A molecular marker associated with eggshell strength during peak egg production and its application

Abstract

This invention discloses a molecular marker associated with eggshell strength during peak egg production in chickens and its application, belonging to the field of biotechnology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; a T / C mutation exists at the 200th base of the sequence shown in SEQ ID NO.1. This invention screened a SNP genetic molecular marker (chr7:14542996, rs313628382, GRCg6a) that is highly associated with eggshell strength. Significant differences in eggshell strength exist among individuals with different genotypes at this locus. Based on this molecular marker, this invention developed specific primers and established a blood DNA detection method. This method requires only a small amount of blood collection to identify individuals with high eggshell strength at an early stage, offering advantages such as convenience, high throughput, and labor savings, significantly reducing breeding costs.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a molecular marker related to eggshell strength during peak egg production in chickens and its application. Background Technology

[0002] Eggshell strength is a crucial indicator of egg quality and an important candidate trait in laying hen breeding. Stronger eggshell strength reduces the risk of egg breakage during collection and transportation and is associated with hatchability. Eggshell strength is influenced by various factors, including genetics, nutrition, health status, and husbandry practices. When other factors are at similar and adequate levels, genetic differences become the key driver of eggshell strength. Traditional breeding requires long-term tracking and recording of eggshell strength information for each individual to guide subsequent selection and breeding efforts, which is time-consuming, costly, labor-intensive, and prone to errors. Therefore, early identification of genetic markers related to high / low eggshell strength from a molecular genetic perspective can help accelerate the breeding process and reduce costs.

[0003] Single nucleotide polymorphisms (SNPs) are an important class of molecular genetic markers, involving only single-base variations. Based on genome-wide association analysis (GWAS), candidate SNP loci associated with eggshell strength can be screened computationally. After accuracy verification, detection methods can be established to guide breeding efforts for related traits. The formation of reliable SNP genetic markers depends on: 1. accurate, large-scale population phenotypic information; 2. a reasonable analysis and screening strategy; and 3. accuracy verification. Currently, studies have attempted to screen genetic markers associated with eggshell strength using genomic methods, but the reported candidate genes or loci are mostly based on small-scale populations or specific strains, lacking universality and stability. Existing markers are mostly concentrated on known calcium metabolism-related genes, lacking in-depth exploration of variations in non-classical pathways or regulatory regions. Therefore, developing a highly reliable, widely applicable molecular marker significantly associated with eggshell strength is of great significance for achieving efficient and precise breeding of laying hens. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to eggshell strength during peak egg production in chickens and its application, thereby addressing the problems existing in the prior art. This invention screened a SNP genetic molecular marker (chr7:14542996, rs313628382, GRCg6a) highly correlated with eggshell strength. Significant differences in eggshell strength exist among individuals with different genotypes at this locus. Based on this molecular marker, this invention developed specific primers and established a blood DNA detection method. This method requires only a small amount of blood sampling to identify individuals with high eggshell strength at an early stage. It has the advantages of convenience, high throughput, and labor savings, significantly reducing breeding costs and avoiding the problems of long cycles, high costs, large manpower requirements, and wide errors associated with conventional breeding practices.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a molecular marker related to eggshell strength during peak egg production in chickens. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. A T / C mutation exists at the 200th base of the sequence shown in SEQ ID NO.1.

[0007] The reference genome for the molecular marker is GRCg6a.

[0008] The present invention also provides a primer pair for amplifying the above-mentioned molecular marker, comprising an upstream primer with the sequence shown in SEQ ID NO.2 and a downstream primer with the sequence shown in SEQ ID NO.3.

[0009] The present invention also provides a kit for identifying eggshell strength traits during peak egg production in chickens, the kit containing the aforementioned primer pairs.

[0010] The present invention also provides the application of the above-mentioned molecular marker, primer pair or kit in identifying eggshell strength traits during peak egg production in chickens.

[0011] This invention also provides a method for identifying eggshell strength characteristics during peak egg production in chickens, comprising the following steps:

[0012] Using the genomic DNA of the chicken to be tested as a template, PCR amplification was performed using the primer pairs or the kit described above to obtain the amplification product; the amplification product was sequenced to determine the genotype of the chicken to be tested.

[0013] Individuals with the TC genotype have higher eggshell strength than individuals with the TT or CC genotypes.

[0014] Optionally, the PCR amplification reaction system is as follows: 200 ng template DNA, 10 μL 2×Taq mix, 0.5 μL upstream primer, 0.5 μL downstream primer, and ddH2O to a final volume of 20 μL.

[0015] Optionally, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 50 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

[0016] The present invention also provides a method for selecting chickens with high eggshell strength traits. The genotype of the chickens to be tested is identified by the above method, and individuals with the genotype TC are retained to obtain chickens with high eggshell strength traits.

[0017] The present invention also provides the application of the above-mentioned molecular marker, primer pair or kit in molecular marker-assisted breeding of chickens.

[0018] The present invention discloses the following technical effects:

[0019] This invention employed genome-wide association analysis (GWAS) to analyze eggshell strength in chickens. Combined with bioinformatics screening strategies, a single SNP (chr7:14542996, rs313628382, GRCg6a) highly correlated with eggshell strength was identified. This SNP locus has three genotypes: CC, TC, and TT. The average eggshell strength of CC individuals is 2.51 kgf / cm². 2 The average eggshell strength of TC individuals is 2.77 kgf / cm². 2 The average eggshell strength of TT individuals is 2.45 kgf / cm². 2 Furthermore, there were statistically significant differences between the groups. Based on this molecular marker, this invention developed specific primers and established a blood DNA detection method. This method requires only a small amount of blood to identify individuals with high eggshell strength traits at an early stage. It has the advantages of being convenient, high-throughput, and labor-saving, which can greatly reduce breeding costs and avoid the problems of long cycles, high costs, large manpower, and wide errors in conventional breeding work. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 GWAS results for eggshell strength at 60 weeks of peak egg production in 1353 Los Angeles Red chickens;

[0022] Figure 2 The 14 SNP sites on chromosome 7 that exceed the genomic significance threshold are included (out of a total of 18 sites exceeding the genomic significance threshold).

[0023] Figure 3 This is a diagram of LD analysis for 14 SNP loci located on chromosome 7.

[0024] Figure 4 A statistical analysis graph showing the relationship between individual genotypes and eggshell strength in a population of 1353 Rhode Island Red chickens;

[0025] Figure 5 This is a schematic diagram illustrating the result interpretation of the molecular marker detection method of the present invention. Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0031] Example 1: Screening and Obtaining Molecular Markers

[0032] In this embodiment, gene chips were used to genotype 1353 Loch Ness Red chickens, and genome-wide association analysis (GWAS) was performed on eggshell strength. Combined with bioinformatics screening strategies, a single SNP molecular marker (chr7:14542996, rs313628382, GRCg6a) highly correlated with eggshell strength in this population was identified. The specific process is as follows:

[0033] 1. Phenotypic determination: Eggshell strength data of 1353 Los Angeles Red chickens (from Jiangsu Provincial Institute of Poultry Science) at 60 weeks of age during the peak egg production period (the period when the daily egg production rate of the flock is >80%) were measured and recorded.

[0034] 2. Genome-wide association analysis: A 55kJ microarray (purchased from Beijing Compson Agricultural Technology Co., Ltd.) was used to genotype each individual. After quality control and calculation of genome-wide significance thresholds, genome-wide association analysis was performed between the 55kJ variation information and the corresponding phenotypic data to identify multiple loci significantly associated with eggshell strength (see...). Figure 1 ).

[0035] 3. Screening of candidate loci: Bioinformatics annotation was performed on 18 loci exceeding the significance threshold, revealing 14 loci located on chromosome 7 (see...). Figure 2 Furthermore, genetic linkage is observed, with a range of 13.99 Mb-16.23 Mb. chr7:14542996 (located at 14542996 bp on chromosome 7, rs313628382, reference genome is GRCg6a) can be considered a tagSNP (see...). Figure 3 This site is an intron mutation that affects the transcription and translation of the UBE2E3 gene. The UBE2E3 gene is involved in the ubiquitin-mediated proteolysis pathway, and ubiquitination is involved in the synthesis and secretion of calcium carbonate, the main component of eggshells. Therefore, chr7:14542996 was identified as a candidate site.

[0036] 4. Determining the relationship between the genotype of this genetic marker and eggshell strength.

[0037] Within this population, three genotypes were observed at this locus: CC, TC, and TT. CC individuals comprised 79.9% of the population, TC individuals comprised 19.4%, and TT individuals comprised 0.7%. The average eggshell strength of CC individuals was 2.51 kgf / cm². 2 The average eggshell strength of TC individuals is 2.77 kgf / cm². 2 The average eggshell strength of TT individuals is 2.45 kgf / cm². 2 And there were statistically significant differences between the groups (see Figure 4 Since the population size of the TT homozygous type at this locus is small (<1.0%), the TT type is excluded. It is determined that the TC heterozygous type at this locus has the trait of high eggshell strength and should be selected; the CC and TT homozygous types have the trait of low eggshell strength and can be eliminated.

[0038] Example 2: Application of Molecular Markers

[0039] This embodiment used 48 Loch Ness Red hens (from Jiangsu Provincial Poultry Science Research Institute) as experimental subjects to verify that by detecting the gene type of the molecular marker in Example 1, chickens with high eggshell strength traits can be selected. The specific process is as follows:

[0040] 1. Blood collection: Using a blood collection needle and an anticoagulant EDTA vacuum blood collection tube, collect 0.1-0.3 mL of blood from the subwing vein of each chicken to be tested for subsequent testing.

[0041] 2. Blood DNA extraction: Using a blood DNA extraction kit, blood sample DNA was extracted according to the operating procedure. The DNA concentration was measured and controlled at 25-200 ng / μL for subsequent PCR.

[0042] 3. PCR: Specific primers designed for the sequence of this molecular genetic marker (chr7:14542996) (as shown in SEQ ID NO.1) were used to amplify the extracted DNA by PCR. The PCR primer sequences are shown in Table 1. The PCR reaction system was 20 μL, as shown in Table 2. The PCR reaction procedure is shown in Table 3. The amplified products were used for subsequent experiments.

[0043] SEQ ID NO.1:

[0044] GAACGTCAAGAAACAACCTCTTTTGACTTCTTTTCTGTACCCTGATGCTATGTTAACTTCTGAAGGCTAATTACGATCACTGAAATTTCAACAAAATCACTCCACTGTTGAAAACCAAACTGAAACATGCTATCATGCAGGGGTTTGTTCAGTGCAGCCAAGGATACACTTGGCACTTCACACTTTTCTTTCATTTCAG(C / T)GTTCTTCCAGAACAAACACACATTCACAAAAAT TGAAATACTCTGGCGCAGCTGGATGCAATCTTGATTCCCACTTAGGAGGGCAGTGTTCAAAAGCACGTCCAAAAATGACTGAGAAGCAATGTGTTCAGGTCCAAACCCAAAAGGGGAATTCACATTACATGAGCAGTGGCT.

[0045] Table 1 Primer sequences

[0046] ForwardPrimer GAACGTCAAGAAACAACCTCTT(SEQ ID NO.2) ReversePrimer AGCCACTGCTCATGTAATGTGA(SEQ ID NO.3)

[0047] Table 2 PCR reaction system

[0048] ForwardPrimer (10μM) 0.5μL ReversePrimer (10μM) 0.5μL 2×Taqmix 10μL DNA (25-200 ng / μL) 200ng <![CDATA[ddH2O]]> Fill to 20μL

[0049] Table 3 PCR reaction procedure

[0050]

[0051] 4. Quality Control and Sequencing of Amplified Products: Take 1 μL of amplified product, mix with 1 μL of nucleic acid dye, and add a DNA marker. Perform 1.5% agarose gel electrophoresis on the same batch. After electrophoresis, if a single band of 374 bp is observed, the quality control is passed and the product can be used for subsequent sequencing. For amplified products that pass the quality control, Sanger sequencing is used to obtain sequencing data. The base information at the 200 bp position is read (see...). Figure 5 ).

[0052] 5. Result Interpretation: If the result shows a TC heterozygous genotype, the individual exhibits a high eggshell strength trait; if it shows a CC or TT homozygous genotype, the individual exhibits a low eggshell strength trait. The results showed that among the 48 chickens, 12 had the TC genotype, 36 had the CC genotype, and 0 had the TT genotype. Based on the result interpretation criteria, the TC genotype individuals were retained, while the CC and TT genotype individuals were culled.

[0053] The above results demonstrate that the molecular markers and detection methods screened in this invention require only a small amount of blood sampling to identify individuals with high eggshell strength traits at an early stage. This approach is convenient, has high throughput, and saves labor costs, thus reducing breeding costs. Based on a breeding cost of 190 yuan per hen from chick to culling, and considering the population gene frequency, individuals with the TC type high eggshell strength trait account for approximately 19.4% of the total population. Therefore, 80.6% of individuals with low or high eggshell strength traits can be culled early. If 10,000 chickens are raised, and this is the sole breeding objective, after deducting the detection cost of this method, approximately 1.4914 million yuan can be saved (10,000 × 190 yuan / hen × 80.6% - 40,000 yuan).

[0054] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a molecular marker associated with eggshell strength during peak egg production, a primer pair for amplifying the molecular marker, or a kit containing the primer pair in identifying the eggshell strength trait during peak egg production in Loch Ness Red chickens; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / C mutation exists at the 200th base of the sequence shown in SEQ ID NO.1; The primer pair includes an upstream primer with the sequence shown in SEQ ID NO.2 and a downstream primer with the sequence shown in SEQ ID NO.3; Individuals with the TC genotype have higher eggshell strength than individuals with the TT or CC genotypes.

2. A method for identifying eggshell strength characteristics during peak egg production in chickens, characterized in that, Includes the following steps: Using the genomic DNA of the chicken to be tested as a template, PCR amplification is performed using the primer pair described in claim 1 or the kit described in claim 1 to obtain the amplification product; the amplification product is sequenced to determine the genotype of the chicken to be tested. The chickens tested were Rhode Island Reds; The nucleotide sequence of the amplified product is shown in SEQ ID NO.

1. A T / C mutation exists at the 200th base of the sequence shown in SEQ ID NO.

1. Individuals with genotype TC have higher eggshell strength than individuals with genotype TT or CC.

3. The method according to claim 2, characterized in that, The PCR amplification reaction system was as follows: 200 ng template DNA, 10 μL 2×Taq mix, 0.5 μL upstream primer, 0.5 μL downstream primer, and ddH2O to a final volume of 20 μL.

4. The method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 50 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

5. A method for selecting chickens with high eggshell strength during peak egg production, characterized in that, The genotype of the chicken to be tested is identified by the method described in any one of claims 2-4, and individuals with the genotype TC are retained to obtain chicken individuals with high eggshell strength trait; The chickens tested were Rhode Island Red chickens.

6. The application of a molecular marker related to eggshell strength during peak egg production, a primer pair for amplifying the molecular marker, or a kit containing the primer pair in marker-assisted breeding of Loch Ness Red chickens; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / C mutation exists at the 200th base of the sequence shown in SEQ ID NO.1; The primer pair includes an upstream primer with the sequence shown in SEQ ID NO.2 and a downstream primer with the sequence shown in SEQ ID NO.3; Individuals with the TC genotype have stronger eggshells than individuals with the TT or CC genotypes. The molecular marker-assisted breeding targets the eggshell strength trait during the peak egg production period of chickens.

Images