting the concentration ratio of the upstream and downstream primers, the template can be amplified and the amplified products analyzed simultaneously in a single reaction, with the detection results presented as amplification and melting curves. Furthermore, multiple probes with different Tm values ​​can be designed within the same fluorescence channel to detect multiple targets, offering high throughput. In addition, the degree of matching between the probe and target sequence in the melting curve is directly reflected in the Tm value of the melting peak; that is, the higher the matching degree, the larger the Tm value, and the lower the matching degree, the smaller the Tm value. Therefore, a single probe can be used to simultaneously detect multiple target sequences with different matching degrees (e.g., wild-type, homozygous mutant, and heterozygous mutant), thus simplifying probe design.

[0004] However, existing melting curve probe designs still have some significant shortcomings. The main issue is limited resolution, meaning a weak ability to distinguish individual base differences. This manifests as insignificant differences in melting temperature (Tm) between wild-type and mutant sequences, especially in distinguishing high-GC-content sequences, making it difficult to select reliable probes. Secondly, the detection limit for mutation abundance is insufficient, meaning that when the mutant sequence accounts for a low proportion of the overall sequence, it may miss detections, failing to effectively detect early heterozygous mutant samples and leading to false negatives, thus compromising its timeliness in clinical testing applications. Therefore, it is necessary to improve the design of existing melting curve probes and further optimize their SNP detection performance. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a design method for a doubly modified probe for detecting single nucleotide polymorphisms. The probe designed by this method can significantly improve the ability to distinguish SNP sites and the sensitivity to detect low abundance mutations.

[0006] The present invention also provides a probe designed according to the method and its application in the field of in vitro diagnostics.

[0007] The technical solution adopted by this invention to solve its technical problem is:

[0008] A method for designing a paired-end modified probe for detecting single nucleotide polymorphisms (SNPs), the method comprising the following steps:

[0009] a) Design a probe complementary to a target sequence segment containing an SNP site, wherein the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a quenching group;

[0010] b) The probe is subjected to a combination of thiolation and locked nucleic acid (LNA) modification, wherein:

[0011] The thiomodification is performed on the first two bases at the 5' end of the probe and on one of the 7th to 9th bases at the 5' end.

[0012] The location of the locked nucleic acid modification is: modification of the bases near the SNP site;

[0013] c) The sequence of the probe is artificially mutated, wherein:

[0014] Artificial mutations were performed on the bases corresponding to the SNP sites on the probe to make them non-complementary to both wild-type and mutant target sequences;

[0015] One or two bases at the 3' end of the probe are artificially mutated to make them non-complementary to the target sequence.

[0016] This invention abandons the idea of ​​single modification and combines thiomodification, which enhances probe stability and resistance to nuclease degradation, with locked nucleic acid (LNA) modification, which can significantly improve the thermal stability of base pairing and mismatch recognition ability, thus providing the probe with excellent basic performance.

[0017] Through extensive experiments, the inventors discovered that the location of the modification is crucial. Optimal amplification efficiency and melting peak shape can only be achieved when the thiomodification is precisely applied to the specific combination of "the two bases before the 5' terminus and one of the 7th-9th positions at the 5' terminus." Furthermore, concentrating LNA modification near SNP sites maximizes its ability to identify single-base mismatches.

[0018] This invention further introduces the concept of double artificial mismatch. First, a "universal" mismatched base is introduced at the SNP site, artificially reducing the basic binding ability of the probe with all targets (wild-type and mutant), thereby amplifying the Tm value difference between wild-type and mutant due to the presence of the original mismatch. Second, one or two mismatches are introduced at the 3' end of the probe, further reducing the binding stability of the probe with the wild-type template, thereby widening the Tm value difference with the mutant template again.

[0019] Preferably, the rule for artificially mutating the bases corresponding to the SNP sites in step c) is as follows: if the wild-type target sequence is A or T at the site, the corresponding base on the probe is mutated to G; if the wild-type target sequence is G or C at the site, the corresponding base on the probe is mutated to A.

[0020] Preferably, the locked nucleic acid modification is located on the bases on both sides of the SNP site to form a "clamping" effect on the SNP site.

[0021] Preferably, the probe designed by the method binds to the wild-type target sequence and the mutant target sequence, and the melting temperature difference (ΔTm) is greater than 4℃.

[0022] Preferably, the probe designed by the method is capable of detecting mutant target sequences with an abundance as low as 0.1% in wild-type target sequences.

[0023] Preferably, the 5' end fluorescent group is selected from FAM, VIC, HEX, ROX, CY5 or CY5.5, and the 3' end quenching group is selected from BHQ1, BHQ2, MGB or Dabycl.

[0024] A probe for detecting single nucleotide polymorphisms, designed according to the method described in this invention.

[0025] A doubly modified probe for detecting single nucleotide polymorphisms, comprising a linear oligonucleotide with a fluorescent group labeled at the 5' end and a quencher group labeled at the 3' end, and satisfying all of the following structural characteristics:

[0026] a) Its sequence contains artificial mutations of 1 to 2 bases at the 3' end corresponding to the SNP site, so that these bases are not complementary to the target sequence;

[0027] b) Its nucleotides undergo combinatorial modifications, including thiolation and locked nucleic acid modifications;

[0028] c) The thiomodification is located at the first two bases of the 5' end of the probe and at one of the 7th to 9th bases of the 5' end;

[0029] d) The locked nucleic acid modification is located on the bases near the SNP site.

[0030] Preferably, the probe binds to wild-type and mutant target sequences with a melting temperature difference (ΔTm) greater than 4°C and can detect mutant target sequences with an abundance as low as 0.1%.

[0031] Preferably, the probe is used to simultaneously detect ≥4 SNP sites using the multiple melting curve method.

[0032] Preferably, 5-7 bp complementary sequences are selectively added to both ends of the probe, and these sequences are not involved in the calculation of GC content, Tm value and length.

[0033] The application of the probe described in this invention in the preparation of kits for detecting drug resistance genes of pathogenic microorganisms or for strain identification.

[0034] Preferably, the pathogenic microorganism drug resistance gene includes Mycobacterium tuberculosis drug resistance genes.

[0035] Compared with the prior art, the present invention has the following significant advantages:

[0036] The probe designed in this invention binds to wild-type and mutant target sequences, and its melting temperature difference (ΔTm) can be stably greater than 4℃, which is more than twice that of traditional probes (usually <2℃). This makes the melting peaks clearly separated, and the results are intuitive, accurate and unambiguous.

[0037] The design of this invention significantly improves the ability to capture low-abundance mutations, and can stably detect mutant target sequences with an abundance as low as 0.1% in a large wild-type background, achieving accurate detection of early mutations or mixed infection samples, which has important clinical value.

[0038] This invention provides a clear and reliable set of design rules, which greatly improves the success rate of probe design and has been validated in the detection of multiple drug resistance genes (rpoB, inhA, embB, gyrA) in Mycobacterium tuberculosis, proving its wide applicability.

[0039] The probe designed in this invention can be applied to multiple melting curve analysis. By labeling different fluorescence channels, multiple SNP sites can be detected simultaneously in one reaction tube, which improves detection efficiency and reduces detection costs. Attached Figure Description

[0040] Figure 1 This is a comparison of the amplification curves and melting peaks of the drug-resistant gyrA gene in Mycobacterium tuberculosis detected by thiomodified TaqMan probes and conventional molecular beacon probes.

[0041] Figure 2This is a comparison of the amplification curves and melting peaks of the drug-resistant gyrA gene in Mycobacterium tuberculosis detected by TaqMan probes with thiomodified or locked nucleic acid modifications.

[0042] Figure 3 This is a comparison of the amplification curves and melting peaks of the drug-resistant gyrA gene in Mycobacterium tuberculosis detected by TaqMan probes at different thiomodification sites. Detailed Implementation

[0043] The technical solution of the present invention will be further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any modifications and / or alterations made to the present invention will fall within the protection scope of the present invention.

[0044] In this invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used are commercially available or commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0045] Unless otherwise specified, the reagents used in the following examples can be purchased from a regular biochemical reagent store.

[0046] In this invention, the 5' end of the probe is modified with a thioglycolic acid. This modification replaces a non-bridging oxygen atom in the original phosphate bond with a sulfur atom, reducing the degradation by nucleases and improving the stability of the modified nucleotide. Furthermore, this invention adds locked nucleic acid modifications to the mutation sites and nearby bases on the probe, altering the probe's Tm value. This shortens the probe length, increases the selectivity of the designed fragment, and also improves the discriminative power of the melting curve.

[0047] Furthermore, this invention adjusts and optimizes the number and position of the thiomodified bases, adding 2 to 3 thiomodifications at the 5' end, 3' end, and middle position of the probe, and designs probes that simultaneously add thiomodifications at the 5' end and 3' end, 5' end and middle position, and 3' end and middle position. It is confirmed that adding thiomodifications simultaneously at the 5' end and middle position of the probe has a better effect.

[0048] Furthermore, this invention artificially mutates the bases corresponding to the SNP sites. If the SNP site is A / T, the probe sequence is mutated to G / C; if the SNP site is G / C, the probe sequence is mutated to A / T. Preferably, if the SNP site is A / T, the probe sequence is mutated to G; if the SNP site is G / C, the probe sequence is mutated to A. Additionally, one to two sites are selected at the 3' end of the probe sequence and artificially mutated to bases that are not complementary to the original sequence. By adding artificial mutation sites to the probe sequence, the matching degree between the probe and substrate sequences is reduced, thereby affecting the Tm value of the product and increasing the differentiation between wild-type and mutant templates in the melting curve.

[0049] Finally, using the probe design method described above, this invention designed a series of specific multiplex modified probes and corresponding primers targeting multiple SNPs related to Mycobacterium tuberculosis drug resistance genes. The effectiveness of the probe design method in this invention was verified at different target sites.

[0050] Preferred probe design methods include:

[0051] 1. Following the TaqMan probe design principles, probe sequences were selected. After comparing whether short complementary sequences were added to both ends of the probe, it was found that probes that do not require complementary sequences and directly add fluorescent genes and quenching groups to both ends of the probe sequence are preferred.

[0052] 2. The detection performance of probes with thiolation modification alone, locked nucleic acid modification alone, and simultaneous thiolation and locked nucleic acid modification was compared. It was found that the probe with simultaneous thiolation and locked nucleic acid modification had better detection performance. The scheme with both modifications was selected as the preferred option.

[0053] 3. When determining the thiomodification site, the optimal approach is to modify the first two bases at the 5' end, and then randomly add a thiomodification to one of the 7th to 9th bases at the 5' end.

[0054] This invention provides a method for designing paired-end modified probes for detecting SNP sites using the multiple melting curve method. This invention uses thio-modification and locked nucleic acid modification to modify bases at specific positions on the probe. At the same time, by artificially mutating certain bases on the probe, the probe designed according to this invention has greater discrimination and higher sensitivity when detecting wild-type and mutant samples.

[0055] Examples of detection of drug resistance-related SNPs in Mycobacterium tuberculosis demonstrate that the Tm values ​​of the double-ended modified probe optimized by this method differ by more than 4°C when detecting wild-type and mutant samples. At the same time, the limit of detection for low-abundance mutant templates can reach 0.1%, and the sensitivity is better than that of conventional asymmetric primers with multiple melting curves, thus having high clinical application value.

[0056] Example 1: Comparison of detection performance between thiomodified TaqMan probes and molecular beacon probes.

[0057] The fluoroquinolone resistance gene gyrA in Mycobacterium tuberculosis (SNP sites are underlined, the same below) was selected to design thiolated TaqMan probes and molecular beacon probes (* indicates thiolation of the right base, the same below). Upstream primer: tcggcccggtcggttgcc, SEQ ID NO:1;

[0058] Downstream primer: tggccgtccaccagcgggt, SEQ ID NO:2;

[0059] Thio-modified TaqMan probe: 6FAM-g*c*a*cggcgacg c gtcgatctacgaca-BHQ1;

[0060] Molecular beacon probe: 6FAM-CCGCGCgcacggcgacg c gtcgatctacgacaGCGCGG-BHQ1.

[0061] The PCR system used was TaKaRa Ex Premier. TM DNA Polymerase, the reaction system composition and procedure are shown in Tables 1 and 2, where the DNA template is wild-type nucleic acid.

[0062] Table 1. PCR reaction system

[0063] TaKaRa Ex Premier DNA Polymerase 2x 25 upstream primer 50μM 0.2 Downstream primer 50μM 1 probe 50μM 0.1 water / Make up to 40 μL DNA template / 10μL

[0064] Table 2. PCR reaction procedure

[0065]

[0066] Table 3. Experimental Results

[0067]

[0068]

[0069] Table 3 and Figure 1 The results showed that the thiomodified TaqMan probe had a faster amplification rate and higher fluorescence value; the thiomodified TaqMan probe also had a higher melting peak; therefore, the thiomodified TaqMan probe was preferred for further analysis.

[0070] Example 2: Comparison of detection performance of thiolated and locked nucleic acid modified TaqMan probes.

[0071] TaqMan probes with thiolated or locked nucleic acid modifications were designed based on the fluoroquinolone-resistant gyrA gene of Mycobacterium tuberculosis (+ indicates locked nucleic acid modification of the right base, the same below).

[0072] Upstream primer: tcggcccggtcggttgcc;

[0073] Downstream primer: tggccgtccaccagcgggt;

[0074] Thio-modified TaqMan probe: 6FAM-a*c*g*gcgacg c gtcgatctacga-BHQ1;

[0075] TaqMan probe modified with locked nucleic acid: 6FAM-acggcgacg+ c +g+tcgatctacga-BHQ1;

[0076] Thio-modified TaqMan probe: 6FAM-a*c*g*gcgacg+ c +g+tcgatctacga-BHQ1.

[0077] The PCR system used was TaKaRa Ex Premier. TM DNA Polymerase, the reaction system composition and procedure are shown in Tables 1 and 2, where the DNA template is wild-type nucleic acid.

[0078] Table 4. Experimental Results

[0079] Thio modification 86.48 Nucleic acid modification 165.87 Thio+ Locked Nucleic Acid Modification 246.36

[0080] Table 4 and Figure 2 The results showed that the TaqMan probe modified with thio-+locked nucleic acid had the fastest amplification rate and the highest melting peak; therefore, the TaqMan probe modified with thio-+locked nucleic acid was preferred in subsequent trials.

[0081] Example 3: Comparison of TaqMan probe detection performance at different thiomodification sites.

[0082] TaqMan probes with different thiomodification sites were designed using the fluoroquinolone-resistant gyrA gene of Mycobacterium tuberculosis.

[0083] Upstream primer: tcggcccggtcggttgcc;

[0084] Downstream primer: tggccgtccaccagcgggt;

[0085] Thio-modified TaqMan probe 1: 6FAM-a*c*g*gcgacg+ c+g+tcgatctacga-BHQ1;

[0086] Thio-modified TaqMan probe 2: 6FAM-acggcgacg+ c +g+tcgatctac*g*a*-BHQ1;

[0087] Thio-modified TaqMan probe 3: 6FAM-acggc*gacg+ c +g+t*cgat*ctacga-BHQ1;

[0088] Thio-modified TaqMan probe 4: 6FAM-a*c*ggcgac*g+ c +g+tcgatctacga-BHQ1;

[0089] Thio-modified TaqMan probe 5: 6FAM-acggcgacg+ c +g+tcga*tctacg*a*-BHQ1.

[0090] The PCR system used was TaKaRa Ex Premier. TM DNA Polymerase, the reaction system composition and procedure are shown in Tables 1 and 2, where the DNA template is wild-type nucleic acid.

[0091] Table 5. Experimental Results

[0092] Thio-modification 1 83.6 Thio-modification 2 31.61 Thio-modification 3 21.12 Thio-modification 4 127.5 Thio-modified 5 15.21

[0093] Table 5 and Figure 3 The results showed that the thiomodified probe 4 had the fastest amplification rate and the highest melting peak. The preferred thiomodification sites are the first two bases from the 5' end and one of the 7th to 9th bases from the 5' end.

[0094] Example 4: Performance test of artificial mutation at SNP sites 1.

[0095] TaqMan probes were designed to artificially mutate SNP sites in the gyrA gene of Mycobacterium tuberculosis fluoroquinolone resistance. (The bolded uppercase bases are the artificial mutation sites, and the same applies below.)

[0096] Upstream primer: tcggcccggtcggttgcc;

[0097] Downstream primer: tggccgtccaccagcgggt;

[0098] Thio-modified TaqMan probe (no mutation): 6FAM-a*c*ggcgac*g+ c +g+tcgatctacga-BHQ1;

[0099] Thio-modified TaqMan probe (artificial mutation 1):

[0100] Thio-modified TaqMan probe (artificial mutation 2):

[0101] The PCR system used was TaKaRa Ex Premier. TM DNA Polymerase, the reaction system composition and procedure are shown in Tables 1 and 2, where the DNA template is wild-type and drug-resistant nucleic acid.

[0102] Table 6. Experimental Results

[0103] No mutation 68.3℃ 67.1℃ 1.2℃ Mutation 1 (CA) 65.3℃ 60.2℃ 5.1℃ Mutation 1 (CT) 64.7℃ 62.1℃ 2.6℃

[0104] The results (Table 6) show that artificially mutating the SNP site from C / G to A / T increases the difference in Tm values ​​between wild-type and drug-resistant melting peaks, thereby increasing the discriminative power. Furthermore, artificially mutating C / G to A is more effective than T. Subsequent optimization will prioritize artificially mutating the probe sequence to A when the SNP site is G / C.

[0105] Example 5: Performance test of artificial mutation at SNP sites 2.

[0106] TaqMan probes were designed to artificially mutate the SNP site of the ethambutol-resistant embB gene in Mycobacterium tuberculosis.

[0107] Upstream primer: cctgctggcatgtcatcgg;

[0108] Downstream primer: ggctgccgaaccagcgg;

[0109] Thio-modified TaqMan probe (no mutation): 6FAM-a*t*cctggg*c a +t+g+gcccgag-BHQ1;

[0110] Thio-modified TaqMan probe (artificial mutation 1):

[0111] Thio-modified TaqMan probe (artificial mutation 2):

[0112] The PCR system used was TaKaRa Ex Premier. TM DNA Polymerase, the reaction system composition and procedure are shown in Tables 1 and 2, where the DNA template is wild-type and drug-resistant nucleic acid.

[0113] Table 7. Experimental Results

[0114] No mutation 71.2℃ 69.8℃ 1.4℃ Mutation 1 (AC) 68.3℃ 62.7℃ 5.6℃ Mutation 1 (AG) 67.9℃ 64.9℃ 3℃

[0115] The results (Table 7) show that artificially mutating the SNP site A / T to C / G increases the difference in Tm values ​​between wild-type and drug-resistant melting peaks, thereby increasing the discriminative power. Furthermore, artificially mutating A / T to G is more effective than C. Subsequent optimization will favor artificially mutating the probe sequence to G when the SNP site is A / T.

[0116] Example 6: Multiplex detection of drug resistance genes in Mycobacterium tuberculosis. Multiplex detection was performed using probes with different fluorescent channels designed for the rifampicin resistance rpoB gene, isoniazid resistance inhA gene, ethambutol resistance embB gene, and fluoroquinolone resistance gyrA gene in Mycobacterium tuberculosis.

[0117] rpoB gene upstream primer 1: ggtggtcgccgcgatc;

[0118] rpoB gene downstream primer 1: ggtgcacgtcgcggacct;

[0119] rpoB gene TaqMan probe 1:

[0120] upstream primer 2 for inhA gene: gccggaaatcgcagccac;

[0121] inhA gene downstream primer 2: cggtaaccaggactgaacggg;

[0122] TaqMan probe 2 for inhA gene:

[0123] embB gene upstream primer 3: cctgctctggcatgtcatcgg;

[0124] embB gene downstream primer 3: ggctgccgaaccagcgg;

[0125] embB gene TaqMan probe 3:

[0126] upstream primer 4 for gyrA gene: tcggcccggtcggttgcc;

[0127] gyrA gene downstream primer 4: tggccgtccaccagcgggt;

[0128] TaqMan probe 4 for the gyrA gene:

[0129] The PCR system used was TaKaRa Ex Premier. TM The DNA Polymerase reaction system composition is shown in Table 8, and the reaction procedure is shown in Table 2, where the DNA template is wild-type and drug-resistant nucleic acid.

[0130] Table 8. PCR reaction system

[0131] TaKaRa Ex Premier DNA Polymerase 2x 25 upstream primers 1-4 50μM 0.2 each Downstream primers 1-4 50μM 1 each Probes 1-4 50μM 0.1 each water / Make up to 40 μL DNA template / 10μL

[0132] Table 9. Experimental Results

[0133] rpoB-FAM 71.6℃ 66.3℃ 5.3℃ inhA-VIC 73.5℃ 67.9℃ 5.6℃ embB-ROX 74.1℃ 68.1℃ 6.0℃ gyrA-CY5 70.8℃ 66.2℃ 4.6℃

[0134] The results (Table 9) show that the probe described in this invention can achieve multiplex detection of multiple drug resistance genes, and the melting peak differentiation ΔTm between wild-type and drug-resistant genes is above 4℃.

[0135] Example 7: Detection capability test of low abundance mutation ratio of drug resistance genes in Mycobacterium tuberculosis. Different fluorescent channel probes were designed to detect mixed templates with different mutation ratios using Mycobacterium tuberculosis rifampicin resistance rpoB gene, isoniazid resistance inhA gene, ethambutol resistance embB gene, and fluoroquinolone resistance gyrA gene.

[0136] rpoB gene upstream primer 1: ggtggtcgccgcgatc;

[0137] rpoB gene downstream primer 1: ggtgcacgtcgcggacct;

[0138] rpoB gene TaqMan probe 1:

[0139] upstream primer 2 for inhA gene: gccggaaatcgcagccac;

[0140] inhA gene downstream primer 2: cggtaaccaggactgaacggg;

[0141] TaqMan probe 2 for inhA gene:

[0142] embB gene upstream primer 3: cctgctctggcatgtcatcgg;

[0143] embB gene downstream primer 3: ggctgccgaaccagcgg;

[0144] embB gene TaqMan probe 3:

[0145] upstream primer 4 for gyrA gene: tcggcccggtcggttgcc;

[0146] gyrA gene downstream primer 4: tggccgtccaccagcgggt;

[0147] TaqMan probe 4 for the gyrA gene:

[0148] The PCR system used was TaKaRa Ex Premier. TM The DNA Polymerase reaction system composition is shown in Table 8, and the reaction procedure is shown in Table 2, where the DNA template is a drug-resistant nucleic acid with different mutation ratios.

[0149] Table 10. Experimental Results

[0150]

[0151]

[0152] The results (Table 10) show that the probe described in this invention can detect low-abundance drug resistance mutations with a mutation rate as low as 0.1%, and the melting peaks of wild-type and drug-resistant mutations can be clearly distinguished (△Tm>4℃).

[0153] In summary, this invention simultaneously adds thiolated and locked nucleic acid modifications at specific positions on the probe to enhance base stability and probe specificity. Furthermore, by replacing the bases at the corresponding SNP sites, the probe's ability to distinguish between wild-type and mutant samples is increased. Compared to conventional asymmetric melting curve method probes, the probes designed in this invention have advantages in sensitivity, specificity, detection rate of low-abundance mixed templates, and the ability to distinguish between wild-type and mutant templates. Taking Mycobacterium tuberculosis drug resistance-related SNPs as an example, this invention designed a conventional probe and, based on this invention, designed a novel dual-end modified probe, and the comparison confirmed the above points.

[0154] The probes designed using this method can accurately distinguish whether a fragment in a sample contains SNP sites, and the results are presented as multiple melting curves. This method features high throughput, good specificity, and high sensitivity, and is suitable for probe design requirements in the in vitro detection of base mutations in pathogenic microorganisms.

[0155] This invention solves the problems of poor detection limit and discrimination in the prior art through dual-end modification and sequence optimization, and realizes accurate detection of drug resistance genes of pathogenic microorganisms.

Claims

1. A doubly modified probe for detecting single nucleotide polymorphisms, characterized in that, The probe is selected from one of the following probes: Thio-modified TaqMan probe: 6FAM-a*c*ggcgac*g+A+g+tcgaCctacga-BHQ1; Thio-modified TaqMan probe: 6FAM-a*c*ggcgac*g+T+g+tcgaCctacga-BHQ1; Thio-modified TaqMan probe: 6FAM-a*t*cctggg*cC+t+g+gccTgag-BHQ1; Thio-modified TaqMan probe: 6FAM-a*t*cctggg*cG+t+g+gccTgag-BHQ1; rpoB gene TaqMan probe 1: 6FAM-a*c*ccgctg*t+A+g+gggCtga-BHQ1; TaqMan probe 2 for inhA gene: VIC-c*c*gcggcg*agG+c+g+atCggttgt-BHQ1; embB gene TaqMan probe 3: ROX-a*t*cctggg*cG+t+g+gcAcgag-BHQ2; In this context, * indicates a thiolation modification of the right-hand base, and + indicates a locked nucleic acid modification of the right-hand base.

Images