Polynucleic acid molecule for inhibiting expression of ANGPTL3, pharmaceutical composition and application thereof

Abstract

Disclosed herein are polynucleic acid molecules that can be used to repress the expression of an angiopoietin-like protein 3 (ANGPTL3) gene. In addition, described herein are pharmaceutical compositions comprising a polynucleic acid molecule that targets angiopoietin-like protein 3 (ANGPTL3) mRNA. Further, provided herein are methods for repressing the expression of ANGPTL3 by utilizing the polynucleic acid molecules described herein.

Description

[0001] Cross-referencing

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 438,498, filed January 11, 2023, which is incorporated herein by reference in its entirety. Background Technology

[0003] The discovery of RNA interference (RNAi) as a cellular mechanism for selectively degrading mRNA allows for both targeted manipulation of cell phenotypes in cell culture and the potential for developing targeted therapeutics (Behlke, 2006, Mol. Ther. 13, 644-670; Xie et al., 2006, Drug Discov. Today 11, 67-73).

[0004] Hyperlipidemia is a global condition describing elevated lipid levels in the body. It is considered a major risk factor for atherosclerosis, coronary heart disease, and other vascular diseases. Angiopoietin-like protein 3 (ANGPTL3) plays a crucial role in lipoprotein / plasma lipid metabolism and is primarily produced by cells in the liver. Inhibition of ANGPTL3 is associated with a decrease in plasma lipids, including low-density lipoprotein (LDL) cholesterol, high-density lipoprotein (HDL) cholesterol, and triglycerides. Therefore, there is a need to develop effective ANGPTL3 inhibitors without cytotoxicity. The polynucleotide molecules, their conjugates, and methods described in this article meet this need and offer relevant advantages.

[0005] Incorporation

[0006] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent, or patent application is expressly and individually indicated to be incorporated by reference. Where a publication, patent, or patent application incorporated by reference contradicts the disclosure contained in this specification, this specification is intended to supersede and / or give precedence to any such contradictory material. Summary of the Invention

[0007] To meet the need for more effective ANGPTL3 inhibitors, this article provides, in one respect, polynucleotide molecules for regulating the expression of the angiopoietin-like protein 3 or angiopoietin-like 3 (ANGPTL3) gene, wherein the polynucleotide molecules contain the nucleic acid sequences in Table 1, Table 2, Table 3 or Table 4.

[0008] In one aspect, this disclosure provides a polynucleotide molecule for regulating the expression of the angiopoietin-like protein 3 (ANGPTL3) gene, wherein the polynucleotide molecule comprises nucleic acid sequences from Tables 1, 2, 3, or 4. In some embodiments, the polynucleotide molecule is a single-stranded nucleic acid molecule. In some embodiments, the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, or 18 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875 and having no more than 1, 2, 3, or 4 mismatches. In some embodiments, the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875.

[0009] In some embodiments, the polynucleotide molecule is a double-stranded nucleic acid molecule comprising a guest strand and a guide strand. In some embodiments, the guest strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:401-596, 819-828, and 870-875. In some embodiments, the guide strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:1-196, 797-806, and 850-857. In some embodiments, the guest strand comprises at least 14, 15, 16, 17, 18, 19, or 20 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875 and having no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some embodiments, the guide strand comprises at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences selected from SEQ ID NO: 1-196, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some embodiments, the pass strand comprises nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and the guide strand comprises nucleic acid sequences selected from SEQ ID NO: 1-196, 797-806, and 850-857. In some implementations, the passchain comprises a nucleic acid sequence having at least 90% or at least 95% identity with a nucleic acid sequence selected from Table 3 (SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875). In some implementations, the guide strand comprises a nucleic acid sequence that has at least 90% or at least 95% identity with a nucleic acid sequence selected from Table 3 (SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806 and 850-857).In some implementations, the transit strand comprises a nucleic acid sequence selected from Table 3 (SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875) and the guide strand comprises a ...). The sequences of nucleic acid sequences of NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806 and 850-857.

[0010] In some embodiments, the polynucleotide molecule comprises (1) a 2'-fluorinated nucleotide; (2) a 2'-O-methylated nucleotide; (3) a 2'-deoxy-modified nucleotide; or (4) a modified nucleotide inter-bond. In some embodiments, the polynucleotide molecule comprises at least two consecutive modified nucleotide inter-bonds at the 5' end. In some embodiments, the three nucleotide inter-bonds at the 3' end of the guiding strand comprise at least two nucleotide inter-bonds that have been replaced by modified nucleotide inter-bonds. In some implementations, the guiding strand comprises 5'-nNfnnnNfnNfNfnnnnN fnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnnn-3', 5'-nNfn nnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnnnNfnNfnnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In some embodiments, the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nn nnnnNfnNfNfNfnnnnnnnnnn-3', or 5'-nnnnnnnnNfNfNfnnnnnnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In some embodiments, the guest chain comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3', where the guiding chain comprises 5'-nNfnNfnNfnNfnNfnnnNfnnnNfnNfnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In some embodiments, the guest chain comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the guiding chain comprises 5'-nNfnnnNfnNfNfnnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide and "n" represents a 2'-O-methyl-modified nucleotide. In some embodiments, the guest chain comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the guiding chain comprises 5'-nNfnnnn nnnnnnNfnNfnnnnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide and "n" represents a 2'-O-methyl-modified nucleotide.In some embodiments, the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the guiding chain comprises 5'-nNfnn nnnnnnnNfnNfnnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide and "n" represents a 2'-O-methyl-modified nucleotide. In some embodiments, the guest chain comprises 5'-nnnnnnNfnNfnnnnnnnnnn-3', wherein the guiding chain comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide and "n" represents a 2'-O-methyl-modified nucleotide.

[0011] In some embodiments, the modified internucleotide bonds are phosphate-thioester nucleotide bonds. In some embodiments, the modified internucleotide bonds comprise stereochemically enriched phosphate-thioester nucleotide bonds. In some cases, the guiding strand comprises a nucleotide analog selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), and 1',2'-dideoxyribose-3'-phosphate (dAB). In some cases, the nucleotide analog is located in the seed region of the guiding strand (positions 2-8) starting from the 5' end.

[0012] In some embodiments, the guest strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 601-796, 830-839, and 876-881. In some embodiments, the guide strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 201-396, 808-817, and 858-868. In some embodiments, the guest strand comprises a nucleic acid sequence selected from SEQ ID NO: 601-796, 830-839, and 876-881, and the guide strand comprises a nucleic acid sequence selected from SEQ ID NO: 201-396, 808-817, and 858-868. In some embodiments, the polynucleotide molecule is 19-25 nucleotides in length. In some embodiments, the polynucleotide molecule is 21-23 nucleotides in length.

[0013] In one aspect, this disclosure provides a polynucleotide molecule for regulating the expression of the angiopoietin-like protein 3 (ANGPTL3) gene, wherein the polynucleotide molecule comprises (a) a guide strand comprising a nucleotide sequence selected from SEQ ID NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and .... (a) A transit chain containing nucleotide sequences of SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875; (b) Containing a sequence selected from SEQ ID NO: The guide strand of nucleotide sequences NO: 205, 207, 208, 211, 218, 220, 222, 240, 243-246, 250, 252, 253, 256, 308, 309, 313, 314, 345, 346, 348, 353, 357, 358, 808-817, and 858-868 and containing sequences selected from SEQ ID (c) A transit strand containing the nucleotide sequences of 605, 607, 608, 611, 618, 620, 622, 640, 643, 644, 645, 646, 650, 652, 653, 656, 708, 709, 713, 714, 745, 746, 748, 753, 757, 758, 830-839, and 876-881; (d) A guide strand containing the nucleotide sequence usUfsaguuGfguuuCfgUfgAfuuuccscsa (SEQ ID NO: 313) and a transit strand containing the nucleotide sequence gsgsaaauCfaCfgAfaaccaacuaa (SEQ ID NO: 713); (e) A strand containing the nucleotide sequence usUfsagagUfauaaCfcUfuCfcauuususg (SEQ ID NO: 313). (e) A guide strand containing the nucleotide sequence asasauggAfaGfgUfuauacucuaa (SEQ ID NO:346) and a transit strand containing the nucleotide sequence asasauggAfaGfgUfuauacucuaa (SEQ ID NO:746);(f) A guide strand containing the nucleotide sequence usUfsaaggAfuuuaAfuAfcCfagauusasu (SEQ ID NO:358) and a pass strand containing the nucleotide sequence asasucugGfuAfuUfaaauccuuaa (SEQ ID NO:758); (g) A guide strand containing the nucleotide sequence usAfsuuagAfuugcUfuCfaCfuauggsasg (SEQ ID NO:308) and a pass strand containing the nucleotide sequence cscsauagUfgAfaGfcaaucuaaua (SEQ ID NO:708); (h) A guide strand containing the nucleotide sequence usUfsauagUfugguUfuCfgUfgauuuscsc (SEQ ID NO:314) and a pass strand containing the nucleotide sequence asasaucaCfgAfaAfccaacuauaa (SEQ ID NO:358). (i) a passer chain containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuuusgsa (SEQ ID NO: 345) and a passer chain containing the nucleotide sequence asasaaugGfaAfgGfuuauacucua (SEQ ID NO: 745); (j) a passer chain containing the nucleotide sequence usUfsaauuAfgauuGfcUfuCfacuausgsg (SEQ ID NO: 309) and a passer chain containing the nucleotide sequence asusagugAfaGfcAfaucuaauuaa (SEQ ID NO: 709); (k) a passer chain containing the nucleotide sequence usAfsauuaGfauugCfuUfcAfcuaugsgsa (SEQ ID NO: 815) and a passer chain containing the nucleotide sequence csasuaguGfaAfgCfaaucuaauua (SEQ ID NO: 714). (1) A transit chain containing the nucleotide sequence usUfsucauUfgaagUfuUfuGfugaucscsa (SEQ ID NO: 812) and a transit chain containing the nucleotide sequence gsasucacAfaAfaCfuucaaugaaa (SEQ ID NO: 834); (2) A guide chain containing the nucleotide sequence usAfsuugcUfucacUfaUfgGfaguausasu (SEQ ID NO: 813) and a transit chain containing the nucleotide sequence asusacucCfaUfaGfugaagcaaua (SEQ ID NO: 835);(n) a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuucsgsa (SEQ ID NO:865) and a guest strand containing the nucleotide sequence gsasaaugGfaAfgGfuuauacucua (SEQ ID NO:879); or (o) a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuccsgsa (SEQ ID NO:866) and a guest strand containing the nucleotide sequence gsgsaaugGfaAfgGfuuauacucua (SEQ ID NO:880), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e., “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0014] On the other hand, this disclosure provides a polynucleotide conjugate for regulating angiopoietin-like protein 3 (ANGPTL3) gene expression, wherein the polynucleotide conjugate comprises the polynucleotide molecule described herein and the desialyl glycoprotein receptor targeting moiety. In some embodiments, the polynucleotide molecule and the desialyl glycoprotein receptor targeting moiety are coupled via a linker. In some embodiments, the linker comprises the following formula (IV),

[0015] At least one of Y1 and Y2 is a nucleotide in a polynucleotide molecule. In some embodiments, Y1 is the last nucleotide at the 3' end of the transit strand of the polynucleotide molecule. In some embodiments, Y1 and Y2 are two consecutive nucleotides in the polynucleotide molecule. In some embodiments, the desialylate glycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc). In some embodiments, the linker with the last nucleotide at the 3' end of the transit strand of the polynucleotide molecule and the desialylate glycoprotein receptor targeting moiety are shown in the following formula:

[0016]

[0017]

[0018] In formula (V'), (V””), (V””’) or (V”””), Z is -H, -OH, -O-methyl, -F or -O-methoxyethyl, and R is adenine, uracil, guanine, cytosine, thymine, debasement or other in formula (V'), (V””), (V””’) or (V”””).

[0019] In one aspect, this disclosure provides a pharmaceutical composition comprising a polynucleic acid molecule, or a polynucleic acid molecule conjugate as described herein, and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. In some embodiments, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

[0020] In one aspect, this disclosure provides a method for regulating the mRNA expression of the angiopoietin-like protein 3 (ANGPTL3) gene in a subject, comprising: administering to the subject a polynucleotide molecule, a polynucleotide molecule conjugate, or a pharmaceutical composition as described herein, thereby regulating the mRNA expression of the ANGPTL3 gene in the subject.

[0021] On the other hand, this disclosure provides a method for preventing, alleviating, or treating ANGPTL3-related diseases or their symptoms in a subject in need, comprising: administering to the subject a polynucleotide molecule, a polynucleotide conjugate, or a pharmaceutical composition described herein, thereby preventing, alleviating, or treating ANGPTL3-related diseases or their symptoms in the subject. In some embodiments, ANGPTL3-related diseases or their symptoms include hyperlipidemia. In some embodiments, ANGPTL3-related diseases or their symptoms include atherosclerosis, coronary artery disease, and vascular disease. Attached Figure Description

[0022] The novel features of the invention are specifically set forth in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description and accompanying drawings, which illustrate embodiments in which the principles of the invention are utilized, in which:

[0023] Figure 1 The inhibitory efficacy of the selected ANGPTL3 siRNA used in vivo testing in mice in Example 3 is depicted. Results are shown as the mean % change in serum hANGPTL3 protein levels from baseline on day -4. These results correspond to the data in Table 8.

[0024] Figure 2 The inhibitory efficacy of the selected ANGPTL3 siRNA used in vivo in mice in Example 4 is depicted. Results are shown as the mean % change in serum hANGPTL3 protein levels from baseline on day -4. These results correspond to the data in Table 9.

[0025] Figure 3 The inhibitory efficacy of the selected ANGPTL3 siRNA used in vivo testing in mice in Example 5 is depicted. Results are shown as the mean % change in serum hANGPTL3 protein levels from baseline on day -4. These results correspond to the data in Table 10.

[0026] Figure 4 The inhibitory efficacy of the selected ANGPTL3 siRNA used in vivo testing in mice in Example 6 is depicted. Results are shown as the mean % change in serum hANGPTL3 protein levels relative to the mediator control group. These results correspond to the data in Table 11.

[0027] Figure 5 The inhibitory efficacy of the selected ANGPTL3 siRNA, used in cynomolgus monkeys in Example 7, is depicted. Results are shown as the mean % change in serum ANGPTL3 relative to day 1. These results correspond to the data in Table 12.

[0028] Figure 6 The expression levels of ANGPTL3 mRNA from cynomolgus monkey liver tissue in Example 7 were depicted. The results are shown as relative expression over -15 days.

[0029] Figure 7 The inhibitory efficacy of the selected ANGPTL3 siRNA used in vivo testing in mice in Example 8 is depicted. Results are shown as the mean % change in serum hANGPTL3 protein levels relative to the mediator control group. These results correspond to the data in Table 13. Detailed Implementation

[0030] Angiopoietin-like protein 3 (ANGPTL3) is a member of the angiopoietin-like protein family, sharing structural similarities with the angiopoietin family. ANGPTL3 is a secreted protein primarily produced by hepatocytes and significantly expressed in renal podocytes. ANGPTL3 regulates all three major lipids: LDL-cholesterol, HDL-cholesterol, and triglycerides. ANGPTL3 inhibits lipoprotein lipase (LPL) and endothelial lipase to regulate triglyceride and cholesterol metabolism.

[0031] The ANGPTL3 gene is located on the short arm of chromosome 1 (1p31.3). The ANGPTL3 (NM_014495.4) mRNA contains 2926 bp and is divided into 7 exons. ANGPTL3 is a 460-amino acid polypeptide containing a unique signal peptide sequence, an N-terminal coiled-coil domain, and a C-terminal globular fibrinogen-like domain. The N-terminal coiled-coil region (17-207 amino acids), particularly at amino acid positions 61-66, affects plasma triglyceride levels by inhibiting the catalytic activity of lipoprotein lipase (LPL). The C-terminal fibrinogen-like domain (207-460 amino acids) can bind to the integrin αvβ3 receptor, which influences angiogenesis. ANGPTL3 also contains a short-connector region: Arg 221 -Ala222 -Pro 223 -Arg 224 It is located between the N-terminal and C-terminal domains. This linker region acts as a junction between the amino acid residues Arg. 221 -Ala 222 and Arg 224 -Thr 225 The furin cleavage site is located between the two ends. Similar to other members of the angiopoietin-like protein family, ANGPTL3 undergoes cleavage to produce separate fragments containing an N-terminal coiled-coil domain and a C-terminal fibrinogen-like domain, which appear to have different functions. Both full-length and truncated forms of ANGPTL3 have been found in plasma (see Tikka, A. et al., Endocrine. 2016:187-193; Wang, X. et al., JACC: Basic to Translational Science. 2019:755-762; Ono, M. et al., The Journal of Biological Chemistry. 2003:41804-41809; and NCBI reference accession number: NM_014495.4).

[0032] Loss of function of the ANGPTL3 gene has been shown to be associated with low levels of plasma LDL-cholesterol, HDL-cholesterol, and triglycerides. Therefore, targeting ANGPTL3 could provide a lipid-lowering therapy without causing serious side effects and could further offer a way to reduce the risk of atherosclerosis, coronary heart disease, and other vascular diseases.

[0033] This document describes polynucleotide molecules for regulating ANGPTL3 gene expression. In some respects, the polynucleotide molecule is a single-stranded nucleic acid molecule. In some respects, the polynucleotide molecule is a double-stranded nucleic acid molecule containing a sense strand (passenger strand) and an antisense strand (guide strand). In some respects, the polynucleotide molecule contains nucleic acid sequences from Tables 1, 2, 3, or 4. Therefore, this document provides various target regions of human ANGPTL3 mRNA with which the polynucleotide molecules described herein hybridize. In some embodiments, the sequence of the polynucleotide molecule described herein is provided. In some embodiments, conjugates of the polynucleotide molecules described herein are provided. In some respects, modifications of the polynucleotide molecules described herein are provided.

[0034] This article also describes methods for regulating ANGPTL3 mRNA or protein expression in subjects. Furthermore, this article describes methods for preventing, alleviating, or treating ANGPTL3-associated diseases or their symptoms in subjects in need.

[0035] definition

[0036] Unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” include plural references. For example, the term “cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A,” “B,” “A or B,” and “A and B.”

[0037] When a range of values ​​is provided, it should be understood that every intermediate value between the upper and lower limits of the range and any other stated or intermediate value within the stated range (unless otherwise expressly specified by the context, one-tenth of a unit down to the lower limit) is included within this disclosure. The upper and lower limits of these smaller ranges may be independently included within that smaller range and are also included within this disclosure, but are affected by any limits specifically excluded from the stated range. When a stated range includes one or both limits, the range excluding any one or both of the included limits is also included in this disclosure.

[0038] Certain ranges are presented herein with numerical values ​​preceded by the term "about". The term "about" is used herein to provide literal support for the precise figures that follow, as well as figures that are close to or approximate to the figures that follow the term. In determining whether a figure is close to or approximates a specifically recorded figure, a close to or approximate unrecorded figure may be a figure that provides a substantially equal value to the specifically recorded figure in the context in which it is presented.

[0039] The “percentage of sequence identity (%)” or “percentage of identity (%)” for the nucleic acid sequences identified in this paper is defined as the percentage of nucleic acids that are identical to the compared nucleic acid sequence among the candidate sequences after sequence alignment in which any conserved substitutions are considered part of sequence identity.

[0040] All scopes disclosed herein also encompass any and all possible subscopes and combinations thereof. Any enumerated scope may be considered sufficient to describe and implement the same scope being divided into at least two, three, four, five, ten, etc., parts. As a non-limiting example, each scope discussed herein can be readily divided into a lower third, a middle third, and an upper third, etc. Those skilled in the art will also understand that all terms such as “up to,” “at least,” “greater than,” “less than,” etc., include the stated numbers and refer to a scope that can subsequently be divided into subscopes as discussed above. Finally, those skilled in the art will understand that a scope includes each individual member. Thus, for example, a group having 1-3 items means a group having 1, 2, or 3 items. Similarly, a group having 1-5 items means a group having 1, 2, 3, 4, or 5 items, and so on.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which polynucleotide molecules, polynucleotide conjugates, pharmaceutical compositions, methods and other aspects pertain.

[0042] As used in this article, the term “complementary” indicates a sufficient degree of complementarity between two nucleic acid molecules that bind stably and specifically to avoid nonspecific binding.

[0043] As used herein, the terms “polynucleotide” and “polynucleotide” are used interchangeably to refer to nucleotide chains. The term “nucleotide” includes the sequences “G,” “C,” “A,” “T,” and “U,” each typically representing a nucleotide containing guanine, cytosine, adenine, thymidine, and uracil as a base. In some cases, “nucleotide” can refer to a modified nucleotide (e.g., having a modified sugar moiety, a modified base, a modified internucleotide bond, or a combination thereof, including but not limited to 2'-modified nucleotides, LNA, ENA, BNA, UNA, GNA, etc.). In some cases, “nucleotide” can refer to a modified nucleotide having a non-canonical base (e.g., including but not limited to 2-thiouridine, 2-thiothymidine, inosine, 2-aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).

[0044] As used in this article, “object” can be any mammal, including humans and non-human primates.

[0045] As used in this article, the term "condition" includes disease, symptom, and susceptibility. In some cases, a condition is an AGT-related symptom or its symptoms.

[0046] As used herein, the term "treatment" for any disease or condition refers in one context to improving the disease or condition (i.e., slowing or halting or reducing the development of the disease or at least one of its clinical symptoms). In another context, "treatment" refers to reducing or improving at least one bodily parameter, including those that the patient may not be aware of. In yet another context, "treatment" refers to regulating the disease or condition physically (e.g., stabilizing perceptible symptoms), physiologically (e.g., stabilizing bodily parameters), or both.

[0047] As used herein, the term "prevention" refers to reducing the occurrence of pathological changes in an object that does not have a disease or condition but is at risk of developing one or is susceptible to it. Prevention can be complete, for example, the complete absence of pathological changes in the object. Prevention can also be partial, such that the occurrence of pathological changes in the object is less than the pathological changes that would occur without this disclosure.

[0048] As used herein, the term "administration" and its grammatical equivalents can refer to the administration of the pharmaceutical composition described herein to a subject or patient. The composition may be administered to a subject using conventional methods known to those skilled in the art of medicine, depending on the type or site of the disease to be treated. For example, the composition may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implantable reservoir, or via infusion. One or more of these routes may be used.

[0049] As used herein, the term "pharmaceutical composition" and its grammatical equivalents may refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient and one or more pharmaceutically acceptable excipients, carriers, and / or therapeutic agents to be administered to a subject of need (e.g., a human).

[0050] As used herein, the term "pharmaceutically acceptable" and its grammatical equivalents can refer to the properties of materials that are generally safe and non-toxic, neither biologically nor otherwise adverse, and acceptable for veterinary and human pharmaceutical use. "Pharmaceutically acceptable" can refer to materials such as carriers or diluents that do not eliminate the biological activity or properties of the compound and are relatively non-toxic, meaning that the material can be administered to a patient without causing adverse biological effects or interacting harmfully with any component of a pharmaceutical composition containing the material.

[0051] "Pharmaceutical acceptable excipients" are excipients that can be administered to a subject together with an agent without destroying the agent's pharmacological activity and are non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the agent.

[0052] The term "therapeutic agent" can refer to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or preventative effect, and / or induces the desired biological and / or pharmacological effect. Therapeutic agents may also be referred to as "active substances" or "active agents." Such agents include, but are not limited to, cytotoxic agents, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0053] As used herein, the term "sense strand" is used interchangeably with the term "passenger strand," and the term "antisense strand" is used interchangeably with the term "guide strand." In some cases, the nucleic acid sequences described herein for sense strands and passenger strands are used interchangeably. Furthermore, in some cases, the nucleic acid sequences described herein for antisense strands and guide strands are used interchangeably.

[0054] As used herein, the term "continuous sequence" refers to a sequence containing multiple consecutive nucleotides derived from a reference sequence. For example, if the reference sequence is N1N2N3N4N5N6N7, the continuous sequence can be N1N2N3N4 or N3N4N5N6, but the sequence N1N3N4N5 or N3N4N7 cannot be a continuous sequence.

[0055] As used in this article, the term "negative control" refers to a subject or cell that did not receive treatment or a placebo.

[0056] It should be understood that certain features of polynucleotide molecules and / or polynucleotide conjugates, pharmaceutical compositions comprising polynucleotide molecules or polynucleotide conjugates, methods, and other aspects described for clarity in the context of individual embodiments may also be provided in combination in a single embodiment. Conversely, various features of polynucleotide molecules and / or polynucleotide conjugates, pharmaceutical compositions comprising polynucleotide molecules or polynucleotide conjugates, methods, and other aspects described for brevity in the context of a single embodiment may also be provided individually or in any suitable sub-combination. All combinations of embodiments are specifically included in this disclosure and are disclosed herein as if each combination were disclosed individually and explicitly, to the extent that such combinations encompass operable processes and / or compositions. Furthermore, all sub-combinations listed in embodiments describing such variables are also specifically included in this disclosure of polynucleotide molecules and / or polynucleotide conjugates, pharmaceutical compositions comprising polynucleotide molecules or polynucleotide conjugates, methods, and other aspects, and are disclosed herein as if each such sub-combination were disclosed herein as if each such sub-combination were disclosed herein individually and explicitly.

[0057] Polynucleic acid molecules

[0058] Target regions of multiple nucleic acid molecules

[0059] This article describes polynucleotide molecules used to regulate ANGPTL3 gene expression. In some cases, polynucleotide molecules consist of single-stranded nucleic acid molecules that hybridize to a specific region of the mRNA. In other cases, polynucleotide molecules are double-stranded nucleic acid molecules. This article also describes polynucleotide molecules used to regulate ANGPTL3 gene expression, wherein the polynucleotide molecule is a double-stranded nucleic acid molecule containing a guest strand (sense strand) and a guide strand (antisense strand), and the guide strand hybridizes to a specific region of the ANGPTL3 mRNA.

[0060] In some respects, the polynucleotide molecules described herein hybridize with specific regions of human ANGPTL3 mRNA. In some cases, human ANGPTL3 mRNA is referred to as NM_014495.4. In some respects, the polynucleotide molecules described herein hybridize with specific regions of non-human ANGPTL3 mRNA.

[0061] In some respects, the polynucleotide molecules described herein hybridize with the 5'UTR region of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with the coding region of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 1 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 2 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 3 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 4 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 5 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 6 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with a portion of exon 7 of human ANGPTL3 mRNA. In some respects, the polynucleotide molecules described herein hybridize with the 3'UTR region of human ANGPTL3 mRNA.

[0062] In some respects, the target regions for hybridization with the polynucleotide molecules described in this paper are determined by the effectiveness of ANGPTL3 silencing and possible off-target effects. In some cases, the initiation of the target region falls between positions 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, or 91-100 on NM_014495.4. In other cases, the initiation of the target region falls between positions 101-110, 111-120, 121-130, 131-140, 141-150, 151-160, 161-170, 171-180, 181-190, or 191-200 on NM_014495.4. In some cases, the target region begins at position 201-210, 211-220, 221-230, 231-240, 241-250, 251-260, 261-270, 271-280, 281-290, or 291-300 of NM_014495.4. In other cases, the target region begins at position 301-310, 311-320, 321-330, 331-340, 341-350, 351-360, 361-370, 371-380, 381-390, or 391-400 of NM_014495.4. In some cases, the target area begins at position 401-410, 411-420, 421-430, 431-440, 441-450, 451-460, 461-470, 471-480, 481-490, or 491-500 of NM_014495.4. In other cases, the target area begins at position 501-510, 511-520, 521-530, 531-540, 541-550, 551-560, 561-570, 571-580, 581-590, or 591-600 of NM_014495.4. In some cases, the target region begins at positions 601-610, 611-620, 621-630, 631-640, 641-650, 651-660, 661-670, 671-680, 681-690, or 691-700 of NM_014495.4. In other cases, the target region begins at positions 701-710, 711-720, 721-730, 731-740, 741-750, 751-760, 761-770, 771-780, 781-790, or 791-800 of NM_014495.4.In some cases, the target region begins at position 801-810, 811-820, 821-830, 831-840, 841-850, 851-860, 861-870, 871-880, 881-890, or 891-900 of NM_014495.4. In other cases, the target region begins at position 901-910, 911-920, 921-930, 931-940, 941-950, 951-960, 961-970, 971-980, 981-990, or 991-1000 of NM_014495.4. In some cases, the target region begins at position 1001-1010, 1011-1020, 1021-1030, 1031-1040, 1041-1050, 1051-1060, 1061-1070, 1071-1080, 1081-1090, or 1091-1100 of NM_014495.4. In other cases, the target region begins at position 1101-1110, 1111-1120, 1121-1130, 1131-1140, 1141-1150, 1151-1160, 1161-1170, 1171-1180, 1181-1190, or 1191-1200 of NM_014495.4. In some cases, the target region begins at position 1201-1210, 1211-1220, 1221-1230, 1231-1240, 1241-1250, 1251-1260, 1261-1270, 1271-1280, 1281-1290, or 1291-1300 of NM_014495.4. In other cases, the target region begins at position 1301-1310, 1311-1320, 1321-1330, 1331-1340, 1341-1350, 1351-1360, 1361-1370, 1371-1380, 1381-1390, or 1391-1400 of NM_014495.4. In some cases, the starting point of the target region falls between positions 1401-1410, 1411-1420, 1421-1430, 1431-1440, 1441-1450, 1451-1460, 1461-1470, 1471-1480, 1481-1490, or 1491-1500 of NM_014495.4.In some cases, the target region begins at position 1501-1510, 1511-1520, 1521-1530, 1531-1540, 1541-1550, 1551-1560, 1561-1570, 1571-1580, 1581-1590, or 1591-1600 of NM_014495.4. In other cases, the target region begins at position 1601-1610, 1611-1620, 1621-1630, 1631-1640, 1641-1650, 1651-1660, 1661-1670, 1671-1680, 1681-1690, or 1691-1700 of NM_014495.4. In some cases, the target area begins at position 1701-1710, 1711-1720, 1721-1730, 1731-1740, 1741-1750, 1751-1760, 1761-1770, 1771-1780, 1781-1790, or 1791-1800 of NM_014495.4. In other cases, the target area begins at position 1801-1810, 1811-1820, 1821-1830, 1831-1840, 1841-1850, 1851-1860, 1861-1870, 1871-1880, 1881-1890, or 1891-1900 of NM_014495.4. In some cases, the target region begins at position NM_014495.4 between 1901-1910, 1911-1920, 1921-1930, 1931-1940, 1941-1950, 1951-1960, 1961-1970, 1971-1980, 1981-1990, or 1991-2000. In other cases, the target region begins at position NM_014495.4 between 2001-2010, 2011-2020, 2021-2030, 2031-2040, 2041-2050, 2051-2060, 2061-2070, 2071-2080, 2081-2090, or 2091-2100. In some cases, the starting point of the target region falls between positions 2101-2110, 2111-2120, 2121-2130, 2131-2140, 2141-2150, 2151-2160, 2161-2170, 2171-2180, 2181-2190, or 2191-2200 of NM_014495.4.In some cases, the target region begins at positions 2201-2210, 2211-2220, 2221-2230, 2231-2240, 2241-2250, 2251-2260, 2261-2270, 2271-2280, 2281-2290, or 2291-2300 of NM_014495.4. In other cases, the target region begins at positions 2301-2310, 2311-2320, 2321-2330, 2331-2340, 2341-2350, 2351-2360, 2361-2370, 2371-2380, 2381-2390, or 2391-2400 of NM_014495.4. In some cases, the target region begins at position 2401-2410, 2411-2420, 2421-2430, 2431-2440, 2441-2450, 2451-2460, 2461-2470, 2471-2480, 2481-2490, or 2491-2500 of NM_014495.4. In other cases, the target region begins at position 2501-2510, 2511-2520, 2521-2530, 2531-2540, 2541-2550, 2551-2560, 2561-2570, 2571-2580, 2581-2590, or 2591-2600 of NM_014495.4. In some cases, the target region begins at positions 2601-2610, 2611-2620, 2621-2630, 2631-2640, 2641-2650, 2651-2660, 2661-2670, 2671-2680, 2681-2690, or 2691-2700 of NM_014495.4. In other cases, the target region begins at positions 2701-2710, 2711-2720, 2721-2730, 2731-2740, 2741-2750, 2751-2760, 2761-2770, 2771-2780, 2781-2790, or 2791-2800 of NM_014495.4. In some cases, the target region begins at positions 2801-2810, 2811-2820, 2821-2830, 2831-2840, 2841-2850, 2851-2860, 2861-2870, 2871-2880, 2881-2890, or 2891-2900 of NM_014495.4. In other cases, the target region begins at positions 2901-2910, 2911-2920, or 2921-2926 of NM_014495.4.

[0063] Structure of polynucleic acid molecules

[0064] Single-stranded nucleic acid molecules

[0065] This article describes a polynucleotide molecule for regulating the expression of the ANGPTL3 gene, wherein the polynucleotide molecule comprises a single-stranded nucleic acid molecule that is reverse complementary to the target region of the ANGPTL3 mRNA as described herein.

[0066] In some respects, the polynucleotide molecules described herein are not 100% complementary to the target region of ANGPTL3 mRNA. Therefore, in some cases, the polynucleotide molecules described herein are approximately 95% complementary to the target region of ANGPTL3 mRNA. In some cases, the polynucleotide molecules described herein are approximately 90% complementary to the target region of ANGPTL3 mRNA. In some cases, the polynucleotide molecules described herein are approximately 85% complementary to the target region of ANGPTL3 mRNA. In some cases, the polynucleotide molecules described herein are approximately 80% complementary to the target region of ANGPTL3 mRNA. In some cases, the polynucleotide molecules described herein are approximately 75% complementary to the target region of ANGPTL3 mRNA. In some cases, the polynucleotide molecules described herein are approximately 70% complementary to the target region of ANGPTL3 mRNA.

[0067] In some respects, the polynucleotide molecules described herein comprise nucleic acid sequences from Tables 1, 2, 3, or 4. In some cases, the polynucleotide molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences from Tables 1, 2, 3, or 4. In some cases, the polynucleotide molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875. In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875. In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are complementary to at least 80%, at least 85%, at least 90%, or at least 95% of the nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875. In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are complementary to at least 80%, at least 85%, at least 90%, or at least 95% of the nucleic acid sequences selected from SEQ ID NO:513, 546, 553, 558, 508, 514, and 545.

[0068] In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, excluding overhangs. In some cases, the polynucleotide molecules described herein contain a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, excluding overhangs. In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, excluding overhangs. In some cases, the polynucleotide molecules described herein contain nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to nucleic acid sequences selected from SEQ ID NO:513, 546, 553, 558, 508, 514, and 545, excluding overhangs.

[0069] In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 14 consecutive nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 14 consecutive (adjacent) nucleotides complementary to the nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 15 consecutive nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 15 consecutive (adjacent) nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, having no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 16 consecutive nucleotides complementary to nucleic acid sequences in Tables 1, 2, 3, or 4, having no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 16 consecutive (adjacent) nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, having no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 17 consecutive nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 17 consecutive (adjacent) nucleotides complementary to the nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 18 consecutive nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 18 consecutive (adjacent) nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, having no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 19 consecutive (adjacent) nucleotides complementary to nucleic acid sequences in Tables 1, 2, 3, or 4, having no more than 1, 2, 3, or 4 mismatches.In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 19 consecutive (adjacent) nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, having no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 20 consecutive (adjacent) nucleotides complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, having no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 21 consecutive (adjacent) nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 21 consecutive (adjacent) nucleotides complementary to the nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatches. In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 22 consecutive (adjacent) nucleotides complementary to the nucleic acid sequences in Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 22 consecutive (adjacent) nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875 and have no more than 1, 2, 3 or 4 mismatches.

[0070] In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 14 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 15 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 16 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches.In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 17 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 18 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 19 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches.In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 20 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 21 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 22 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches.

[0071] In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 14 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 15 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 16 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 17 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 18 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches.In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 19 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 20 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 21 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence of 22 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatches.

[0072] In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 15 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 16 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 17 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 18 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 19 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 20 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 21 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 22 consecutive nucleotides complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, having no more than 1, 2, 3, or 4 mismatches.

[0073] In other respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides, which are complementary to the nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and do not have more than 1, 2, 3, or 4 mismatched protrusions. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides, which are complementary to the nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and do not have more than 1, 2, 3, or 4 mismatched protrusions. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides, which are complementary to the nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and do not have more than 1, 2, 3, or 4 mismatched protrusions. The nucleic acid sequences of NOs 402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875 are complementary and do not have more than 1, 2, 3, or 4 mismatched protrusions. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides, which are complementary to nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and do not have no more than 1, 2, 3, or 4 mismatched overhangs. In some respects, the polynucleotide molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545 and do not have more than 1, 2, 3, or 4 mismatched overhangs.

[0074] In some respects, the polynucleotide molecules described herein comprise chains of about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some respects, the polynucleotide molecules described herein comprise chains of about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some respects, the polynucleotide molecules described herein comprise chains of about 21, 22, 23, 24, or 25 nucleotides in length. In some respects, the polynucleotide molecules described herein comprise chains of about 26, 27, 28, 29, or 30 nucleotides in length.

[0075] Double-stranded nucleic acid molecules

[0076] This article further describes a polynucleotide molecule for regulating the expression of the ANGPTL3 gene, wherein the polynucleotide molecule is a double-stranded molecule containing a guest strand (sense strand) and a guide strand (antisense strand), and the guide strand is reverse complementary to the target region of the ANGPTL3 mRNA as described above.

[0077] In some respects, the guide chain described herein is 100% complementary to the target region of ANGPTL3 mRNA. In other respects, the guide chain described herein is not 100% complementary to the target region of ANGPTL3 mRNA. Therefore, in some cases, the guide chain described herein is approximately 95% complementary to the target region of ANGPTL3 mRNA. In some respects, the guide chain described herein is approximately 90% complementary to the target region of ANGPTL3 mRNA. In some respects, the guide chain described herein is approximately 85% complementary to the target region of ANGPTL3 mRNA. In some respects, the guide chain described herein is approximately 80% complementary to the target region of ANGPTL3 mRNA. In some respects, the guide chain described herein is approximately 75% complementary to the target region of ANGPTL3 mRNA. In some respects, the guide chain described herein is approximately 70% complementary to the target region of ANGPTL3 mRNA.

[0078] In some respects, the polynucleotide molecules described herein comprise nucleic acid sequences from Tables 1, 2, 3, or 4. In other respects, the polynucleotide molecules described herein comprise nucleic acid sequences having at least 80%, at least 85%, at least 90%, or at least 95% identity with the sequences from Tables 1, 2, 3, or 4. In some cases, the passer strand described herein comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:401-596, 819-828, and 870-875. In some cases, the guide strand described herein comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:1-196, 797-806, and 850-857. In some cases, the passchain described herein contains nucleic acid sequences that have at least 80%, at least 85%, at least 90%, or at least 95% identity with nucleic acid sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875. In some cases, the guiding strand described herein contains a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857. In some cases, the passchain described herein contains nucleic acid sequences that have at least 80%, at least 85%, at least 90%, or at least 95% identity with nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875.In some cases, the guiding strand described herein comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857. In some cases, the guest strand described herein comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545. In some cases, the guide strand described herein contains a nucleic acid sequence that has at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145.

[0079] In other respects, the polynucleotide molecules described herein comprise 14 consecutive sequences from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit strand described herein comprises 14 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guide strand described herein comprises 14 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other respects, the polynucleotide molecules described herein comprise 15 consecutive sequences from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit strand described herein comprises 15 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guide strand described herein comprises 15 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In still other aspects, the polynucleotide molecule described herein comprises 16 consecutive sequences selected from Tables 1, 2, 3, or 4, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit strand described herein comprises 16 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 16 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other aspects, the polynucleotide molecule described herein comprises 17 consecutive sequences selected from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guest strand described herein comprises 17 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 17 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other respects, the polynucleotide molecules described herein contain 18 consecutive sequences from Tables 1, 2, 3 or 4 and have no more than 1, 2, 3 or 4 mismatched nucleic acid sequences.In some aspects, the transit chain described herein comprises 18 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guide chain described herein comprises 18 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other aspects, the polynucleotide molecule described herein comprises 19 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit chain described herein comprises 19 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 19 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other aspects, the polynucleotide molecules described herein comprise 20 consecutive sequences selected from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guest strand described herein comprises 20 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 20 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other respects, the polynucleotide molecules described herein comprise 21 consecutive sequences from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit strands described herein comprise 21 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guide strands described herein comprise 21 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In other respects, the polynucleotide molecules described herein comprise 22 consecutive sequences from Tables 1, 2, 3, or 4, with no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some aspects, the transient chain described herein comprises 22 consecutive sequences selected from SEQ ID NO:401-596, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding chain described herein comprises 22 consecutive sequences selected from SEQ ID NO:1-196, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.

[0080] In some respects, the passchain described herein comprises 15 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 15 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chain described herein comprises 16 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 16 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some respects, the transit chain described herein comprises 17 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 17 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the passchain described herein comprises 18 consecutive sequences selected from SEQ ID NO: 402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 18 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some respects, the transient chains described herein comprise 19 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 19 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chain described herein comprises 20 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 20 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some respects, the transient chain described herein comprises 21 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 21 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chain described herein comprises 22 consecutive sequences selected from SEQ ID NO:402-403, 405, 407-408, 410-411, 414-415, 418, 420-422, 432, 434, 442-446, 450-456, 460, 476-477, 496, 498, 507-509, 511, 513-514, 535, 545-546, 548-549, 553, 557-558, 560-561, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 22 consecutive sequences selected from SEQ ID NO:2-3, 5, 7-8, 10-11, 14-15, 18, 20-22, 32, 34, 42-46, 50-56, 60, 76-77, 96, 98, 107-109, 111, 113-114, 135, 145-146, 148-149, 153, 157-158, 160-161, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.

[0081] In some respects, the transit chain described herein comprises 15 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 15 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the passchain described herein comprises 16 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 16 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chain described herein comprises 17 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 17 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some respects, the transient chains described herein comprise 18 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 18 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chain described herein comprises 19 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 19 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transient chains described herein comprise 20 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 20 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some respects, the transit chain described herein comprises 21 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 21 consecutive sequences selected from SEQ ID NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the transit chains described herein comprise 22 consecutive sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and have no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some respects, the guiding strand described herein comprises 22 consecutive sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.

[0082] In some aspects, the transit chain described herein comprises 15 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guide chain described herein comprises 15 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit chain described herein comprises 16 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 16 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guest strand described herein comprises 17 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 17 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit chain described herein comprises 18 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guide chain described herein comprises 18 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transit chain described herein comprises 19 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 19 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guest strand described herein comprises 20 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.In some aspects, the guiding strand described herein comprises 20 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guest strand described herein comprises 21 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding strand described herein comprises 21 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the transient chain described herein comprises 22 consecutive sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences. In some aspects, the guiding chain described herein comprises 22 consecutive sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, and has no more than 1, 2, 3, or 4 mismatched nucleic acid sequences.

[0083] In some aspects, the polynucleotide molecules described herein comprise a transit chain and a guide chain of about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleotide molecules described herein comprise a transit chain and a guide chain of about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some aspects, the polynucleotide molecules described herein comprise a transit chain and a guide chain of about 21, 22, 23, 24, or 25 nucleotides in length. In some aspects, the polynucleotide molecules described herein comprise a transit chain and a guide chain of about 26, 27, 28, 29, or 30 nucleotides in length. In some aspects, the polynucleotide molecules described herein comprise a transit chain of 19 nucleotides in length and a guide chain of about 21 nucleotides in length. In some respects, the polynucleotide molecules described herein comprise a 21-nucleotide transit strand and a 23-nucleotide guide strand.

[0084] In some aspects, the transit chain and the guiding chain described herein are anti-complementary to each other, forming a double chain with a 3' protrusion on the guiding chain. In some aspects, the transit chain and the guiding chain described herein are anti-complementary to each other, forming a double chain with a 5' protrusion on the guiding chain. In some aspects, the transit chain and the guiding chain described herein are anti-complementary to each other, forming a double chain with a 3' protrusion on the transit chain. In some aspects, the transit chain and the guiding chain described herein are anti-complementary to each other, forming a double chain with a 5' protrusion on the transit chain.

[0085] Modification of multiple nucleic acid molecules

[0086] In some respects, this document describes a polynucleotide molecule with modifications as described herein. In some respects, the modifications described herein occur on one or more different structures of the polynucleotide molecule described herein (e.g., modifications to the sugar ring, backbone, or bases). In some respects, the modifications described herein include substitutions of one or more nucleotides in the polynucleotide molecule described herein. In some respects, different percentages of the polynucleotide molecules described herein contain the modifications described herein. In some respects, different positions of the polynucleotide molecules described herein contain the modifications described herein. In some respects, the modifications described herein contain modification patterns disclosed in WO / 2018 / 035380, which is incorporated herein by reference in its entirety.

[0087] Modified type

[0088] In some respects, the polynucleotide molecules described herein contain one or more sugar-modified nucleotides. In some respects, the sugar-modified nucleotides are 2'-fluoromodified nucleotides. In some cases, the 2'-fluoromodified nucleotides include nucleotides containing a thiomodified base, such as 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the sugar-modified nucleotides include modification at the 2' hydroxyl group of the ribose moiety. In some cases, the sugar-modified nucleotides include modifications with H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some respects, the sugar-modified nucleotides are 2'-O-methylmodified nucleotides or 2'-alkoxymodified nucleotides (e.g., 2'-methoxymodified nucleotides). In some cases, 2'-hydroxyl modification includes 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA). In some cases, the alkyl moiety contains heterosubstitution. In some cases, the carbon atom of the heterocyclic group is substituted with nitrogen, oxygen, or sulfur. In some aspects, the sugar-modified nucleotide is a 2'-amino-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-azido-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-deoxy-modified nucleotide. In some aspects, the sugar-modified nucleotide is 2'-O-methoxyethyl (2'-MOE). In some aspects, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some respects, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some respects, the sugar-modified nucleotide is (S)-constrained ethyl (cEt). In some respects, the sugar-modified nucleotide is tricyclic DNA (tcDNA). In some respects, the sugar-modified nucleotide is a 2'-NH2 nucleic acid. In some respects, the polynucleotide molecules described herein contain a 5'-vinylphosphonate-modified nucleotide. In some cases, the 5'-vinylphosphonate-modified nucleotide is located on the guide strand of a double-stranded polynucleotide molecule (e.g., siRNA). In some cases, the 5'-vinylphosphonate-modified nucleotide is located at the 5' end of the guide strand. In some cases, the 5'-vinylphosphonate-modified nucleotide is located at position 1 starting from the 5' end of the guide strand.

[0089] In some respects, the polynucleotide molecules described herein comprise one or more nucleotides modified with sugar phosphates. In some respects, the modified sugar phosphate is phosphorodiamidate morpholino (PMO). In some respects, the modified sugar phosphate is an aminophosphate. In some cases, heterocyclic substitutions include imidazole and pyrrolidine. In some respects, the modified sugar phosphate is a thioaminophosphate. In some respects, the modified sugar phosphate is a peptide nucleic acid (PNA).

[0090] In some respects, the polynucleotide molecules described herein contain one or more backbone-modified nucleotides. In some respects, the modified backbone is a methylphosphonate. In some respects, the modified backbone is a thiophosphate. In some respects, the modified backbone is a guanidinopropylaminophosphate. In some respects, the modified backbone is a methanesulfonyl-aminophosphate (MsPA) bond. In some cases, the modified backbone contains one or more of the following: dithiophosphate, methylphosphonate, 5'-alkylphosphonate, 5'-methylphosphonate, 3'-alkylphosphonate, trifluoroborate, borane phosphate with a 3'-5' or 2'-5' bond, selenophosphate, phosphate triester, thiocarbonyl alkyl phosphate triester, phosphonate hydrogen bond, alkylphosphonate, alkylthiophosphonate, arylthiophosphonate, selenophosphate, and aminophosphate.

[0091] In some respects, the modified nucleotides include modified guanine (e.g., inosine) or one or more of any type of non-natural nucleic acid.

[0092] In some aspects, the modified backbone contains internucleotide bonds of thiophosphate, and the thiophosphate is stereochemically enriched. In some aspects, the chain contains at least one stereochemically enriched thiophosphate. In some aspects, the chain contains at least 1, 2, or 3 stereochemically enriched thiophosphates. In some aspects, the chain contains only 1, 2, 3, or 4 stereochemically enriched thiophosphates. In a further aspect, at least one (e.g., one or two) stereochemically enriched thiophosphates are located between two consecutive nucleotides that are two of the six 5'-terminal nucleotides of the chain. In an even further aspect, at least one (e.g., one or two) stereochemically enriched thiophosphates are located between two consecutive nucleotides that are two of the six 3'-terminal nucleotides of the chain. In still a further aspect, one stereochemically enriched thiophosphate is covalently bonded to a first and a second nucleotide from the 5' end of the chain. In some aspects, a stereochemically enriched thiophosphate is covalently bonded to the 21st and 22nd nucleotides starting from the 5' end of the chain. In other aspects, a stereochemically enriched thiophosphate is covalently bonded to the 22nd and 23rd nucleotides starting from the 5' end of the chain. In specific aspects, the stereochemically enriched thiophosphate has R... PStereochemical identity. In some respects, stereochemically enriched thiophosphates possess S... P Stereochemical identity.

[0093] In some respects, the polynucleotide molecules described herein comprise one or more (e.g., 1 to 20, 1 to 10, or 1 to 5) stereochemically enriched (e.g., inter-nucleoside) dithiophosphates (e.g., diastereomeric excess of at least 10%, 50%, 60%, 70%, 80%, or 90%, e.g., up to about 99%) at the P-stereoisomer center. The polynucleotide molecules described herein comprise one or more (e.g., 1 to 20, 1 to 10, or 1 to 5; e.g., inter-nucleoside) dithiophosphates. The dithiophosphates in the polynucleotide molecules described herein may be non-P-stereoisomers. Thiophosphates and dithiophosphates can enhance the stability of the polynucleotide molecules described herein to serum exonuclease activity. Non-P-stereoisomer dithiophosphates can simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible diastereoisomeric sources. Typically, thiophosphates or dithiophosphates can link two adjacent nucleotides within the six 3'-terminal and six 5'-terminal nucleotides of the polynucleotide molecules described herein. In some respects, stereochemically enriched thiophosphates (e.g., R...) P -Enriched thiophosphates can be covalently bonded to a first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) starting from the 5' end of the guiding chain. Alternatively or stereochemically enriched thiophosphates (e.g., S... P -Enriched thiophosphates can be covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) starting from the 5' end of the guiding chain. Further, additionally or optionally, stereochemically enriched thiophosphates (e.g., S... P - Enriched thiophosphates or R P - Enriched thiophosphates can be covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) starting from the 5' end of the guiding chain.

[0094] 5'R in the guidance chain P - Enriched thiophosphates (e.g., R-terminated phosphates covalently bonded to a first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) starting from the 5' end). P - Enriched thiophosphates) and 3'S P- Enriched thiophosphates (e.g., S-phosphates covalently bonded to the 21st nucleotide (e.g., the 3'-carbon atom of the 21st nucleotide) and the 22nd nucleotide (e.g., the 5'-carbon atom of the 22nd nucleotide) starting from the 5' end). P Combinations of enriched thiophosphates can produce better efficacy and / or duration of action, for example, as by means of 5'R deficiency. P - Enriched thiophosphates and 3'S P - A reference guide chain for enriched thiophosphates or combinations of 5'Rp-enriched thiophosphates and 3'Sp and Rp-enriched thiophosphates, measured by a decrease in activity against the target. In some embodiments, stereochemically enriched thiophosphates may contain R p R p S p S p (R p R p Located at positions 1 and 2 of the guide chain, and S p S p Located at positions 21 and 22 of the guide chain) or R p R p S p R p (R p R p Located at positions 1 and 2 of the guide chain, and S p R pLocated at positions 21 and 22 of the guiding chain). In some respects, the polynucleotide molecules described herein comprise four stereochemically enriched thiophosphates: (1) Rp-enriched thiophosphates covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) from the 5' end of the guiding chain; (2) covalently bonded to the second nucleoside (e.g., the 3'-carbon atom of the second nucleoside) and the third nucleoside (e.g., the 5'-carbon atom of the third nucleoside) from the 5' end of the guiding chain. (3) Rp-enriched thiophosphates; and (4) Sp-enriched thiophosphates covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) starting from the 5' end of the guiding chain. In some respects, the polynucleotide molecules described herein comprise four stereochemically enriched thiophosphates: (1) Rp-enriched thiophosphates covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) starting from the 5' end of the guiding chain; and (2) covalently bonded to the second nucleoside (e.g., the 3'-carbon atom of the second nucleoside) and the third nucleoside (e.g., the 5'-carbon atom of the third nucleoside) starting from the 5' end of the guiding chain. (3) Rp-enriched thiophosphates; and (4) Sp-enriched thiophosphates covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) starting from the 5' end of the guiding chain; and (5) Rp-enriched thiophosphates covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) starting from the 5' end of the guiding chain.

[0095] In some respects, the polynucleotide molecules described herein contain one or more purine modifications. In some respects, the purine modification described herein is 2,6-diaminopurine. In some respects, the purine modification described herein is 3-deazo-adenine. In some respects, the purine modification described herein is 7-deazo-guanine. In some respects, the purine modification described herein is 8-azido-adenine.

[0096] In some respects, the polynucleotide molecules described herein contain one or more pyrimidine modifications. In some respects, the pyrimidine modification described herein is 2-thio-thymidine. In some respects, the pyrimidine modification described herein is 5-formamide-uracil. In some respects, the pyrimidine modification described herein is 5-methyl-cytosine. In some respects, the pyrimidine modification described herein is 5-ethynyluracil.

[0097] In some embodiments, the polynucleotide molecules described herein contain debase substitutions. In those cases where the hybridized polynucleotide construct is considered for use as siRNA, reducing miRNA-like off-target effects is desirable. Because debase substitutions lack nucleobases capable of participating in base-pairing interactions and alleviate steric hindrance, including one or more (e.g., one or two) debase substitutions in the hybridized polynucleotide construct can reduce or even eliminate miRNA-like off-target effects. Therefore, the polynucleotide molecules disclosed herein may include one or more (e.g., one or two) debase substitutions. In some aspects, the debase substitution is located at the 5th nucleotide from the 5' end of the guiding strand described herein. In some aspects, the debase substitution is located at the 7th nucleotide from the 5' end of the guiding strand described herein.

[0098] When the polynucleotide molecules disclosed herein include two or more debase substitutions, their structures may be the same or different. In some aspects, the guest strand contains one debase substitution (e.g., the guiding strand may not have a debase substitution). In other aspects, the guiding strand contains one debase substitution (e.g., the guest strand may not have a debase substitution). In still other aspects, both the guiding strand and the guest strand contain one debase substitution. In a further aspect, the guest strand includes a debase substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7. In an even further aspect, the guiding strand includes a debase substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7.

[0099] Debasic substitution can be performed according to formula (III):

[0100]

[0101] in

[0102] L is a sugar analogue, or is substituted with a heteroacyl group from A, U, C, G, or any other substituted nucleic acid (e.g., locked or unlocked nucleic acids, glycol nucleic acids, etc.);

[0103] Each X 4 It can be either O or S independently;

[0104] Each X 5 It can be independently of O, S, NH or a bond;

[0105] Each R 9 H independently, or C with optional substitution 1-6 Alkyl, optionally substituted C 2-6 alkenyl, optionally substituted C 2-6 alkynyl, optionally substituted (C 1-9 (heterocyclic group)-C 1-6-alkyl, optionally substituted (C 6-10 (aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 cycloalkyl)-C 1-6 -alkyl, -LinkA(-T) p Or the joined parts;

[0106] Each LinkA is independently a multivalent connector (e.g., including -C(O)-N(H)-);

[0107] Each T is an independent auxiliary part;

[0108] R 10 It is a bond with the 3'-carbon atom of the nucleoside (x) in the chain;

[0109] R 11 It is a bond with the 5'-oxygen atom of the nucleoside (x+1) in the chain;

[0110] p is an integer from 1 to 6; and

[0111] t is an integer from 1 to 6.

[0112] In some aspects, the debase substitutions described herein are attached to the guiding strand of the polynucleotide molecule described herein. In certain aspects, the guiding strand described herein (e.g., within the seed region of the guiding strand) may include debase substitutions (e.g., internucleotide debase spacers of formula (III), where t is 1). In some aspects, debase substitutions (e.g., internucleotide debase spacers of formula (III), where t is 1) may be bonded to the 3' carbon atom of the second, third, fourth, or fifth nucleotide of the guiding strand described herein, starting from the 5' end. In some aspects, debase substitutions (e.g., internucleotide debase spacers of formula (III), where t is 1) may be bonded to the 3' carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleotide of the guiding strand described herein, starting from the 5' end. In some aspects, debase substitutions are made on the fourth, fifth, sixth, seventh, eighth, and / or ninth nucleotides of the guiding strand described herein, starting from the 5' end.

[0113] The polynucleotide molecules described herein may contain a chain including a seed region comprising a nucleoside (e.g., inosine) containing a hypoxanthine nucleobase.

[0114] In some respects, the nucleoside containing a hypoxanthine nucleotide is the second nucleoside from the 5' end of the chain. In a further respect, the nucleoside containing a hypoxanthine nucleotide is the third nucleoside from the 5' end of the chain. In an even further respect, the nucleoside containing a hypoxanthine nucleotide is the fourth nucleoside from the 5' end of the chain. In still a further respect, the nucleoside containing a hypoxanthine nucleotide is the fifth nucleoside from the 5' end of the chain. In a particular respect, the nucleoside containing a hypoxanthine nucleotide is the sixth nucleoside from the chain. In a particular respect, the nucleoside containing a hypoxanthine nucleotide is the seventh nucleoside from the chain.

[0115] Nucleotide analogues

[0116] In some respects, this disclosure provides a polynucleic acid molecule incorporating nucleotide analogs.

[0117] In some cases, modification of nucleotides with the nucleotide analogs described herein can alter base pairing and structural changes in repressive polynucleotide molecules. In some cases, nucleotide analogs can be incorporated into polynucleotide molecules to repress off-target effects. In some cases, nucleotide analogs can be incorporated into polynucleotide molecules to improve their stability and efficacy. In some cases, the nucleotide analogs described herein can be incorporated into the guide strand, guest strand, or a combination thereof.

[0118] In some cases, nucleotide analogs can be placed within polynucleotide molecules, or can be substitutes for nucleotides within polynucleotide molecules, thereby inhibiting off-target effects. In some cases, nucleotide analogs can replace nucleotides in polynucleotide molecules, thereby improving the stability and / or efficacy of the polynucleotide molecules. In some cases, the nucleotide analogs described herein can be placed within the guide strand, the transit strand, or both.

[0119] In some aspects, this disclosure provides a polynucleotide molecule comprising a guest strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a nucleotide analog as described herein. In some cases, the nucleotide analog includes acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the nucleotide analogue is selected from the following nucleotide analogues: acyclic L-threonine nucleic acid-thymidine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the nucleotide analogue is selected from the following nucleotide analogues: acyclic L-threonine nucleic acid-thymidine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3) and 2'-fluoro-2-thiouridine-3'-phosphate (U3f).

[0120] In some cases, acyclic L-threonine nucleic acid-3'-phosphate (TT) has a general representation as shown below, where the base can be any suitable base or modified base that can undergo Watson-Crick binding with a base on the opposite strand:

[0121]

[0122] In some cases, the phosphoramidic structure of acyclic L-threonol nucleic acid-thymine-3'-phosphate (TT) is shown below:

[0123]

[0124] In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) is incorporated into polynucleotide molecules. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) is incorporated into siRNA. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) is incorporated into the guide strand. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) is incorporated into the transit strand. In some cases, the incorporated acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) has the following structure:

[0125] In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) is incorporated into polynucleotide molecules. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) replaces one or more nucleotides in the siRNA. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) replaces one or more nucleotides in the guest strand and / or the guide strand. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) replaces one or more nucleotides in the guest strand. In some cases, acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT) replaces one or more nucleotides in the guide strand.

[0126] In some cases, the phosphoramidite structure of acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) is shown below:

[0127]

[0128] In some cases, acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) is incorporated into polynucleotide molecules. In some cases, acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) is incorporated into siRNA. In some cases, acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) is incorporated into the guide strand. In some cases, acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) is incorporated into the transit strand. In some cases, the incorporated acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA) has the structure shown below:

[0129]

[0130] In some cases, acyclic L-threonine-adenine-3'-phosphate (TA) is incorporated into polynucleotide molecules. In some cases, acyclic L-threonine-adenine-3'-phosphate (TA) replaces one or more nucleotides in the siRNA. In some cases, acyclic L-threonine-adenine-3'-phosphate (TA) replaces one or more nucleotides in the guest strand and / or the guide strand. In some cases, acyclic L-threonine-adenine-3'-phosphate (TA) replaces one or more nucleotides in the guest strand. In some cases, acyclic L-threonine-adenine-3'-phosphate (TA) replaces one or more nucleotides in the guide strand.

[0131] In some cases, the phosphoramidic structure of acyclic N-acetyl-L-threonol debased nucleic acid-3'-phosphate (T-NAc) is shown below:

[0132]

[0133] In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) is incorporated into polynucleotide molecules. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) is incorporated into siRNA. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) is incorporated into the director strand. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) is incorporated into the transit strand. In some cases, the incorporated acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) has the structure shown below:

[0134]

[0135] In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) is incorporated into polynucleotide molecules. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) replaces one or more nucleotides in the siRNA. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) replaces one or more nucleotides in the transient and / or guiding strands. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) replaces one or more nucleotides in the transient strand. In some cases, acyclic N-acetyl-L-threonol abasic nucleic acid-3'-phosphate (T-NAc) replaces one or more nucleotides in the guiding strand.

[0136] In some cases, the phosphorous amide structure of 1',2'-dideoxyribose-3'-phosphate (dAB) is shown below:

[0137]

[0138] In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) is incorporated into polynucleotide molecules. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) is incorporated into siRNA. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) is incorporated into the guide strand. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) is incorporated into the transit strand. In some cases, the incorporated 1',2'-dideoxyribo-3'-phosphate (dAB) has the structure shown below:

[0139]

[0140] In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) is incorporated into polynucleotide molecules. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) replaces one or more nucleotides in siRNA. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) replaces one or more nucleotides in the transient and / or guiding strands. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) replaces one or more nucleotides in the transient strand. In some cases, 1',2'-dideoxyribo-3'-phosphate (dAB) replaces one or more nucleotides in the guiding strand.

[0141] In some cases, the phosphoramide structure of the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is shown below:

[0142]

[0143] In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into polynucleotide molecules. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into siRNA. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into the director strand. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into the transit strand. In some cases, the incorporated thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) has the structure shown below:

[0144]

[0145] In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is placed in a polynucleotide molecule. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) replaces one or more nucleotides in the siRNA. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) replaces one or more nucleotides in the guest strand and / or the guide strand. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) replaces one or more nucleotides in the guest strand. In some cases, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) replaces one or more nucleotides in the guide strand.

[0146] In some cases, the phosphoramidic structure of 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is shown below:

[0147]

[0148] In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is incorporated into polynucleotide molecules. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is incorporated into siRNA. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is incorporated into the director strand. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is incorporated into the transit strand. In some cases, the incorporated 2'-O-methyl-2-thiouridine-3'-phosphate (u3) has the structure shown below:

[0149]

[0150] In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) is incorporated into polynucleotide molecules. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) replaces one or more nucleotides in the siRNA. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) replaces one or more nucleotides in the transient and / or guiding strands. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) replaces one or more nucleotides in the transient strand. In some cases, 2'-O-methyl-2-thiouridine-3'-phosphate (u3) replaces one or more nucleotides in the guiding strand.

[0151] In some cases, the phosphoramidic structure of 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is shown below:

[0152]

[0153] In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is incorporated into polynucleotide molecules. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is incorporated into siRNA. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is incorporated into the director strand. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is incorporated into the transit strand. In some cases, the incorporated 2'-fluoro-2-thiouridine-3'-phosphate (U3f) has the structure shown below:

[0154]

[0155] In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) is incorporated into polynucleotide molecules. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) replaces one or more nucleotides in the siRNA. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) replaces one or more nucleotides in the transient and / or guiding strands. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) replaces one or more nucleotides in the transient strand. In some cases, 2'-fluoro-2-thiouridine-3'-phosphate (U3f) replaces one or more nucleotides in the guiding strand.

[0156] In some cases, the phosphoramidic structure of 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is shown below:

[0157]

[0158] In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is incorporated into polynucleotide molecules. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is incorporated into siRNA. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is incorporated into the guide strand. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is incorporated into the transit strand. In some cases, the incorporated 2-amino-2'-O-methyladenosine-3'-phosphate (a1) has the structure shown below:

[0159]

[0160] In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) is placed in a polynucleotide molecule. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) replaces one or more nucleotides in the siRNA. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) replaces one or more nucleotides in the transient and / or guiding strands. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) replaces one or more nucleotides in the transient strand. In some cases, 2-amino-2'-O-methyladenosine-3'-phosphate (a1) replaces one or more nucleotides in the guiding strand.

[0161] In some cases, nucleotide analogs include nucleosides containing inosine nucleobases (e.g., inosine).

[0162] The amount and position of the embellishment

[0163] In some aspects, the polynucleotide molecules described herein contain one or more types of modifications as described above. Therefore, in some aspects, about 10% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 20% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 30% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 40% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 50% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 60% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 70% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 80% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other aspects, about 90% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the aforementioned modifications. In other respects, 100% of the nucleotides from the polynucleotide molecules described herein are modified with one or more of the types of modifications described above.

[0164] In some aspects, the modifications of one or more types described herein occur at different locations within the polynucleotide molecule described herein. In some aspects, the modifications of one or more types described herein occur in seed regions within the polynucleotide molecule described herein. In some aspects, the modifications of one or more types described herein occur at the 3' end of the polynucleotide molecule described herein. In some aspects, the modifications of one or more types described herein occur at the 5' end of the polynucleotide molecule described herein. In some aspects, the modifications of one or more types described herein occur dispersedly within the polynucleotide molecule described herein. In some aspects, the modifications of one or more types described herein occur in clusters within the polynucleotide molecule described herein.

[0165] In some respects, polynucleotide molecules are modified with the nucleotide analogs described herein by incorporating nucleotide analogs into the seed region of the guiding strand (positions 2-8 of the guiding strand from the 5' end). As described herein, a "seed region" refers to a region on a polynucleotide molecule containing a sequence essential for the binding of the polynucleotide molecule described herein to a target RNA (e.g., mRNA).

[0166] In some cases, polynucleotide molecules are modified with nucleotide analogs described herein at positions 3-8, 4-8, 5-8, 6-8, or 7-8 starting from the 5' end of the guiding strand. In some cases, polynucleotide molecules are modified with nucleotide analogs described herein at positions 2, 3, 4, 5, 6, 7, 8, or combinations thereof starting from the 5' end of the guiding strand. In some cases, polynucleotide molecules are modified with one, two, three, four, five, six, or seven nucleotide analogs. In some cases, two or more consecutive positions in the guiding strand of the polynucleotide molecule are modified with nucleotide analogs. In some cases, two or more nucleotide analog modifications may be disposed in alternating positions (e.g., positions 3 and 5, positions 4 and 6, positions 5 and 7, etc.) in the polynucleotide molecule.

[0167] In some cases, polynucleotide molecules include polynucleotide molecules. In some cases, polynucleotide molecules are siRNAs containing a guide strand and a guest strand. In some cases, the nucleotide analog is located in the guide strand seed region at positions 2-8 from the 5' end. In some cases, the nucleotide analog is located at positions 3-8 from the 5' end. In some cases, the nucleotide analog is located at positions 4-8 from the 5' end. In some cases, the nucleotide analog is located at positions 5-8 from the 5' end. In some cases, the nucleotide analog is located at positions 6-8 from the 5' end. In some cases, the nucleotide analog is located at positions 6-7 from the 5' end. In some cases, the nucleotide analog is located at positions 7-8 from the 5' end.

[0168] In some cases, the nucleotide analog is located at any of positions 2-8 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 3-8 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 4-8 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 5-8 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 6-8 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 6-7 from the 5' end of the guide strand. In some cases, the nucleotide analog is located at any of positions 7-8 from the 5' end of the guide strand.

[0169] In some cases, the nucleotide analog is located at position 1 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 2 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 3 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 4 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 5 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 7 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 9 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 10 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 11 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 12 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 13, starting from the 5' end of the guide strand. In other cases, the nucleotide analog is located at position 14, starting from the 5' end of the guide strand.

[0170] In some cases, the nucleotide analog is located at position 3 starting from the 5' end of the guide strand. In some cases, the nucleotide analog is located at position 3 starting from the 5' end of the guide strand, and the guide strand further comprises 2-thiouridine-3'-phosphate. In some cases, the nucleotide analog is located at position 3 starting from the 5' end of the guide strand, and the guide strand further comprises 2'-O-methyl-2-thiouridine-3'-phosphate (u3). In some cases, the nucleotide analog is located at position 3 starting from the 5' end of the guide strand, and the guide strand further comprises at least one, at least two, at least three, or at least four 2'-F modified nucleotides. In some cases, the nucleotide analog is located at position 3 starting from the 5' end of the guide strand, and the guide strand further comprises at least one 2'-F modified nucleotide at positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 3 of the guide strand starting from the 5' end, and the guide strand further contains 2'-F modified nucleotides at positions 2, 7, 12, 14, and 16 starting from the 5' end.

[0171] Specific modification mode

[0172] In some respects, this paper describes a specific modification pattern for a polynucleotide molecule, which is a double-stranded nucleic acid molecule comprising a guest strand and a guide strand. In some respects, the guide strand contains a 2'-fluorinated nucleotide at position 2. In some respects, the guide strand contains a 2'-fluorinated nucleotide at position 14. In some respects, the guide strand contains 2'-fluorinated nucleotides at positions 2 and 14. In some respects, the guide strand contains a 2'-fluorinated nucleotide at position 12. In some respects, the guide strand contains a 2'-fluorinated nucleotide at position 16. In other respects, the guide strand contains a 2'-fluorinated nucleotide at position 6. In other respects, the guide strand contains a 2'-fluorinated nucleotide at position 7. In other respects, the guide strand contains a 2'-fluorinated nucleotide at position 8. In other respects, the guide strand contains a 2'-fluorinated nucleotide at position 9. In other respects, the guide strand contains a 2'-fluorinated nucleotide at position 4.

[0173] In some respects, this paper describes a specific modification pattern for a polynucleotide molecule, which is a double-stranded nucleic acid molecule comprising a guest strand and a guide strand. In some respects, the guest strand contains a 2'-fluorinated nucleotide at position 9. In some respects, the guest strand contains a 2'-fluorinated nucleotide at position 11. In some respects, the guest strand contains 2'-fluorinated nucleotides at positions 9 and 11. In some respects, the guest strand contains a 2'-fluorinated nucleotide at position 7. In some respects, the guest strand contains a 2'-fluorinated nucleotide at position 10. In some respects, the guest strand contains 2'-fluorinated nucleotides at positions 9, 11, and 7. The guest strand contains 2'-fluorinated nucleotides at positions 9, 11, and 10. The guest strand contains 2'-fluorinated nucleotides at positions 9 and 7. The guest strand contains 2'-fluorinated nucleotides at positions 9 and 10. The guest chain contains 2'-fluorinated nucleotides at positions 9, 11, 7, and 10. In other respects, the guest chain contains a 2'-fluorinated nucleotide at position 8. In other respects, the guest chain contains a 2'-fluorinated nucleotide at position 12. In other respects, the guest chain contains a 2'-fluorinated nucleotide at position 16.

[0174] In some respects, the transit and guide strands of polynucleotide molecules contain any combination of two or more 2'-fluorinated nucleotides at the positions described in the above two paragraphs.

[0175] In some aspects, the guiding strand contains 5'-nNfnnnNfNfNfnnnnNfnNfnnnnnnn-3'. In some aspects, the guiding strand contains 5'-nNfnnnNfnnnnnnnnNfnNfnnnnnnnn-3'. In some aspects, the guiding strand contains 5'-nNfnnnnNfnnnnnnNfnNfnnnnnnnn-3'. In the above modification pattern, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0176] In some aspects, the transient chain contains 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3'. In some aspects, the transient chain contains 5'-nnnnnnNfnNfNfnnnnnnnnnn-3'. In some aspects, the transient chain contains 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In the above modification pattern, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0177] In some respects, this paper describes a specific modification pattern for a polynucleotide molecule that is a double-stranded nucleic acid molecule comprising a guest strand and a guide strand, wherein the guest strand comprises approximately twelve 2'-fluoro-modified nucleotides and approximately nine 2'-O-methyl-modified nucleotides, and wherein the guide strand comprises approximately nine 2'-fluoro-modified nucleotides and approximately fourteen 2'-O-methyl-modified nucleotides.

[0178] In some respects, this paper describes a specific modification pattern in which the guest chain is fully modified and contains twelve 2'-fluoro-modified nucleotides and nine 2'-O-methyl-modified nucleotides, and in which the guide chain is fully modified and contains nine 2'-fluoro-modified nucleotides and fourteen 2'-O-methyl-modified nucleotides.

[0179] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3', and the guiding strand contains 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0180] In some respects, this paper describes a specific modification pattern in which the guest chain contains 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3', the guiding chain contains 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnnn-3', and the guest chain and / or the guiding chain contains one or more thiophosphate bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain contains 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3', the guiding chain contains 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnnn-3', the guest chain contains two thiophosphate bonds, the guiding chain contains four thiophosphate bonds, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0181] In some respects, this paper describes a specific modification pattern in which the guest chain contains 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3', the guiding chain contains 5'-nsNfsnnnnNfnnnnNfnNfnnnnnsnsn-3', the guest chain contains two thiophosphate bonds, where "s" represents a thiophosphate bond, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0182] In some respects, this paper describes a specific modification pattern in which the transient chain and / or the guiding chain is modified to type I in Table 6.

[0183] Table 6. Nucleotide modification patterns

[0184] Mode Name model Passenger Chain Type I 5'-NfsnsNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3' Guidance Chain Type I 5'-nsNfsnNfnNfnNfnNfnnnNfnNfnNfnNfnsnsn-3' Passenger Chain Type II 5'-nsnsnnnnNfnNfNfNfnnnnnnnnnn-3' Guidance Chain Type II 5'-nsNfsnnnNfnNfNfnnnnNfnNfnnnnnsnsn-3' Passenger Chain Type III 5'-nsnsnnnnnnNfnNfnnnnnnnnnn-3' Guidance Chain Type III 5'-nsNfsnnnnnnnnnNfnNfnnnnnnnsnsn-3' Passenger Chain Type IV 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3' Guidance Chain Type IV 5'-nsNfsnnnnnnnnnNfnNfnNfnnnnnsnsn-3' Passenger Chain V-Shaped 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3' V-shaped guidance chain 5'-nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn-3' Passenger Chain Type VI 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3'

[0185] Note: "Nf" represents a 2'-fluoromodified nucleotide, "n" represents a 2'-O-methylmodified nucleotide, "s" represents a 3′-thiophosphate, and "invdN" represents an inverted deoxynucleotide.

[0186] In some respects, the polynucleotide molecules provided herein comprise a transit strand of nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and a guiding strand comprises nucleic acid sequences selected from SEQ ID NO: 1-196, 797-806, and 850-857. In other respects, the polynucleotide molecules provided herein comprise a transit strand of nucleic acid sequences selected from SEQ ID NO: 401-596, 819-828, and 870-875, and a guiding strand comprises nucleic acid sequences selected from SEQ ID NO: 1-196, 797-806, and 850-857, wherein the transit strand and / or the guiding strand are modified with the type I modification pattern specified in Table 6. In some respects, the polynucleotide molecules provided herein comprise a transit strand from nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and a guide strand comprises .... Nucleic acid sequences of NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857. In other respects, the polynucleotide molecules provided herein comprise a transit strand from nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and a guide strand comprised of sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875. The nucleic acid sequences of NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the transit strand and / or the guide strand are modified with the type I modification pattern specified in Table 6.

[0187] In some respects, the polynucleotide molecules provided herein comprise a transit strand from nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and a guide strand comprises .... Nucleic acid sequences of NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857. In other respects, the polynucleotide molecules provided herein comprise a transit strand from nucleic acid sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and the guiding strand comprises .... The nucleic acid sequences of NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the transit strand and / or the guide strand are modified with the type I modification pattern specified in Table 6.

[0188] In some respects, the polynucleotide molecules provided herein comprise a transit strand of nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and a guiding strand comprises nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145. In other respects, the polynucleotide molecules provided herein comprise a transit strand of nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514, and 545, and a guiding strand comprises nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114, and 145, wherein the transit strand and / or the guiding strand are modified with the type I modification pattern specified in Table 6.

[0189] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about four 2'-fluoro-modified nucleotides and about seventeen 2'-O-methyl-modified nucleotides, and in which the guiding chain comprises about six 2'-fluoro-modified nucleotides and about seventeen 2'-O-methyl-modified nucleotides.

[0190] In some respects, this paper describes a specific modification pattern in which the guest strand is fully modified and contains four 2'-fluoro-modified nucleotides and seventeen 2'-O-methyl-modified nucleotides, and in which the guide strand is fully modified and contains six 2'-fluoro-modified nucleotides and seventeen 2'-O-methyl-modified nucleotides.

[0191] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', and the guiding strand contains 5'-nNfnnnNfnNfNfnnnnnnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0192] In some respects, this paper describes a specific modification pattern in which the guest chain contains 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', the guiding chain contains 5'-nNfnnnNfnNfNfnnnnnnNfnNfnnnnnnn-3', and the guest chain and / or the guiding chain contains one or more phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and wherein "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain contains 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', the guiding chain contains 5'-nNfnnnNfnNfNfnnnnnnNfnNfnnnnnnn-3', the guest chain contains two thiophosphate bonds, the guiding chain contains four thiophosphate bonds, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0193] In some respects, this paper describes a specific modification pattern in which the transient chain and / or the guiding chain are modified to type II in Table 6.

[0194] In some respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:1-196, 797-806 and 850-857, wherein the transit strand and / or guide strand are modified with the type II modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type II modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type II modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:405, 408, 418, 422, 440, 444-446, 450, 452-453, 456, 513, 546, 553, 509, 558, 508, 514 and 545, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:113, 146, 153, 158, 108, 114 and 145, wherein the transit strand and / or guide strand are modified with the type II modification pattern specified in Table 6.

[0195] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about two 2'-fluoro-modified nucleotides and about nineteen 2'-O-methyl-modified nucleotides, and in which the guiding chain comprises about three 2'-fluoro-modified nucleotides and about twenty 2'-O-methyl-modified nucleotides.

[0196] In some respects, this paper describes a specific modification pattern in which the guest chain is fully modified and contains two 2'-fluoro-modified nucleotides and nineteen 2'-O-methyl-modified nucleotides, and in which the guide chain is fully modified and contains three 2'-fluoro-modified nucleotides and twenty 2'-O-methyl-modified nucleotides.

[0197] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', the guiding strand contains 5'-nNfnnnnnnnnnnNfnNfnnnnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0198] In some respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnnnnnnnNfnNfnnnnnnnnnn-3', and the guest chain and / or the guiding chain comprises one or more phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnnnnnnnNfnNfnnnnnnnnnn-3', the guest chain comprises two phosphate thioester bonds, the guiding chain comprises four phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0199] In some respects, this paper describes a specific modification pattern in which the transient chain and / or the guiding chain are modified to type III in Table 6.

[0200] In some respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:1-196, 797-806 and 850-857, wherein the transit strand and / or guide strand are modified with the type III modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type III modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type III modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514 and 545, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114 and 145, wherein the transit strand and / or guide strand are modified with the type III modification pattern specified in Table 6.

[0201] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about three 2'-fluoro-modified nucleotides and about eighteen 2'-O-methyl-modified nucleotides, and in which the guiding chain comprises about four 2'-fluoro-modified nucleotides and about nineteen 2'-O-methyl-modified nucleotides.

[0202] In some respects, this paper describes a specific modification pattern in which the guest strand is fully modified and contains three 2'-fluorinated nucleotides and eighteen 2'-O-methylated nucleotides, and in which the guide strand is fully modified and contains four 2'-fluorinated nucleotides and nineteen 2'-O-methylated nucleotides.

[0203] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the guiding strand contains 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0204] In some respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnnnnnnnNfnNfnnnnnnnnn-3', and the guest chain and / or the guiding chain comprises one or more phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnNfnNfnnnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnnnnnnnNfnNfnnnnnnnnn-3', the guest chain comprises two phosphate thioester bonds, the guiding chain comprises four phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0205] In some respects, this paper describes a specific modification pattern in which the transient chain and / or the guiding chain are modified to type IV in Table 6.

[0206] In some respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:1-196, 797-806 and 850-857, wherein the transit strand and / or guide strand are modified in accordance with the type IV modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type IV modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strand and / or the guide strand are modified with the type IV modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514 and 545, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114 and 145, wherein the transit strand and / or guide strand are modified in accordance with the type IV modification pattern specified in Table 6.

[0207] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about three 2'-fluoro-modified nucleotides and about eighteen 2'-O-methyl-modified nucleotides, and in which the guiding chain comprises about five 2'-fluoro-modified nucleotides and about eighteen 2'-O-methyl-modified nucleotides.

[0208] In some respects, this paper describes a specific modification pattern in which the guest chain is fully modified and contains three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and in which the guiding chain is fully modified and contains five 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides.

[0209] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the guiding strand contains 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0210] In some respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', and the guest chain and / or the guiding chain comprises one or more phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnNfnNfnnnnnnnnnnnn-3', the guiding chain comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', the guest chain comprises two phosphate thioester bonds, the guiding chain comprises four phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0211] In some respects, this paper describes a specific modification pattern in which the transient chain and / or the guiding chain are modified into the V-shape shown in Table 6.

[0212] In some respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:1-196, 797-806 and 850-857, wherein the transit strand and / or guide strand are modified with the V-shaped modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strands of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strands and / or the guide strands are modified with the V-shaped modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strands of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the guest strands and / or the guide strands are modified with the V-shaped modification pattern specified in Table 6. In other respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514 and 545, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114 and 145, wherein the transit strand and / or guide strand are modified with the V-shaped modification pattern specified in Table 6.

[0213] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about three 2'-fluoro-modified nucleotides and about eighteen 2'-O-methyl-modified nucleotides, with one or more inverted deoxynucleotides as overhangs at the 3' end.

[0214] In some respects, this paper describes a specific modification pattern in which the guest chain is fully modified and contains three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, with two inverted deoxynucleotides as overhangs at the 3' end.

[0215] In some aspects, this document describes a specific modification pattern in which the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoromodified nucleotide, "n" represents a 2'-O-methylmodified nucleotide, and "invdN" represents an inverted deoxynucleotide. In some cases, invdN is an inverted deoxythymidine. In some aspects, a linker conjugated to one or more target moieties, as shown in formula (IV") or (IV"'), is added to the first nucleic acid at the 5' end. In some aspects, a linker conjugated to one or more GalNAc, as shown in formula (V") or (V"'), is added to the first nucleic acid at the 5' end. In some aspects, the modification pattern comprises one or more phosphate thioester bonds. In some aspects, the modification pattern is shown in formula (VII). In some aspects, 5' end modifications known in the art are applied to one or more inverted nucleotides.

[0216] Where R is the part corresponding to the sugar modification described herein, and in some cases, R is -O-methyl; where R' is thymine, debasement, etc.; where A is -O or -S; and where A' is -O or -S.

[0217] In some respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO:401-596, 819-828 and 870-875, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO:1-196, 797-806 and 850-857, wherein the transit strand is modified in the type VI modification pattern specified in Table 6 or as described in the preceding paragraphs. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the transit strand is modified with the type VI modification pattern specified in Table 6 or as described in the preceding paragraphs. In other respects, the polynucleotide molecules provided herein contain a transit chain comprising nucleic acid sequences selected from SEQ ID NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875, and / or contain ... The guide strand of the nucleic acid sequences NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, wherein the transit strand is modified with the type VI modification pattern specified in Table 6 or as described in the preceding paragraphs. In other respects, the polynucleotide molecules provided herein comprise a transit strand comprising nucleic acid sequences selected from SEQ ID NO: 513, 546, 553, 558, 508, 514 and 545, and / or a guide strand comprising nucleic acid sequences selected from SEQ ID NO: 113, 146, 153, 158, 108, 114 and 145, wherein the transit strand is modified in the type VI modification pattern specified in Table 6 or as described in the preceding paragraphs.

[0218] In some respects, this paper describes a specific modification pattern in which the guest chain comprises about three 2'-fluoro-modified nucleotides and about eighteen 2'-O-methyl-modified nucleotides, and in which the guiding chain comprises about four 2'-fluoro-modified nucleotides and about nineteen 2'-O-methyl-modified nucleotides.

[0219] In some respects, this paper describes a specific modification pattern in which the guest strand is fully modified and contains three 2'-fluorinated nucleotides and eighteen 2'-O-methylated nucleotides, and in which the guide strand is fully modified and contains four 2'-fluorinated nucleotides and nineteen 2'-O-methylated nucleotides.

[0220] In some respects, this paper describes a specific modification pattern in which the transient strand contains 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3', and the guiding strand contains 5'-nsNfsnnnnNfnnnnNfnNfnnnnnsnsn-3', where "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide.

[0221] In some respects, this paper describes a specific modification pattern in which the guest chain contains 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3', the guiding chain contains 5'-nsNfsnnnnNfnnnnNfnNfnnnnnsnsn-3', and the guest chain and / or the guiding chain contains one or more phosphate thioester bonds, wherein "Nf" represents a 2'-fluoromodified nucleotide and "n" represents a 2'-O-methylmodified nucleotide. In other respects, this paper describes a specific modification pattern in which the guest chain contains 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3', the guiding chain contains 5'-nsNfsnnnnNfnnnnNfnNfnnnnnsnsn-3', the guest chain contains two thiophosphate bonds, the guiding chain contains four thiophosphate bonds, "Nf" represents a 2'-fluoromodified nucleotide, and "n" represents a 2'-O-methylmodified nucleotide.

[0222] This article describes a polynucleotide molecule whose passchain contains a nucleic acid sequence having at least 80% identity with nucleic acid sequences selected from SEQ ID NO:601-796, 830-839, and 876-881. This article describes a polynucleotide molecule whose passchain contains a nucleic acid sequence having at least 85% identity with nucleic acid sequences selected from SEQ ID NO:601-796, 830-839, and 876-881. This article describes a polynucleotide molecule whose passchain contains a nucleic acid sequence having at least 90% identity with nucleic acid sequences selected from SEQ ID NO:601-796, 830-839, and 876-881. This article describes a polynucleotide molecule whose passchain contains a nucleic acid sequence having at least 95% identity with nucleic acid sequences selected from SEQ ID NO:601-796, 830-839, and 876-881.

[0223] This article describes a polynucleotide molecule whose guide strand contains a nucleic acid sequence having at least 80% identity with nucleic acid sequences selected from SEQ ID NO:201-396, 808-817, and 858-868. This article describes a polynucleotide molecule whose guide strand contains a nucleic acid sequence having at least 85% identity with nucleic acid sequences selected from SEQ ID NO:201-396, 808-817, and 858-868. This article describes a polynucleotide molecule whose guide strand contains a nucleic acid sequence having at least 90% identity with nucleic acid sequences selected from SEQ ID NO:201-396, 808-817, and 858-868. This article describes a polynucleotide molecule whose guide strand contains a nucleic acid sequence having at least 95% identity with nucleic acid sequences selected from SEQ ID NO:201-396, 808-817, and 858-868.

[0224] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing a nucleotide sequence selected from SEQ ID NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and a .... Passenger chains of nucleotide sequences NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875.

[0225] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing a nucleotide sequence selected from SEQ ID NO:5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806, and 850-857, and a .... Passenger chains of nucleotide sequences NO:405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875.

[0226] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand comprising nucleotide sequences selected from SEQ ID NO:113, 146, 153, 158, 108, 114 and 145 and a transit strand comprising nucleotide sequences selected from SEQ ID NO:513, 546, 553, 558, 508, 514 and 545.

[0227] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing a nucleotide sequence selected from SEQ ID NO: 205, 207, 208, 211, 218, 220, 222, 240, 243-246, 250, 252, 253, 256, 308, 309, 313, 314, 345, 346, 348, 353, 357, 358, 808-817, and 858-868, and .... Passenger chains of nucleotide sequences NO:605, 607, 608, 611, 618, 620, 622, 640, 643, 644, 645, 646, 650, 652, 653, 656, 708, 709, 713, 714, 745, 746, 748, 753, 757, 758, 830-839, and 876-881.

[0228] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing a nucleotide sequence selected from SEQ ID NO: 205, 207, 208, 211, 218, 220, 222, 240, 243-246, 250, 252, 253, 256, 308, 309, 313, 314, 345, 346, 348, 353, 357, 358, 808-817, and 858-868, and .... Passenger chains of nucleotide sequences NO:605, 607, 608, 611, 618, 620, 622, 640, 643, 644, 645, 646, 650, 652, 653, 656, 708, 709, 713, 714, 745, 746, 748, 753, 757, 758, 830-839, and 876-881.

[0229] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing nucleotide sequences selected from SEQ ID NO:313, 346, 353, 358, 308, 314 and 345 and a transit strand containing nucleotide sequences selected from SEQ ID NO:713, 746, 753, 758, 708, 714 and 745.

[0230] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsaguuGfguuuCfgUfgAfuuuccscsa (SEQ ID NO:313) and a guest strand containing the nucleotide sequence gsgsaaauCfaCfgAfaaccaacuaa (SEQ ID NO:713), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0231] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsagagUfauaaCfcUfuCfcauuususg (SEQ ID NO:346) and a guest strand containing the nucleotide sequence asasauggAfaGfgUfuauacucuaa (SEQ ID NO:746), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0232] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsuggaUfcaacAfuUfuUfgguugsasu (SEQ ID NO:353) and a guest strand containing the nucleotide sequence csasaccaAfaAfuGfuugauccaua (SEQ ID NO:753), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0233] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsaaggAfuuuaAfuAfcCfagauusasu (SEQ ID NO:358) and a guest strand containing the nucleotide sequence asasucugGfuAfuUfaaauccuuaa (SEQ ID NO:758), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0234] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsuuagAfuugcUfuCfaCfuauggsasg (SEQ ID NO:308) and a guest strand containing the nucleotide sequence cscsauagUfgAfaGfcaaucuaaua (SEQ ID NO:708), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0235] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsauagUfugguUfuCfgUfgauuuscsc (SEQ ID NO:314) and a guest strand containing the nucleotide sequence asasaucaCfgAfaAfccaacuauaa (SEQ ID NO:714), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluorinated modified nucleotide, and “s” represents a 3'-thiophosphate.

[0236] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuuusgsa (SEQ ID NO:345) and a guest strand containing the nucleotide sequence asasaaugGfaAfgGfuuauacucua (SEQ ID NO:745), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0237] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsaauuAfgauuGfcUfuCfacuausgsg (SEQ ID NO:309) and a guest strand containing the nucleotide sequence asusagugAfaGfcAfaucuaauuaa (SEQ ID NO:709), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0238] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsauuaGfauugCfuUfcAfcuaugsgsa (SEQ ID NO:815) and a guest strand containing the nucleotide sequence csasuaguGfaAfgCfaaucuaauua (SEQ ID NO:837), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0239] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usUfsucauUfgaagUfuUfuGfugaucscsa (SEQ ID NO:812) and a guest strand containing the nucleotide sequence gsasucacAfaAfaCfuucaaugaaa (SEQ ID NO:834), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0240] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsuugcUfucacUfaUfgGfaguausasu (SEQ ID NO:813) and a guest strand containing the nucleotide sequence asusacucCfaUfaGfugaagcaaua (SEQ ID NO:835), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0241] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuucsgsa (SEQ ID NO:865) and a guest strand containing the nucleotide sequence gsasaaugGfaAfgGfuuauacucua (SEQ ID NO:879), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0242] A polynucleotide molecule for regulating ANGPTL3 gene expression, wherein the polynucleotide molecule comprises a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuccsgsa (SEQ ID NO:866) and a guest strand containing the nucleotide sequence gsgsaaugGfaAfgGfuuauacucua (SEQ ID NO:880), wherein lowercase “n” represents a 2'-O-methyl modified nucleotide, uppercase followed by “f” (i.e. “Nf”) represents a 2'-fluoro modified nucleotide, and “s” represents a 3'-thiophosphate.

[0243] On the one hand, this paper describes specific modification motifs or patterns of double-stranded repressive polynucleotide molecules that include a transit strand and a guide strand.

[0244] In some respects, the guiding chain comprises a nucleotide analog selected from acyclic L-threonine nucleic acid-thymidine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the nucleotide analogue is selected from the following nucleotide analogues: acyclic L-threonine nucleic acid-thymidine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the nucleotide analogue is selected from the following nucleotide analogues: acyclic L-threonine nucleic acid-thymidine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3) and 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the nucleotide analogue is selected from the following nucleotide analogues: acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), and 1',2'-dideoxyribose-3'-phosphate (dAB). In some cases, the guiding strand contains a nucleotide analogue selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), and 1',2'-dideoxyribose-3'-phosphate (dAB).

[0245] In some aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at position 2 starting from the 5' end. In some aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at position 7 starting from the 5' end. In some aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at position 12 starting from the 5' end. In some aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at position 14 starting from the 5' end. In some aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at position 16 starting from the 5' end. In other aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at positions 2, 12, 14, 16, or a combination thereof starting from the 5' end. In other aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at positions 2, 7, 12, 14, 16, or a combination thereof starting from the 5' end. In other aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at at least three of positions 2, 12, 14, and 16 starting from the 5' end. In other aspects, the guiding strand comprises a nucleotide analog at one of positions 2-8 starting from the 5' end, and further comprises a 2'-fluorinated nucleotide at at least three of positions 2, 7, 12, 14, and 16 starting from the 5' end.

[0246] In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least one of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least two of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least three of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 6 of the guide strand starting from the 5' end, and the guide strand further includes 2'-fluorinated (2'-F) modified nucleotides at positions 2, 7, 12, 14 and 16 starting from the 5' end.

[0247] In some cases, the nucleotide analog is located at position 7 starting from the 5' end of the guide strand. In some cases, the nucleotide analog is located at position 7 starting from the 5' end of the guide strand, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least one of positions 2, 6, 8, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 starting from the 5' end of the guide strand, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least one of positions 2, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 starting from the 5' end of the guide strand, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least two of positions 2, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 of the guide strand starting from the 5' end, and the guide strand further comprises 2'-fluorinated (2'-F) modified nucleotides at at least three of positions 2, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 of the guide strand starting from the 5' end, and the guide strand further comprises 2'-fluorinated (2'-F) modified nucleotides at positions 2, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 of the guide strand starting from the 5' end, and the guide strand comprises 2'-F modified nucleotides at positions 2, 6, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 7 of the guide strand starting from the 5' end, and the guide strand comprises 2'-F modified nucleotides at positions 2, 8, 12, 14, and 16 starting from the 5' end.

[0248] In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end. In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least one of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least two of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end, and the guide strand further comprises a 2'-fluorinated (2'-F) modified nucleotide at at least three of positions 2, 7, 12, 14, and 16 starting from the 5' end. In some cases, the nucleotide analog is located at position 8 of the guide strand starting from the 5' end, and the guide strand further includes 2'-fluorinated (2'-F) modified nucleotides at positions 2, 7, 12, 14 and 16 starting from the 5' end.

[0249] In some cases, the nucleotides of the guide strand include DNA or RNA. As described herein, in some cases, the DNA nucleotides include unmodified DNA, comprising: unmodified adenine nucleotide (A), unmodified guanine nucleotide (G), unmodified thymine nucleotide (T), or unmodified cytosine nucleotide (C). As described herein, in some cases, the RNA includes unmodified RNA, comprising: unmodified adenine nucleotide (A), unmodified guanine nucleotide (G), unmodified uracil nucleotide (U), or unmodified cytosine nucleotide (C).

[0250] In some cases, the nucleotide guiding the strand includes DNA, RNA, nucleotide analogs, 2'-F-modified nucleotides, or 2'-O-alkyl-modified nucleotides. In some cases, 2'-O-alkyl-modified nucleotides include 2'-O-methyl-modified nucleotides. In some cases, the nucleotide guiding the strand that is not a nucleotide analog or a 2'-F-modified nucleotide is selected from DNA nucleotides, RNA nucleotides, and 2'-O-alkyl-modified nucleotides. In some cases, the nucleotide guiding the strand that is not a nucleotide analog or a 2'-F-modified nucleotide is a 2'-O-methyl-modified nucleotide.

[0251] In some cases, the guiding chain contains at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphate-thioester modified nucleotide bonds. In some cases, the guiding chain contains at least two, at least three, or at least four phosphate-thioester modified nucleotide bonds. In some cases, the guiding chain contains at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphate-thioester modified nucleotide bonds. In some cases, the guiding chain contains one, two, three, four, five, six, seven, or eight phosphate-thioester modified nucleotide bonds. In some cases, the guiding chain contains 1 to 8, 2 to 8, 3 to 8, 4 to 8, 5 to 8, or 6 to 8 phosphate-thioester modified nucleotide bonds. In some cases, the guiding chain contains 1 to 4, 2 to 4, or 3 to 4 phosphate-thioester modified nucleotide bonds.

[0252] In some cases, the guiding strand contains one phosphate-thioester modified nucleotide bond at the 5' end and one phosphate-thioester modified nucleotide bond at the 3' end. In some cases, the guiding strand contains two phosphate-thioester modified nucleotide bonds at the 5' end and two phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guiding strand contains three phosphate-thioester modified nucleotide bonds at the 5' end and three phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guiding strand contains four phosphate-thioester modified nucleotide bonds at the 5' end and four phosphate-thioester modified nucleotide bonds at the 3' end.

[0253] In some cases, the guide chain contains nucleotides modified with 2'-O-methyl, nucleotides modified with 2'-F, and / or nucleotide analogs described herein. In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmXFmmmmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-fluoro(2'-F) modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmXFmmmmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-fluoro(2'-F) modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0254] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0255] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmFXmmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guide strand contains a nucleic acid sequence of 5'-mFmmmFXmmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0256] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXFmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXFmmmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0257] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guide strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0258] In some cases, the guiding chain contains a 2'-O-methyl modified nucleotide, a 2'-F modified nucleotide, a nucleotide analog as described herein, or a phosphate-thioester nucleotide bond. In some cases, the guiding chain contains one or more phosphate-thioester modified nucleotide bonds at the 5' end and one or more phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guiding chain contains two phosphate-thioester modified nucleotide bonds at the 5' end and two phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0259] In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0260] In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), and 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn).

[0261] In some cases, the nucleotide analog is located at at least one of positions 2-12 from the 5' end of the guiding strand, and the nucleotide analog comprises 2'-O-methyl-2-thiouridine-3'-phosphate (U3) or 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the nucleotide analog is located at position 12 from the 5' end of the guiding strand, and the nucleotide analog consists of 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the nucleotide analog is located at position 3 from the 5' end of the guiding strand, and the nucleotide analog comprises 2'-O-methyl-2-thiouridine-3'-phosphate (U3). In some cases, the nucleotide analog is located at position 3 from the 5' end of the guiding strand, and the nucleotide analog consists of 2'-O-methyl-2-thiouridine-3'-phosphate (U3). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmF'mFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, X is selected from acyclic L-threonol nucleic acid-thymine-3'-phosphate (TT), acyclic N-acetyl L-threonol debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and F' is 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmF'mFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, X is selected from acyclic L-threonol nucleic acid-thymine-3'-phosphate (TT), acyclic N-acetyl L-threonol debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and F' is 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some cases, the guiding strand contains the nucleic acid sequence 5'-mFXmmmFmmmmFmFmFmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is 2'-O-methyl-2-thiouridine-3'-phosphate (u3). In other cases, the guiding strand contains the nucleic acid sequence 5'-msFsXmmmFmmmmFmFmFmmmmmsmsm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a thiophosphate nucleotide internucleotide bond, and X is 2'-O-methyl-2-thiouridine-3'-phosphate (u3).

[0262] In some respects, this paper describes specific modification patterns of motifs in double-stranded polynucleotide molecules, including guest and guide strands. In other respects, this paper describes specific modification patterns of the guest strand.

[0263] In some cases, the guest chain contains one or more nucleotide analogs. In some cases, the guest chain contains one or more nucleotide analogs at positions opposite to the seed region of the guiding strand. In some cases, the guest chain contains one or more nucleotide analogs at positions 12-22 starting from the 5' end. In some cases, the guest chain contains one or more nucleotide analogs at positions 2-10 starting from the 3' end. In some cases, the guest chain contains one or more 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guest chain contains 2-amino-2'-O-methyladenosine-3'-phosphate (a1) at positions 11, 12, 13, 14, or 15 starting from the 5' end. In some cases, the guest chain contains 2-amino-2'-O-methyladenosine-3'-phosphate (a1) at position 13 starting from the 5' end. In some cases, the guest chain contains 2-amino-2'-O-methyladenosine-3'-phosphate (a1) at position 14 starting from the 5' end. In some cases, the transient chain contains 2-amino-2'-O-methyladenosine-3'-phosphate (a1) at position 15 starting from the 5' end.

[0264] In some cases, the guest chain contains at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleotides modified with 2'-fluorine (2'-F). In some cases, the guest chain contains at least two, at least three, or at least four nucleotides modified with 2'-F. In some cases, the guest chain contains at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight nucleotides modified with 2'-fluorine (2'-F). In some cases, the guest chain contains one to eight, two to eight, three to eight, four to eight, five to eight, six to eight, or seven to eight nucleotides modified with 2'-fluorine (2'-F). In some cases, the guest chain contains one, two, three, four, five, six, seven, or eight nucleotides modified with 2'-fluorine (2'-F). In some cases, the guest chain contains one nucleotide modified with 2'-F. In some cases, the guest chain contains two nucleotides modified with 2'-F. In some cases, the transient chain contains three 2'-F modified nucleotides. In some cases, the transient chain contains four 2'-F modified nucleotides. In some cases, the transient chain contains five 2'-F modified nucleotides.

[0265] In some aspects, the guest chain contains a 2'-fluorinated nucleotide at position 7 starting from the 5' end. In some aspects, the guest chain contains a 2'-fluorinated nucleotide at position 9 starting from the 5' end. In some aspects, the guest chain contains a 2'-fluorinated nucleotide at position 11 starting from the 5' end. In some aspects, the guest chain contains a 2'-fluorinated nucleotide at at least one of positions 7, 9, and 11 starting from the 5' end. In some aspects, the guest chain contains a 2'-fluorinated nucleotide at positions 7, 9, 11, or a combination thereof starting from the 5' end. In some aspects, the guest chain contains a 2'-fluorinated nucleotide at positions 7, 9, and 11 starting from the 5' end.

[0266] In some cases, the nucleotides in the transit chain include DNA nucleotides or RNA nucleotides. As described herein, in some cases, the DNA nucleotides include unmodified DNA nucleotides, including: unmodified adenine nucleotides (A), unmodified guanine nucleotides (G), unmodified thymine nucleotides (T), or unmodified cytosine nucleotides (C). As described herein, in some cases, the RNA nucleotides include unmodified RNA nucleotides, including: unmodified adenine nucleotides (A), unmodified guanine nucleotides (G), unmodified uracil nucleotides (U), or unmodified cytosine nucleotides (C).

[0267] In some cases, the guest chain nucleotide includes DNA nucleotides, RNA nucleotides, nucleotide analogs, 2'-F-modified nucleotides, or 2'-O-alkyl-modified nucleotides. In some cases, 2'-O-alkyl-modified nucleotides include 2'-O-methyl-modified nucleotides. In some cases, the guest chain nucleotide that is not a nucleotide analog or a 2'-F-modified nucleotide is selected from 2'-O-alkyl-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-halogenated nucleotides, DNA nucleotides, RNA nucleotides, ENA, BNA, LNA, and UNA. In some cases, the guest chain nucleotide that is not a 2'-F-modified nucleotide is a 2'-O-methyl-modified nucleotide.

[0268] In some cases, the guest chain contains at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphate-thioester modified nucleotide bonds. In some cases, the guest chain contains at least two, at least three, or at least four phosphate-thioester modified nucleotide bonds. In some cases, the guest chain contains at least one phosphate-thioester modified nucleotide bond. In some cases, the guest chain contains at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphate-thioester modified nucleotide bonds. In some cases, the guest chain contains one, two, three, four, five, six, seven, or eight phosphate-thioester modified nucleotide bonds. In some cases, the guest chain contains 1 to 8, 2 to 8, 3 to 8, 4 to 8, 5 to 8, or 6 to 8 phosphate-thioester modified nucleotide bonds. In some cases, the guest chain contains 1 to 4, 2 to 4, or 3 to 4 phosphate-thioester modified nucleotide bonds.

[0269] In some cases, the guest chain contains at least one, at least two, at least three, or at least four phosphate-thioester modified nucleotide bonds at the 5' end. In some cases, the guest chain contains at least one phosphate-thioester modified nucleotide bond at the 5' end. In some cases, the guest chain contains at least one, at least two, at least three, or at least four phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guest chain contains at least one phosphate-thioester modified nucleotide bond at the 3' end.

[0270] In some cases, the guest chain contains one phosphate-thioester modified nucleotide bond at the 5' end. In some cases, the guest chain contains two phosphate-thioester modified nucleotide bonds at the 5' end. In some cases, the guest chain contains three phosphate-thioester modified nucleotide bonds at the 5' end. In some cases, the guest chain contains four phosphate-thioester modified nucleotide bonds at the 5' end.

[0271] In some cases, the guest chain contains one phosphate-thioester modified nucleotide bond at the 3' end. In some cases, the guest chain contains two phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guest chain contains three phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guest chain contains four phosphate-thioester modified nucleotide bonds at the 3' end.

[0272] In some cases, the guest chain contains one phosphate-thioester modified nucleotide bond at the 5' end and one phosphate-thioester modified nucleotide bond at the 3' end. In some cases, the guest chain contains two phosphate-thioester modified nucleotide bonds at the 5' end and two phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guest chain contains three phosphate-thioester modified nucleotide bonds at the 5' end and three phosphate-thioester modified nucleotide bonds at the 3' end. In some cases, the guest chain contains four phosphate-thioester modified nucleotide bonds at the 5' end and four phosphate-thioester modified nucleotide bonds at the 3' end.

[0273] In some respects, this paper describes a specific modification pattern for a double-stranded polynucleotide molecule that includes a transit strand and a guide strand. In some cases, the guiding strand contains the nucleic acid sequence mFmmmXFmmmm FmFmFmmmmmmm, and the guest strand contains mmmmmmFmFmF mmmmmmmmmm, where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmXFmmmmFmFmmmmmmm-3', and the guest strand contains mmmmmmFmFmFmmmmmmmmmm, where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dA B), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmXFmmmmFmFmmmmmmm-3', and the guest strand contains 5'-mmmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmXFmmmmFmFmmmmmmm-3', and the guest strand contains 5'-mmmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0274] In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine Arin-3'-phosphate (TA), acyclic N-acetyl-L-threonol debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmXFmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0275] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-mmmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (AAP), and acyclic L-threonine nucleic acid-adenine-3'-phosphate (AAP). '-Phosphate (TA), acyclic N-acetyl-L-threonol debased nucleic acid-3' phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f) or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmF mFmFmmmmmmmm-3', and the guest strand contains 5'-mmmmmmFm FmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NA c), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmXmmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0276] In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine... Alcoholic nucleic acids - adenine-3'-phosphate (TA), acyclic N-acetyl-L-threonol debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmXmmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0277] In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-mmmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (ATP), and acyclic L-threonine nucleic acid-adenine-3'-phosphate (ATP). '-Phosphate (TA), acyclic N-acetyl-L-threonol debased nucleic acid-3' phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f) or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-mmmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains a nucleic acid sequence of 5'-mFmmmmFXmmmFmFmFmmmmmmm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debaseted nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0278] In some cases, the guiding strand contains the nucleic acid sequence 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine... Alcoholic nucleic acids - adenine-3'-phosphate (TA), acyclic N-acetyl-L-threonol debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), or 2-amino-2'-O-methyladenosine-3'-phosphate (a1). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmmmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, s is a phosphate thioester nucleotide bond, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn). In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmX'mmmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).In some cases, the guiding strand contains a nucleic acid sequence of 5'-msFsmmmmFXmmmFmFmFmmmmmsmsm-3', and the guest strand contains 5'-msmsmmmmFmFmFmmmX'mmmmmm-3', where m is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and X is selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), 1',2'-dideoxyribose-3'-phosphate (dAB), and thymidine-ethylene glycol nucleic acid (GNA) S-isomer (Tgn), and X' is 2-amino-2'-O-methyladenosine-3'-phosphate (a1).

[0279] Adhesion

[0280] Targeted portion

[0281] In some respects, the polynucleotide molecules described herein are coupled or conjugated with one or more targeting moieties to form polynucleotide-targeting moieties conjugate molecules. In some cases, the targeting moieties are selected based on their ability to selectively or preferably target the conjugate molecules described herein to a desired cell population, tissue, or organ. In some cases, the targeting moieties target cells, tissues, or organs that express a corresponding binding partner (e.g., a corresponding receptor or ligand) of the targeting moieties. For example, a polynucleotide molecule conjugated with N-acetylgalactosamine (GalNAc) can target hepatocytes expressing desialyl glycoprotein (ASGP-R). The hybrid polynucleotide constructs disclosed herein may include targeting moieties (i.e., intracellular targeting moieties) that target desired sites within the cell (e.g., the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria). Non-limiting examples of the intracellular targeting portion are provided in WO 2015 / 069932 and WO 2015 / 188197; the disclosure of the intracellular targeting portion in WO 2015 / 069932 and WO 2015 / 188197 is incorporated herein by reference.

[0282] Therefore, the polynucleotide molecules described herein may include one or more targeting moieties selected from intracellular targeting moieties, extracellular targeting moieties, and combinations thereof. Thus, including one or more targeting moieties (e.g., extracellular targeting moieties independently selected from folic acid, mannose, N-acetylgalactosamine, and prostate-specific membrane antigen) and one or more intracellular targeting moieties (e.g., moieties targeting the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecules described herein can facilitate the delivery of polynucleotides to specific sites within a specific cell population. In some aspects, the targeting moieties contain one or more mannose carbohydrates. The mannose targets the mannose receptor, a 175 kDa membrane-associated receptor expressed on hepatic sinusoidal cells and antigen-presenting cells (e.g., macrophages and dendritic cells). It is a highly efficient endocytosis / recycling receptor that binds to and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987; Taylor et al., J. Biol. Chem. 265:12156-62, 1990).

[0283] This article describes several targeting fractions. In some respects, the targeting fraction contains or specifically binds to proteins selected from the following: insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF; e.g., IGF 1 or 2), mesenchymal epithelial transforming factor receptor (c-met; also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), cytokinin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), and tumor necrosis factor receptor. (TNFR), Tumor necrosis factor α (TNF-α), TNF-β, Folate receptor (FOLR), Folate, Transferrin, Transferrin receptor (TfR), Mesothelin, Fc receptor, c-kit receptor, c-kit, Integrins (e.g., α4-integrin or β-1-integrin), P-selectin, Sphingosine-1-phosphate receptor-1 (S1PR), Hyaluronic acid receptor, Leukocyte functional antigen-1 (LFA-1), CD4, CD11, CD18, CD20, CD25, CD27 CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule 1 (VCAM1)), CD166 (activated leukocyte adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-associated apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin-1 (IL-1) The target portion contains IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, hepatic glycoprotein (Eph) receptor, mucosal addressin cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate-specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof. In a further aspect, the targeting portion contains erythroblastoma leukemia virus oncogene homolog (ErbB) receptors (e.g., ErbB1 receptor; ErbB2 receptor; ErbB3 receptor; and ErbB4 receptor). In some aspects, the targeting portion contains one or more (e.g., 1 to 6) N-acetylgalactosamine (GalNAc). In some aspects, the targeting portion contains one or more (e.g., 1 to 6) mannose. In other aspects, the targeting portion contains folic acid ligands. Folic acid ligands have the following structure:

[0284]

[0285] Some targeting moieties may include bufotin, gastrin, gastrin-releasing peptide, tumor growth factor (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non-peptide targeting moieties may also be used and may include, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include peptides such as somatostatin or somatostatin analogs (e.g., growth inhibitory peptide or lanreotide), bufotin, or antibodies or their antigen-binding fragments. Antibodies may be of any known class or subclass, such as IgG, IgA, IgM, IgD, or IgE. Typically, antibodies belonging to the IgG class are preferred. According to techniques known in the art, antibodies may be derived from any species. However, antibodies are typically human, mouse, or rabbit-derived. Furthermore, antibodies may be polyclonal or monoclonal, but are typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used for targeting moieties. Targeting moieties may include antigen-binding fragments of the antibody. Such antibody fragments may include, for example, Fab', F(ab')2, Fv or Fab fragments, single-domain antibodies, ScFv or other antigen-binding fragments. Fc fragments may also be used for targeting. These antibody fragments may be prepared, for example, by digestion with proteases, such as by pepsin or papain digestion, reductive alkylation, or recombinant techniques. The materials and methods used to prepare antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.

[0286] Other peptides used as targeting helper motifs in the polynucleotide molecules described herein may be selected from KiSS peptides and analogues, bony fish tension peptide II peptides and analogues, GnRH I and II peptides and analogues, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (leukocyte-stimulating peptide, e.g., P483H, which contains the heparin-binding region of platelet factor-4 (PF-4) and a lysine-rich sequence), atrial natriuretic peptide (ANP), β-amyloid peptide, delta-opioid antagonists (such as ITIPP (psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemokines (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK), GP... IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, apticides (P280 and P274), platelet-reactive protein receptors (including analogs such as TP-1300), bitistatin, pituitary adenylate cyclase type I receptor (PAC1), fibrin α-chain, peptides derived from phage display libraries, and their conserved alternatives.

[0287] One or more (e.g., 1 to 6) target portions can be connected via -LinkA- to MOIETY or X2 in formula (V', V”, or V”').

[0288] In some aspects, the targeting portion includes one or more (e.g., 1 to 6 or 1 to 3) desialyl glycoprotein receptor ligands (e.g., GalNAc). In some aspects, the desialyl glycoprotein receptor ligand (e.g., GalNAc) is attached to -LinkA- via an anomeric carbon (e.g., where the anomeric carbon is a carbon atom in an acetal or sesquiamine acetal). In some aspects, the desialyl glycoprotein receptor ligand (e.g., GalNAc) contains an anomeric carbon bonded to a trivalent, tetravalent, pentavalent, or hexavalent linker, wherein the anomeric carbon is part of a sesquiamine acetal group. Compared to hybrid polynucleotide constructs having desialyl glycoprotein receptor ligands (e.g., GalNAc) attached to linkers via sesquiamine acetals, desialyl glycoprotein receptor ligands (e.g., GalNAc) attached to linkers via acetals can produce hybrid polynucleotide constructs with better efficacy in gene silencing.

[0289] In some aspects, formula (V) shows a connector and three desialyl glycoprotein receptor targeting moieties, each containing GalNAc. In some cases, the conjugates described herein contain only one desialyl glycoprotein receptor targeting moieties, and therefore the conjugates comprise the structure of formula (V) with any two targeting moieties removed. In some cases, the conjugates described herein contain only two desialyl glycoprotein receptor targeting moieties, and therefore the conjugates described herein comprise the structure of formula (V) with any one targeting moieties removed.

[0290]

[0291] One of Y1 and Y2 is a nucleotide, or both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides from the polynucleotide molecule described herein.

[0292] In some aspects, the connector and targeting portion described herein are coupled to the 3' end of the transit chain (e.g., as shown in formula (V')). In some aspects, the connector and targeting portion described herein are coupled to the 5' end of the transit chain (e.g., as shown in formula (V”) or (V”')). In some aspects, the connector and targeting portion described herein are coupled to the 3' end of the guide chain (e.g., as shown in formula (V')). In some aspects, the connector and targeting portion described herein are coupled to the 5' end of the guide chain (e.g., as shown in formula (V”) or (V”')).

[0293]

[0294] In formula (V'), Z corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0295]

[0296] In formula (V”), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V”) is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0297]

[0298] In formula (V”'), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V”') is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0299]

[0300] In formula (V””), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V””) is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0301]

[0302] In formula (V””’), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V””’) is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0303]

[0304] In formula (V”””), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V”””) is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0305] In some cases, the 3' end of the transit chain (semantic chain) in Tables 1, 2, 3, or 4 is concatenated with X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), or (V”””)). In some cases, the 5' end of the transit chain (semantic chain) in Tables 1, 2, 3, or 4 is concatenated with X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), (V””’) or (V”””)). In some cases, the nucleic acids in the transit strand (sense strand) (not at the 5' and 3' ends) in Tables 1, 2, 3, or 4 are conjugated to X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), or (V”””)). In some cases, the 3' end of the guide strand (antisense strand) in Tables 1, 2, 3, or 4 is conjugated to X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), (V””’) or (V”””)). In some cases, the 5' end of the guide strand (antisense strand) in Tables 1, 2, 3, or 4 is conjugated to X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), or (V”””)). In some cases, the nucleic acid within the guide strand (antisense strand) in Tables 1, 2, 3, or 4 (not at the 5' and 3' ends) is conjugated to X2-GalNAc (see formulas (V), (V'), (V”), (V”’), (V””’), (V””’) or (V”””)).

[0306] One or more endosome escape portions (e.g., 1 to 6 or 1 to 3) may be attached as auxiliary portions to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. Exemplary endosome escape portions include chemotherapeutic agents described herein (e.g., quinolones such as chloroquine); fused lipids (e.g., dioleoylphosphatidylethanolamine (DOPE)); and polymers such as polyethyleneimine (PEI); poly(β-amino esters); polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains. For example, fusion peptides can be derived from the M2 protein of influenza A virus; peptide analogs of influenza virus hemagglutinin; the HEF protein of influenza C virus; transmembrane glycoproteins of filamentous viruses; transmembrane glycoproteins of rabies virus; transmembrane glycoprotein (G) of vesicular stomatitis virus; fusion proteins of Sendai virus; transmembrane glycoproteins of Semliki forest virus; fusion proteins of human respiratory syncytial virus (RSV); fusion proteins of measles virus; fusion proteins of Newcastle disease virus; fusion proteins of sheep exmyelinating virus; fusion proteins of murine leukemia virus; fusion proteins of HTL virus; and fusion proteins of simian immunodeficiency virus (SIV). Other components that can be used to facilitate endosome escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. For example, WO 2015 / 188197 provides endosome escape portions, including specific examples of portions suitable for conjugation with polynucleotide constructs disclosed herein; the disclosure of these endosome escape portions is incorporated herein by reference.

[0307] As described herein, one or more internal escape portions (e.g., 1 to 6 or 1 to 3) can be attached to MOIETY or X2 in formula (V', V”, V”', V””, V””' or V”””) via -LinkA-.

[0308] One or more cell-penetrating peptides (CPPs) (e.g., 1 to 6 or 1 to 3) may be attached as helper moieties to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. As disclosed herein, CPPs can be reversibly linked to the hybrid polynucleotides via disulfide bonds. Thus, upon delivery to a cell, CPPs can be cleaved intracellularly, for example by intracellular enzymes (e.g., protein disulfide isomerases, thioredoxins, or thioesterases), thereby releasing the polynucleotide.

[0309] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. DrugDeliv. 2, 43-51). For example, specific examples of CPPs including portions suitable for conjugation to polynucleotide constructs disclosed herein are provided in WO 2015 / 188197; the disclosure of such CPPs is incorporated herein by reference.

[0310] CPPs are positively charged peptides that facilitate the delivery of biological cargo into cells. The cationic charge of CPPs is believed to be crucial to their function. Furthermore, the transduction of these proteins appears to be independent of cell type, and they can be efficiently transduced in virtually all cultured cells without apparent toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have been successfully used to induce intracellular uptake of DNA (Abu-Amer, ibid.), antisense polynucleotides (Astriab-Fisher et al., Pharm.Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug.Chem. 11:762-71, 2000), and even inorganic 40 nm iron particles (Dodd et al., J.Immunol.Methods 256:89-105, 2001; Wunderbaldinger et al., Bioconjug.Chem. 13:264-8, 2002; Lewin et al., Nat.Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug.Chem. 10:186-91, 1999), demonstrating considerable flexibility in particle size during this process.

[0311] In one embodiment, the CPP that can be used in the methods and compositions described herein comprises a peptide characterized by significant α-helicality. Transfection has been found to be optimized when the CPP exhibits significant α-helicality. In another embodiment, the CPP comprises a sequence containing basic amino acid residues substantially aligned along at least one face of the peptide. The CPP described herein can be a natural or synthetic peptide.

[0312] As described herein, one or more cell-penetrating peptides (e.g., 1 to 6 or 1 to 3) can be attached via -LinkA- to MOIETY or X2 in the formula (V', V”, V”’, V””, V””’ or V”””).

[0313] The polynucleotide constructs and hybrid polynucleotide constructs disclosed herein may also include covalently attached auxiliary moieties based on neutral polymers. Neutral polymers include poly(C1-6 epoxy), such as poly(ethylene glycol) and poly(propylene glycol), and copolymers thereof, such as diblock and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyl oxazoline), poly(alkyl acrylate), poly(acrylamide), poly(N-alkylacrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymer auxiliary portions may have molecular weights less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.

[0314] As described herein, one or more polymers (e.g., 1 to 6 or 1 to 3) can be attached to MOIETY or X2 in the formula (V', V”, V”’, V””, V””’ or V”””) via -LinkA-.

[0315] splicing joint

[0316] In some respects, the polynucleotide molecules described herein comprise a transit strand or a guide strand bonded to at least one group of formula (I).

[0317]

[0318] Or its salt, or its stereoisomer,

[0319] in

[0320] Each X 1 It can be either O or S independently;

[0321] Each X 2 It can be independently of O, S, NH or a bond;

[0322] MOIETY is an optional substitution of C. 2-10 Alkane - tetramethyl or -M 1 -M 2 -M 3 -groups, where each M 1 and each M 3 C that does not exist independently or is arbitrarily substituted 1-6Alkylene, and M 2 C is an optional replacement 3-9 Heterocyclic tetramers, optionally substituted C 6-10 Aromatic - tetramethyl or optionally substituted C 3-8 Cycloalkanes - tetramethyl;

[0323] Each R 1 and each R 2 H independently, or C with optional substitution 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, conjugated moiety, or –LinkA (–T) p As long as at least one R 1 Or at least one R 2 It is a join part or –LinkA(–T) p That's all;

[0324] Each R 3 H independently, or C with optional substitution 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, optionally substituted C 2-16 alkenyl, optionally substituted C 2-16 alkynyl, optionally substituted (C 1-9 (heterocyclic group)-C 1-6 -alkyl, optionally substituted (C 6-10 (aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 cycloalkyl)-C 1-6 -alkyl, conjugated moiety, or –LinkA (–T) p ;

[0325] R 4 H, or C with optional substitution 1-6 Alkyl group, –LinkA (–T) p Or -Sol;

[0326] Each LinkA is independently a multivalent connector (e.g., including -C(O)-N(H)- (e.g., including at least one multivalent connector of -C(O)-N(H)- bonded to T));

[0327] Each T is an independent auxiliary part;

[0328] Sol is a solid support;

[0329] m is an integer from 1 to 6;

[0330] Each n is independently 0 or 1;

[0331] Each p is an independent integer from 1 to 6; and

[0332] q is an integer from 0 to 3.

[0333] At least one group of formula (I) may be bonded to the 5' end, 3' end, inter-nucleotide phosphate, inter-nucleotide thiophosphate, or inter-nucleotide dithiophosphate of the polynucleotide. When at least one group of formula (I) is bonded to an inter-nucleotide phosphate, inter-nucleotide thiophosphate, or inter-nucleotide dithiophosphate, q is 0. The polynucleotide construct contains no more than one Sol.

[0334] The -LinkA- group may comprise 0 to 3 polyvalent monomers (e.g., optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, or trivalent nitrogen atom) and one or more divalent monomers (e.g., 1 to 40), wherein each divalent monomer is independently an optionally substituted C1-6 alkylene; optionally substituted C2-6 alkenyl; optionally substituted C2-6 ynynyl; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenyl; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclic group having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(O)m, wherein m is 0, 1, or 2. In some respects, each monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclic group having 1 to 4 heteroatoms selected from N, O and S; an imino; an optionally substituted N; O; or S(O)m, wherein m is 0, 1 or 2 (e.g., m is 2). In some respects, each monomer is independently a optionally substituted C1-6 alkylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclic group having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted N; O; or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). The non-biologically reversible linker connecting the auxiliary portion to the conjugated portion or its reaction product may comprise 2 to 500 (e.g., 2 to 300 or 2 to 200) such monomers. The -LinkA- group may comprise poly(epoxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene oxide), polybutane oxide, poly(tetramethylene oxide), and their diblock or triblock copolymers). In some respects, non-biological reversible connectors include polyethylene oxide (e.g., poly(ethylene oxide) with a molecular weight of less than 1 kDa).

[0335] The –LinkA(–T)p group in formula (I) can be prepared by the process described in the following section. In some cases, –LinkA(–T)p is of formula (II):

[0336] –Q 1 –Q 2 ([–Q 3 –Q 4 –Q 5 ] s –Q 6 –T) p ,

[0337] (II)

[0338] in

[0339] Each s is an integer from 0 to 20 (e.g., 0 to 10), where repeating units may be the same or different;

[0340] Q 1 It is a splice joint (e.g., [–Q) 3 –Q 4 –Q 5 ] s –Q C –, where Q C C is an optional substitute 2-12 Heteroalkylene (e.g., heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O)2-N(H)-, or -N(H)-S(O)2-), optionally substituted C 1-12 Thioyl heterocyclic groups (e.g., ), optional replacement of C 1-12 Heterocyclic groups (e.g., 1,2,3-triazol-1,4-diyl or...) (), cyclobut-3-en-1,2-dione-3,4-diyl or pyridin-2-ylhydrazone);

[0341] If p is 1, then Q 2 It is a linear group (e.g., [–Q) 3 –Q 4 –Q 5 ] s –), or if p is an integer from 2 to 6, then Q 2 It is a branched group (e.g., [–Q) 3 –Q 4 –Q 5 ] s –Q 7 ([–Q 3 –Q 4 –Q 5 ] s –(Q 7 )p1 ) p2 (where p1 is 0 or 1, and p2 is 0, 1, 2, or 3);

[0342] Each Q 3 and each Q 6 Independently, it can be either non-existent, –CO–, –NH–, –O–, –S–, –SO2–, –OC(O)–, –COO–, –NHC(O)–, –C(O)NH–, –CH2–, –CH2NH–, –NHCH2–, –CH2O– or –OCH2–;

[0343] Each Q 4 Independently, C is non-existent or arbitrarily substituted. 1-12 Alkylene, optionally substituted C 2-12 alkenyl, optionally substituted C 2-12 Ethyne group, optionally substituted C 2-12 Heteroalkylene, optionally substituted C 6-10 aryl, optionally substituted C 1-9 heteroaryl or optionally substituted C 1-9 Sub-heterocyclic groups;

[0344] Each Q 5 Independently, -CO-, -NH-, -O-, -S-, -SO2-, -CH2-, -C(O)O-, -OC(O)-, -C(O)NH-, -NH-C(O)-, -NH-CH(R) a –C(O)– or –C(O)–CH(R) a )–NH–;

[0345] Each Q 7 C is independently optional substitution 1-6 Alkane-trimethyl, optional substituted C 1-6 Alkane-tetramethyl, optional substituted C 2-6 Heteroalkanes - trimethyl or optionally substituted C 2-6 Heteroalkanes-tetramethyl; and

[0346] Each R a It is independently an H or amino acid side chain;

[0347] As long as Q 3 Q 4 and Q 5 The presence of at least one of them is sufficient.

[0348] In some respects, each Q 4 Independently, C is non-existent or arbitrarily substituted. 1-12 Alkylene, optionally substituted C 2-12 alkenyl, optionally substituted C 2-12Ethyne group, optionally substituted C 2-12 Heteroalkylene or optionally substituted C 1-9 Sub-heterocyclic group. In some respects, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0349] Therefore, in equation (II), if each p1 is 0, then LinkA may include a single branch point, or if at least one p1 is 1, then LinkA may include multiple branch points.

[0350] In equation (II), Q 1 It can be –O–Q L –Q C –, where Q L C is an optional substitute 2-12 Heteroalkylene, optionally substituted C 1-12 Alkylene or - (optionally substituted C 1-6 Alkylene)-(optionally substituted C 6-10 (Aspartic) –. In some respects, Q L C is an optional substitute 2-12 Heteroalkylene or optionally substituted C 1-12 Alkylene. In formula (II), Q C It could be:

[0351]

[0352] In equation (II), Q 2 It can be the formula [–Q] 3 –Q 4 –Q 5 ] s – linear groups, where Q 3 Q 4 and Q 5 As defined in equation (II). Optionally, Q 2 It can be a branched group [–Q] 3 –Q 4 –Q 5 ] s –Q 7 ([–Q 3 –Q 4 –Q 5 ] s –(Q 7 ) p1 ) p2 , where each Q 7 C is independently optional substitution 1-6 Alkane-trimethyl, optional substituted C 1-6 Alkane-tetramethyl, optional substituted C2-6 Heteroalkanes - trimethyl or optionally substituted C 2-6 Heteroalkanes - tetramethyl;

[0353] in

[0354] p1 is 0 or 1;

[0355] p2 is 0, 1, 2, or 3;

[0356] in,

[0357] When p1 is 0, LinkA is a trivalent or tetravalent connector, and...

[0358] When p1 is 1, LinkA is a tetravalent, pentavalent, or hexavalent connector.

[0359] In some respects, p1 is 0.

[0360] In some respects, Q 7 yes:

[0361]

[0362] This document and WO 2015 / 188197 describe compounds that can be used to prepare the group -LinkA(-T)p of formula (I). Non-limiting examples of -LinkA include:

[0363]

[0364]

[0365]

[0366] in

[0367] R 18 It is the key with MOIETY.

[0368] Each R 19 It is a key independent of the auxiliary part.

[0369] Each m5 is an integer from 1 to 20.

[0370] Each m6 is an integer from 1 to 10 independently.

[0371] m7 is an integer from 1 to 6, and

[0372] Each X 6 It can be either O or S on its own.

[0373] In equation (II), when the splice joint is of equation [–Q] 3 –Q 4 –Q 5 ]s –Q C –when, –Q 2 ([–Q 3 –Q 4 –Q 5 ] s –Q 6 –T) p It could be:

[0374]

[0375]

[0376] in

[0377] R 20 Is with Q 1 Q in C The key, each R 19 Each m5 is an independent key to the auxiliary part, and each m5 is an integer from 1 to 20.

[0378] Each m6 is an integer from 1 to 10 independently.

[0379] m7 is an integer from 1 to 6, and

[0380] Each X 6 It can be either O or S on its own.

[0381] In some respects, the joint described herein is cuttable. In other respects, the joint described herein is not cuttable.

[0382] In some respects, the polynucleotide molecules described herein comprise a transit strand or a guide strand bonded to at least one group of formula (IV).

[0383]

[0384] At least one of Y1 or Y2 is a nucleotide in a polynucleotide molecule. In some cases, the linker is contained in formula (IV). In some cases, the linker of the last nucleotide at the 3' end of the transit strand of the polynucleotide molecule and the desialylated glycoprotein receptor targeting portion are shown in (V'), (V””), (V””’), or (V”””) as described herein.

[0385] In some cases, Y1 is the last nucleotide at the 3' end or the first nucleotide at the 5' end of one strand of a polynucleotide molecule. In some cases, Y1 is the last nucleotide at the 3' end or the first nucleotide at the 5' end of one strand of a polynucleotide molecule. In some cases, Y1 is the last nucleotide at the 3' end or the first nucleotide at the 5' end of one strand of a polynucleotide molecule, and Y2 is a 3-hydroxypropoxy group. In some cases, Y2 is the first nucleotide at the 5' end or the last nucleotide at the 3' end of one strand of a polynucleotide molecule. In some cases, Y2 is the first nucleotide at the 5' end or the last nucleotide at the 3' end of one strand of a polynucleotide molecule. In some cases, Y2 is the first nucleotide at the 5' end or the last nucleotide at the 3' end of one strand of a polynucleotide molecule, and Y1 is a 3-hydroxypropoxy group. In other cases, Y1 and Y2 are two consecutive nucleotides in one strand of a polynucleotide molecule.

[0386] In some aspects, the target portion described herein is concatenated with the 3' end of the transit chain (e.g., formula (IV')). In some aspects, the target portion described herein is concatenated with the 5' end of the transit chain (e.g., formula (IV") or (IV"')). In some aspects, the target portion described herein is concatenated with the 3' end of the guide chain (e.g., formula (IV')). In some aspects, the target portion described herein is concatenated with the 5' end of the guide chain (e.g., formula (IV") or (IV"')).

[0387]

[0388] In formula (IV'), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0389]

[0390] In formula (IV”), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (IV”) is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0391]

[0392] In formula (IV”'), Z is a part corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (IV”') is adenine, uracil, guanine, cytosine, thymine, debasement, etc.

[0393] In some aspects, a linker conjugated to one or more target portions, as shown in formula (IV”) or (IV”’), is added to the first nucleotide at the 5’ end. In some aspects, a linker conjugated to one or more GalNAc portions, as shown in formula (V”) or (V”’), is added to the first nucleotide at the 5’ end. In some aspects, the modification pattern comprises one or more phosphate thioester-modified nucleotide internucleotide bonds. In some aspects, the modification pattern is shown in formula (VII). In some aspects, 5’ end modifications known in the art are applied to one or more inverted nucleotides.

[0394] Pharmaceutical Composition

[0395] The delivery of the polynucleotide molecules described herein can be achieved by contacting cells with the construct using a variety of methods. In certain respects, the polynucleotide molecules described herein are formulated with a variety of excipients, mediators, and carriers, as described more fully elsewhere herein.

[0396] The pharmaceutical compositions described herein can be prepared into forms suitable for administration to a subject, including the hybridized polynucleotide constructs disclosed herein, using carriers, excipients, and mediators. Commonly used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk proteins, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol and solvents (such as sterile water), alcohols, glycerol, and polyols. Intravenous mediators include fluids and nutritional supplements. Preservatives include antimicrobial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable mediators include aqueous solutions, non-toxic excipients including salts, preservatives, buffers, etc., as described, for example, in Remington: The Science and Practice of Pharmacy, 21st edition, Gennaro, editor, Lippencott Williams & Wilkins (2005) and The United States Pharmacopeia: The National Formulary (USP 36NF31), published in 2013. The pH of the pharmaceutical composition and the precise concentrations of its various components are adjusted according to conventional techniques in the art. See Goodman and Gilman, *The Pharmacological Basis for Therapeutics*.

[0397] The pharmaceutical compositions described herein can be administered topically or systemically. The therapeutically effective dose will vary depending on a number of factors, such as the degree of infection in the subject, the individual's age, sex, and weight. Dosing regimens can be adjusted to provide the optimal therapeutic response. For example, several fractionated doses can be administered daily, or the dose can be reduced proportionally according to the urgency of the treatment situation.

[0398] Pharmaceutical compositions can be administered in convenient ways, such as by injection (e.g., subcutaneous, intravenous, intraoral, etc.), oral administration, ocular application, inhalation, topical application, or rectal administration. Depending on the route of administration, the pharmaceutical composition may be coated with a material to protect it from enzymes, acids, and other natural conditions that could inactivate it. Pharmaceutical compositions can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, mixtures thereof, and in oils. Under normal storage and use conditions, these formulations may contain preservatives to prevent microbial growth.

[0399] Suitable injectable pharmaceutical compositions include sterile aqueous solutions (in the case of water solubility) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. The compositions are typically sterile and fluid, to the extent that they are easy to inject. The compositions are typically stable under the conditions of production and storage, and preserved against contamination by microorganisms such as bacteria and fungi. The medium can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size (in the case of dispersions), and by using surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents are used in the compositions, such as sugars, polyols such as mannitol and sorbitol, or sodium chloride. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0400] A sterile injectable solution can be prepared by incorporating the desired amount of the pharmaceutical composition with one or a combination of the ingredients listed above into a suitable solvent as needed, followed by filtration and sterilization. Typically, a dispersion is prepared by incorporating the pharmaceutical composition into a sterile medium containing a basic dispersion medium and the other desired ingredients listed above.

[0401] For ease of administration and dosage uniformity, it is particularly advantageous to formulate parenteral compositions in unit dosage form. As used herein, unit dosage form refers to a physically discrete unit suitable as a unit dose for the target of treatment; each unit containing a predetermined amount of the pharmaceutical composition is calculated to combine with a desired drug carrier to produce the desired therapeutic effect. The specifications of the unit dosage form are related to the characteristics of the pharmaceutical composition and the specific therapeutic effect to be achieved. For convenient and effective administration, an effective amount of the main pharmaceutical composition is compounded with a suitable pharmaceutically acceptable carrier in acceptable unit dosage forms. In the case of compositions containing supplemental active ingredients, the dosage is determined by referring to the usual dosage and method of administration of the ingredient.

[0402] Pharmaceutical compositions can be administered orally, for example, in enteric-coated unit dosage forms, such as in a carrier. Pharmaceutical compositions and other ingredients can also be encapsulated in hard or soft-shell gelatin capsules or compressed into tablets. For oral therapeutic use, the pharmaceutical composition can be mixed with excipients and used in ingestible tablets, lozenges, capsules, pills, sheets, etc. Such compositions and formulations should contain at least 1% by weight of the active compound. Of course, the percentage of the composition and formulation can vary and can conveniently be between about 5% to about 80% by weight per unit. Tablets, lozenges, pills, capsules, etc., may also contain: binders such as gum arabic, gum arabic, corn starch, or gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch, potato starch, alginic acid, etc.; lubricants such as magnesium stearate; and sweeteners such as sucrose, lactose, or saccharin, or flavorings such as peppermint, wintergreen oil, or cherry flavoring. When the dosage unit form is a capsule, it may also contain a liquid carrier in addition to the materials of the types described above. Various other materials may be present as coatings or to otherwise alter the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. Syrups or elixirs may contain agents, sucrose as a sweetener, methylparaben and propylparaben as preservatives, dyes, and flavorings such as cherry or orange. Any material used to prepare any dosage unit form should have pharmaceutically acceptable purity and be substantially non-toxic at the amount used. Furthermore, pharmaceutical compositions may be incorporated into sustained-release formulations and formulations.

[0403] The pharmaceutical compositions described herein may comprise one or more permeation enhancers that promote the bioavailability of the polynucleotide molecules described herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are incorporated herein by reference in their entirety. In some aspects, the permeation enhancer is enteric. In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer facilitates crossing the blood-brain barrier. In some aspects, the permeation enhancer improves permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof. In some aspects, the permeation enhancer is a non-chelating non-surfactant or a derivative thereof. In some respects, the penetration enhancer is an ester or a derivative thereof. In some respects, the penetration enhancer is an ether or a derivative thereof. In some respects, the penetration enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, decanoic acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, didecanoate, tridecanoate, monooleate, dilaurin, 1-monodecanoate, 1-dodecylazine-2-one, acylcarnitine, acylcholine, or their monoglycerides, diglycerides, or pharmaceutically acceptable salts. In one specific respect, the penetration enhancer is sodium decanoate (C10). In some applications, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glutocholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidic acid, or sodium saccharide dihydrofusidic acid. In other applications, the permeation enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.

[0404] For the polynucleotide molecules described herein, suitable pharmaceutically acceptable salts include (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, and calcium, and polyamines such as spermine and spermidine; (ii) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid; and (iii) salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, and polygalacturonic acid.

[0405] Although the hybrid polynucleotide constructs described herein may not require the use of excipients for delivery to target cells, the use of excipients can be advantageous in some respects. Therefore, for delivery to target cells, the hybrid polynucleotide molecules described herein can nonvalently bind excipients to form complexes. Excipients can be used to alter post-delivery biodistribution, enhance uptake, increase the half-life or stability of the chains in the hybrid polynucleotide constructs (e.g., improve nuclease resistance), and / or increase targeting to specific cell or tissue types.

[0406] Exemplary excipients include condensing agents (e.g., agents capable of attracting or binding nucleic acids through ionic or electrostatic interactions); fusion agents (e.g., agents capable of fusing with and / or transporting across cell membranes); proteins targeting specific cell or tissue types (e.g., thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, or any other protein); lipids; lipopolysaccharides; lipid micelles or liposomes (e.g., formed from phospholipids such as phosphatidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any combination thereof); and nanoparticles (e.g., silica, lipids, carbohydrates). Compounds or other pharmaceutically acceptable polymer nanoparticles; polyplexes formed from cationic polymers and anionic agents (e.g., CROs), wherein exemplary cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine); cholesterol; dendritic polymers (e.g., polyamidoamine (PAMAM) dendritic polymers); serum proteins (e.g., human serum albumin (HSA) or low-density lipoprotein (LDL)); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclohexane). (purified or hyaluronic acid); lipids; synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-hydroxyacetic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, pseudopeptide-polyamine, or polyamine); cationic moieties (e.g., cationic lipids, Cationic porphyrins, quaternary salts of polyamines, or α-helical peptides; polyvalent sugars (e.g., polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose); vitamins (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, biotin, or pyridoxal); cofactors; or drugs that disrupt the cytoskeleton to increase uptake (e.g., paclitaxel, vincristine, vinblastine, pinocembrin, nocozol, japlakinolide, red sea sponge A, phalloidin, swinholide A, indanocine, or myoservin).

[0407] Other therapeutic agents as described herein may be combined with the polynucleic acid molecules described herein and included in the pharmaceutical compositions described herein.

[0408] Treatment

[0409] In some aspects, this document describes methods for regulating ANGPTL3 gene mRNA expression in subjects, including administering to subjects a polynucleotide molecule, a polynucleotide conjugate, or a pharmaceutical composition as described herein, thereby regulating ANGPTL3 gene mRNA expression in subjects. In other aspects, this document describes methods for preventing, alleviating, or treating ANGPTL3-associated diseases or their symptoms in subjects in need, including administering to subjects a polynucleotide molecule, a polynucleotide conjugate, or a pharmaceutical composition as described herein.

[0410] In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 10% or at least 10% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 20% or at least 20% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 30% or at least 30% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 40% or at least 40% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 50% or at least 50% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 60% or at least 60% compared to a negative control. In some aspects, the method described herein reduces ANGPTL3 gene expression in subjects by about 70% or at least 70% compared to a negative control. In some respects, the method described herein reduces ANGPTL3 gene expression in subjects by approximately 80% or at least 80% compared to a negative control. In some respects, the method described herein reduces ANGPTL3 gene expression in subjects by approximately 90% or at least 90% compared to a negative control. In some respects, the method described herein reduces ANGPTL3 gene expression in subjects by approximately 100% compared to a negative control.

[0411] In some aspects, this document describes methods for modulating ANGPTL3 protein levels in subjects with a need, including administering to the subject a polynucleotide molecule, a polynucleotide conjugate, or a pharmaceutical composition as described herein, wherein the polynucleotide molecule, polynucleotide conjugate, or pharmaceutical composition modulates the ANGPTL3 protein level in the subject. In some aspects, this document describes methods for preventing, alleviating, or treating ANGPTL3-related diseases or their symptoms in subjects with a need, including administering to the subject a polynucleotide molecule, a polynucleotide conjugate, or a pharmaceutical composition as described herein, wherein the polynucleotide molecule, polynucleotide conjugate, or pharmaceutical composition modulates the ANGPTL3 protein level in the subject.

[0412] In some other aspects, the methods described herein reduce ANGPTL3 activity levels in subjects by about 10% or at least 10% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 20% or at least 20% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 30% or at least 30% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 40% or at least 40% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 50% or at least 50% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 60% or at least 60% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 70% or at least 70% compared to a negative control. In some aspects, the methods described herein reduce ANGPTL3 levels in subjects by about 80% or at least 80% compared to a negative control. In some respects, the methods described herein reduce ANGPTL3 levels in subjects by approximately 90% or at least 90% compared to negative controls. In some respects, the methods described herein reduce ANGPTL3 levels in subjects by approximately 100% compared to negative controls.

[0413] In some respects, the methods provided herein include methods for preventing, alleviating, or treating ANGPLT3-related or associated diseases or symptoms in individuals. In some respects, ANGPLT3-related or associated diseases or symptoms include hyperlipidemia, coronary artery disease, vascular disease, severe hypertriglyceridemia, familial chylomicronemia syndrome (FCS), high fasting triglycerides on a restrictive low-fat diet, overweight or obesity, type 2 diabetes, dyslipidemia, cardiovascular disease, atherosclerosis, stroke, acute pancreatitis, atherosclerotic cardiovascular disease, atrial fibrillation, myocardial infarction, calcific aortic stenosis, cardiac arrest, or peripheral artery disease.

[0414] Example

[0415] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein. For all sequences presented below, the oligonucleotide structure representation is written from left to right (5' to 3'). Unless otherwise specified, monomer codes present in the oligonucleotide code are linked by 5'-3' phosphodiester bonds (followed by a 3' internucleotide bond when written from left to right). The abbreviations for the nucleotide monomers used in the oligonucleotide structure representation are as follows. “A” represents adenosine-3'-phosphate; “a” represents 2'-O-methyladenosine-3'-phosphate; “Af” represents 2'-fluoroadenosine-3'-phosphate; “dA” represents 2'-deoxyadenosine-3'-phosphate; “a1” refers to 2-amino-2'-O-methyladenosine-3'-phosphate; “C” represents cytidine-3'-phosphate; “c” represents 2'-O-methylcytidine-3'-phosphate; “Cf” represents 2'-fluorocytidine-3'-phosphate; “dC” represents 2'-deoxycytidine-3'-phosphate; “G” represents guanosine-3'-phosphate; “g” represents 2'-O-methylguanosine-3'-phosphate. "Gf" represents 2'-fluoroguanosine-3'-phosphate; "dG" represents 2'-deoxyguanosine-3'-phosphate; "U" represents uridine-3'-phosphate; "u" represents 2'-O-methyluridine-3'-phosphate; "Uf" represents 2'-fluorouridine-3'-phosphate; "u3" refers to 2'-O-methyl-2-thiouridine-3'-phosphate; "U3f" refers to 2'-fluoro-2-thiouridine-3'-phosphate; "dU" represents 2'-deoxyuridine-3'-phosphate; "T" represents 5-methyluridine-3'-phosphate; "t" represents 2'-O-methyl-5-methyluridine-3'-phosphate;

[0416] “Tf” represents 2'-fluoro-5-methyluridine-3'-phosphate; “dT” represents thymidine-3'-phosphate; “s” represents 3'-thiophosphate; “(TT)” refers to acyclic L-threonine nucleic acid-thymidine-3'-phosphate; “(TA)” refers to acyclic L-threonine nucleic acid-adenine-3'-phosphate; “(T-NAc)” refers to acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate; “(dAB)” refers to 1',2'-dideoxyribose-3'-phosphate; and “(Tgn)” refers to thymidine-ethylene glycol nucleic acid (GNA) S-isomer.

[0417] Example 1 - In vitro efficacy of siRNA targeting ANGPTL3

[0418] A set of siRNAs was generated (shown in Table 1), and each transit strand (sense strand) was conjugated to a three-branched GalNAc portion. These siRNA-GalNAc conjugates were evaluated in vitro in primary human hepatocytes.

[0419] Refrigerated primary human hepatocytes (PHH) were thawed and divided into 9 x 10⁻⁶ cells per well. 4 Cells were plated at a density in collagen-coated 96-well plates. Hepatocytes were treated with siRNAs (each passivating strand (sense strand) conjugated to a three-branched GalNAc portion) as shown in Table 1 for 48 hours in the absence of transfection reagents (free uptake). Cells were treated with either 10 μM or 0.5 μM siRNA. Untreated PHH was used as a negative control. siRNA targeting an unrelated gene (Ahsa1) was also used as a negative control. At the end of the incubation period, cells were lysed, mRNA was isolated, and the relative expression of the target gene was measured by branched DNA (bDNA) assay and normalized relative to the housekeeping gene human GAPDH using standard procedures. Each siRNA was run four times per dose level. Results of the in vitro potency of the siRNAs are shown in Table 5.

[0420] Example 2 - Drug response curve of selected ANGPTL3 siRNA

[0421] The selected group of siRNAs targeting ANGPTL3, as shown in Table 2, was used, with each transit strand (sense strand) conjugated to a three-branched GalNAc portion. For dose-response profiling, primary human hepatocytes were seeded at appropriate densities in 96-well plates. Using a similar experimental setup to that in Example 1, the siRNA-GalNAc conjugates were evaluated in primary human hepatocytes at 10 different doses. The corresponding drug response profiles are plotted in Table 7.

[0422] Example 3 - In vivo testing of ANGPTL3 siRNA in mice

[0423] The selected siRNAs or PBS shown in Table 3 were administered as a single subcutaneous dose to transgenic ANGPTL3 mice (n=6 per group), which were commercially available from Shanghai Model Organisms Center, Inc. (C57BL / 6-Angptl3). em2 (hANGPTL3)Smoc (cat#NM-HU-210036). The 3' end of the transient strand (sense strand) of each siRNA is conjugated to a three-branched GalNAc moiety (such as X2-GalNAc in formula (V')). The selected siRNA was administered at a single subcutaneous dose of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, catalog number DANL30) on day -4 (before administration) and on days 7, 14, 21, 28, 35, 42, 49, 56, and 63. For each individual, the percentage change in serum ANGPTL3 relative to the pre-administration value on day -4 was calculated. The group mean percentage change in serum hANGPTL3 protein levels from baseline on day -4 and the standard error are reported in Table 8. The results are plotted and shown in Figure 1 middle.

[0424]

[0425] Example 4 - In vivo testing of ANGPTL3 siRNA in mice

[0426] The selected siRNAs or PBS shown in Table 3 were administered as a single subcutaneous dose to transgenic ANGPTL3 mice (n=5 per group), which were commercially available from Shanghai Model Organisms Center, Inc. (C57BL / 6-Angptl3). em2 (hANGPTL3)Smoc (cat#NM-HU-210036). The 3' end of the transient strand (sense strand) of each siRNA is conjugated to a three-branched GalNAc moiety (such as X2-GalNAc in formula (V')). The selected siRNA was administered at a single subcutaneous dose of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, catalog number DANL30) on day -4 (before administration) and on days 7, 14, 21, 28, 35, 42, 49, 56, and 63. For each individual, the percentage change in serum ANGPTL3 relative to the pre-administration value on day -4 was calculated. The percentage change in group mean serum hANGPTL3 protein level from baseline on day -4 and the standard error are reported in Table 8. The results are plotted and shown in Figure 1The mean % change and standard error of serum hANGPTL3 protein levels from baseline on day -4 are reported in Table 9. The results are plotted and shown in... Figure 2 middle.

[0427]

[0428] Example 5 - In vivo testing of ANGPTL3 siRNA in mice

[0429] The selected siRNAs or PBS shown in Table 3 were administered as a single subcutaneous dose to transgenic ANGPTL3 mice (n=5 per group), which were commercially available from Shanghai Model Organisms Center, Inc. (C57BL / 6-Angptl3). em2 (hANGPTL3)Smoc (cat#NM-HU-210036). The 3' end of the transient strand (sense strand) of each siRNA is conjugated to a three-branched GalNAc moiety (such as X2-GalNAc in formula (V')). The selected siRNA was administered at a single subcutaneous dose of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, catalog number DANL30) on day-4 (before administration) and on days 7, 14, 21, and 28. For each individual, the percentage change in serum hANGPTL3 relative to the pre-administration value on day-4 was calculated. The mean percentage change and standard error of serum hANGPTL3 protein levels from baseline on day-4 are reported in Table 10. The results are plotted and shown in Figure 3 middle.

[0430]

[0431] Example 6 - In vivo testing of ANGPTL3 siRNA in mice

[0432] The selected siRNAs or PBS shown in Table 3 were administered as a single subcutaneous dose to transgenic ANGPTL3 mice (n=5 per group), which were commercially available from Shanghai Model Organisms Center, Inc. (C57BL / 6-Angptl3). em2 (hANGPTL3)Smoc(cat#NM-HU-210036). The 3' end of the transient strand (sense strand) of each siRNA is conjugated to a three-branched GalNAc moiety (such as X2-GalNAc in formula (V')). The selected siRNA was administered at a single subcutaneous dose of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, catalog number DANL30) on days -4 (before administration) and on days 7, 14, 21, 28, 35, and 42. For each individual, the percentage change in serum hANGPTL3 relative to the mean of the PBS group was calculated at each time point. The mean percentage change in serum hANGPTL3 protein levels relative to the PBS group and the standard error are reported in Table 11. The results are plotted and shown in Figure 4 middle.

[0433]

[0434] Example 7 - In vivo testing of ANGPTL3 siRNA in non-human primates (NHP)

[0435] The siRNA sequences used for non-human primate studies are specified in Table 4. The 3' end of each guest strand (sense strand) is conjugated to GalNAc via X2 (as in formula (V')). In this embodiment, SRS-001704 is used as a baseline or reference. Information regarding SRS-001704 is as follows:

[0436] ●Guided / Antonymous Structure Encoding: 5'-usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc-3' (SEQ ID NO: 886);

[0437] ●Guide / antisense base sequence: 5'-UACUGAUCAAAUAUGUUGAGC-3' (SEQ ID NO: 885);

[0438] ●Passenger / meaningful structure encoding: 5'-s(invAb)sgcucaacaUfAfUfuugaucaguas(invAb)–3' (SEQ ID NO: 888), and GalNAc is joined to the 5' end of the passenger chain via the form V”'; and

[0439] ●Passenger / sense base sequence: 5'–GCUCAACAUAUUUGAUCAGUA–3' (SEQ ID NO:887).

[0440] On day 1, male cynomolgus monkeys (n=4 per treatment group / siRNA) were administered a single subcutaneous injection of 2 mg / kg of the ANGPTL3 siRNA construct as shown in Table 4 or sterile isotonic saline. Blood samples were collected before administration and on days 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 92, 99, 113, 127, 141, and 155 and processed into serum. Circulating ANGPTL3 protein levels in all serum samples were analyzed using an ANGPTL3 ELISA assay (Thermo Fisher, catalog number: EH29RBX5). Results are expressed as the group mean of the % change in circulating ANGPTL3 protein for each individual relative to the time point before administration on day 1, as shown in Table 12 and... Figure 5 As shown in the figure. To assess the depth of ANGPTL3 mRNA silencing in liver tissue, ultrasound-guided liver biopsies were collected before drug administration (day -15) and on days 29, 57, and 85. At each time point, all samples were subjected to qPCR to measure ANGPTL3 mRNA, normalized relative to the ACTB housekeeping gene. ANGPTL3 mRNA expression relative to day -15 time point... Figure 6 Draw in the middle.

[0441] Example 8 - In vivo testing of ANGPTL3 siRNA in mice

[0442] The selected siRNAs or PBS shown in Table 3 were administered as a single subcutaneous dose to transgenic ANGPTL3 mice (n=5 per group), which were commercially available from Shanghai Model Organisms Center, Inc. (C57BL / 6-Angptl3). em2 (hANGPTL3)Smoc (cat#NM-HU-210036). The 3' end of the transient strand (sense strand) of each siRNA is conjugated to a three-branched GalNAc moiety (such as X2-GalNAc in formula (V')). The selected siRNA was administered at a single subcutaneous dose of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, catalog number DANL30) on days -4 (before administration) and on days 7, 14, 21, 28, and 35. For each individual, the percentage change in serum hANGPTL3 relative to the mean of the PBS group was calculated at each time point. The mean percentage change in serum hANGPTL3 protein levels relative to the PBS group and the standard error are reported in Table 13. The results are plotted and shown in Figure 7 middle.

[0443] While preferred aspects of this disclosure have been shown and described herein, it will be apparent to those skilled in the art that such aspects are provided by way of example only. Many variations, alterations, and substitutions will now occur to those skilled in the art without departing from this disclosure. It should be understood that various alternatives to the aspects of this disclosure described herein may be employed in the practice of this disclosure. The appended claims are intended to define the scope of this disclosure and thereby cover the methods and structures within the scope of these claims and their equivalents.

[0444] Table 1. siRNAs evaluated in vitro in primary human hepatocytes at 10 and 0.5 μM.

[0445]

[0446]

[0447]

[0448]

[0449]

[0450] Table 2. siRNAs evaluated in vitro at a 10 ppt dose in primary human hepatocytes

[0451]

[0452] Table 3. siRNAs selected for screening in vivo humanized mouse models

[0453]

[0454] Table 4. siRNAs selected for in vivo NHP screening

[0455]

[0456] Table 5. In vitro efficacy results of siRNA targeting ANGPTL3

[0457]

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467] Table 7. Results of in vitro dose-response of siRNA targeting ANGPTL3

[0468]

[0469]

[0470] Table 8. Results of % change in serum hANGPTL3 protein level

[0471]

[0472] Table 9. Results of % change in serum hANGPTL3 protein level

[0473]

[0474] Table 9 (continued)

[0475]

[0476] Table 10. Results of % change in serum hANGPTL3 protein level

[0477]

[0478] Table 10 (continued)

[0479]

[0480] Table 11. Results of % change in serum hANGPTL3 protein level

[0481]

[0482] Table 11 (continued)

[0483]

[0484] Table 12. Results of changes (%) in serum ANGPTL3 protein levels in cynomolgus monkeys

[0485]

[0486]

[0487] Table 13. Results of % change in serum hANGPTL3 protein level

[0488]

[0489] Table 13 (continued)

[0490]

Claims

1. A polynucleotide molecule for regulating the expression of the angiopoietin-like protein 3 (ANGPTL3) gene, wherein the polynucleotide molecule comprises the nucleic acid sequences in Table 1, Table 2, Table 3 or Table 4.

2. The polynucleotide molecule as described in claim 1, wherein the polynucleotide molecule is a single-stranded nucleic acid molecule.

3. The polynucleotide molecule of claim 2, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, or 18 consecutive nucleotides that are complementary to nucleic acid sequences selected from SEQ ID NO:401-596, 819-828, and 870-875 and have no more than 1, 2, 3, or 4 mismatches.

4. The polynucleotide molecule according to any one of claims 2-3, wherein the single-stranded nucleic acid molecule comprises a sequence that is complementary to at least 80%, at least 85%, at least 90%, or at least 95% of a nucleic acid sequence selected from SEQ ID NO:401-596, 819-828, and 870-875.

5. The polynucleotide molecule as described in claim 1, wherein the polynucleotide molecule is a double-stranded nucleic acid molecule comprising a transit strand and a guide strand.

6. The polynucleotide molecule of claim 5, wherein the passchain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO:401-596, 819-828, and 870-875.

7. The polynucleotide molecule according to any one of claims 5-6, wherein the guiding strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 1-196, 797-806, and 850-857.

8. The polynucleotide molecule according to any one of claims 5-7, wherein the passchain comprises at least 14, 15, 16, 17, 18, 19 or 20 consecutive sequences selected from SEQ ID NO:401-596, 819-828 and 870-875 and has no more than 1, 2, 3 or 4 mismatched nucleic acid sequences.

9. The polynucleotide molecule according to any one of claims 5-8, wherein the guiding strand comprises at least 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive sequences selected from SEQ ID NO: 1-196, 797-806 and 850-857 and has no more than 1, 2, 3 or 4 mismatched nucleic acid sequences.

10. The polynucleotide molecule according to any one of claims 5-9, wherein the passer strand comprises a nucleic acid sequence selected from SEQ ID NO:401-596, 819-828 and 870-875 and the guide strand comprises a nucleic acid sequence selected from SEQ ID NO:1-196, 797-806 and 850-857.

11. The polynucleotide molecule of claim 5, wherein the transit chain comprises a nucleic acid sequence having at least 90% or at least 95% identity with a nucleic acid sequence selected from Table 3 (SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828 and 870-875).

12. The polynucleotide molecule of any one of claims 5 or 11, wherein the guiding strand comprises a nucleic acid sequence having at least 90% or at least 95% identity with a nucleic acid sequence selected from Table 3 (SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806 and 850-857).

13. The polynucleotide molecule of any one of claims 5, 11, or 12, wherein the transit strand comprises a nucleic acid sequence selected from Table 3 (SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828, and 870-875) and the guide ...). The sequences of nucleic acid sequences of NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806 and 850-857.

14. The polynucleotide molecule according to any one of claims 1-13, wherein the polynucleotide molecule comprises (1) a 2'-fluorinated nucleotide; (2) a 2'-O-methylated nucleotide; (3) a 2'-deoxy nucleotide; or (4) a modified nucleotide inter-bond.

15. The polynucleotide molecule of any one of claims 1-14, wherein the polynucleotide molecule comprises at least two consecutive modified nucleotide inter-bonds at its 5' end.

16. The polynucleotide molecule of any one of claims 5-15, wherein the guide strand comprises at least two nucleotide inter-bonds at the 3' end that are replaced by modified nucleotide inter-bonds.

17. The polynucleotide molecule of any one of claims 5-16, wherein the guiding strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnNfnnnnnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnnnnnNfnNfnnnnnnnn-3' or 5'-nNfnnnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

18. The polynucleotide molecule of any one of claims 5-16, wherein the guest chain comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfnnnnnnnnnn-3' or 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

19. The polynucleotide molecule of any one of claims 5-16, wherein the guest strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3', wherein the guiding strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

20. The polynucleotide molecule of any one of claims 5-16, wherein the guest strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the guiding strand comprises 5'-nNfnnnNfnNfNfnnnnnnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

21. The polynucleotide molecule of any one of claims 5-16, wherein the guest strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the guiding strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

22. The polynucleotide molecule of any one of claims 5-16, wherein the guest strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the guiding strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

23. The polynucleotide molecule of any one of claims 5-16, wherein the guest strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the guiding strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoromodified nucleotide, and wherein "n" represents a 2'-O-methylmodified nucleotide.

24. The polynucleotide molecule according to any one of claims 14-23, wherein the modified nucleotide inter-bond is a phosphate thioester nucleotide inter-bond.

25. The polynucleotide molecule of claim 24, wherein the modified nucleotide inter-bond comprises stereochemically enriched phosphate thioester nucleotide inter-bonds.

26. The polynucleotide molecule according to any one of claims 5-25, wherein the guiding strand comprises a nucleotide analog selected from acyclic L-threonine nucleic acid-thymine-3'-phosphate (TT), acyclic L-threonine nucleic acid-adenine-3'-phosphate (TA), acyclic N-acetyl L-threonine debased nucleic acid-3'-phosphate (T-NAc), and 1',2'-dideoxyribose-3'-phosphate (dAB).

27. The polynucleotide molecule of claim 26, wherein the nucleotide analog is located in the seed region (positions 2-8) of the guiding strand starting from the 5' end.

28. The polynucleotide molecule of any one of claims 14-27, wherein the passchain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 601-796, 830-839, and 876-881.

29. The polynucleotide molecule of any one of claims 14-28, wherein the guiding strand comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleic acid sequence selected from SEQ ID NO: 201-396, 808-817, and 858-868.

30. The polynucleotide molecule of any one of claims 14-29, wherein the passer strand comprises a nucleic acid sequence selected from SEQ ID NO: 601-796, 830-839 and 876-881 and the guide strand comprises a nucleic acid sequence selected from SEQ ID NO: 201-396, 808-817 and 858-868.

31. The polynucleotide molecule according to any one of claims 1-30, wherein the polynucleotide molecule has a length of 19-25 nucleotides.

32. The polynucleotide molecule according to any one of claims 1-30, wherein the polynucleotide molecule has a length of 21-23 nucleotides.

33. A polynucleotide molecule for regulating the expression of the angiopoietin-like protein 3 (ANGPTL3) gene, wherein the polynucleotide molecule comprises: (a) A guide strand comprising nucleotide sequences selected from SEQ ID NO: 5, 7, 8, 11, 18, 20, 22, 40, 43, 44, 45, 46, 50, 52, 53, 56, 108, 109, 113, 114, 145, 146, 148, 153, 157, 158, 797-806 and 850-857, and a transit strand comprising nucleotide sequences selected from SEQ ID NO: 405, 407, 408, 411, 418, 420, 422, 440, 443-446, 450, 452, 453, 456, 508, 509, 513, 514, 545, 546, 548, 553, 557, 558, 819-828 and 870-875; (b) A guide strand comprising a nucleotide sequence selected from SEQ ID NO: 205, 207, 208, 211, 218, 220, 222, 240, 243-246, 250, 252, 253, 256, 308, 309, 313, 314, 345, 346, 348, 353, 357, 358, 808-817, and 858-868, and a strand comprising a nucleotide sequence selected from SEQ ID NO: 205, 207, 208, 211, 218, 220, 222, 240, 243-246, 250, 252, 253, 256, 308, 309, 313, 314, 345, 346, 348, 353, 357, 358, 808-817, and 858-868. Passenger chains of nucleotide sequences NO: 605, 607, 608, 611, 618, 620, 622, 640, 643, 644, 645, 646, 650, 652, 653, 656, 708, 709, 713, 714, 745, 746, 748, 753, 757, 758, 830-839, and 876-881; (c) A guide strand containing the nucleotide sequence usUfsaguuGfguuuCfgUfgAfuuuccscsa (SEQ ID NO:313) and a passer strand containing the nucleotide sequence gsgsaaauCfaCfgAfaaccaacuaa (SEQ ID NO:713); (d) A guide strand containing the nucleotide sequence usUfsagagUfauaaCfcUfuCfcauuususg (SEQ ID NO:346) and a guest strand containing the nucleotide sequence asasauggAfaGfgUfuauacucuaa (SEQ ID NO:746); (e) A guide strand containing the nucleotide sequence usAfsuggaUfcaacAfuUfuUfgguugsasu (SEQ ID NO:353) and a transit strand containing the nucleotide sequence csasaccaAfaAfuGfuugauccaua (SEQ ID NO:753); (f) A guide strand containing the nucleotide sequence usUfsaaggAfuuuaAfuAfcCfagauusasu (SEQ ID NO:358) and a passer strand containing the nucleotide sequence asasucugGfuAfuUfaaauccuuaa (SEQ ID NO:758); (g) a guide strand containing the nucleotide sequence usAfsuuagAfuugcUfuCfaCfuauggsasg (SEQ ID NO:308) and a guest strand containing the nucleotide sequence cscsauagUfgAfaGfcaaucuaaua (SEQ ID NO:708); (h) a guide strand containing the nucleotide sequence usUfsauagUfugguUfuCfgUfgauuuscsc (SEQ ID NO:314) and a transit strand containing the nucleotide sequence asasaucaCfgAfaAfccaacuauaa (SEQ ID NO:714); (i) a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuuusgsa (SEQ ID NO:345) and a transit strand containing the nucleotide sequence asasaaugGfaAfgGfuuauacucua (SEQ ID NO:745); (j) The guiding strand containing the nucleotide sequence usUfsaauuAfgauuGfcUfuCfacuausgsg (SEQ ID NO:309) and the transit strand containing the nucleotide sequence asusagugAfaGfcAfaucuaauuaa (SEQ ID NO:709); (k) A guide strand containing the nucleotide sequence usAfsauuaGfauugCfuUfcAfcuaugsgsa (SEQ ID NO:815) and a transit strand containing the nucleotide sequence csasuaguGfaAfgCfaaucuaauua (SEQ ID NO:837); (l) a guide strand containing the nucleotide sequence usUfsucauUfgaagUfuUfuGfugaucscsa (SEQ ID NO:812) and a transit strand containing the nucleotide sequence gsasucacAfaAfaCfuucaaugaaa (SEQ ID NO:834); (m) a guide strand containing the nucleotide sequence usAfsuugcUfucacUfaUfgGfaguausasu (SEQ ID NO:813) and a transit strand containing the nucleotide sequence asusacucCfaUfaGfugaagcaaua (SEQ ID NO:835); (n) a guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuucsgsa (SEQ ID NO:865) and a transit strand containing the nucleotide sequence gsasaaugGfaAfgGfuuauacucua (SEQ ID NO:879); or (o) A guide strand containing the nucleotide sequence usAfsgaguAfuaacCfuUfcCfauuccsgsa (SEQ ID NO:866) and a transit strand containing the nucleotide sequence gsgsaaugGfaAfgGfuuauacucua (SEQ ID NO:880), The lowercase "n" represents a nucleotide modified with 2'-O-methyl, the uppercase "f" (i.e., "Nf") represents a nucleotide modified with 2'-fluorine, and "s" represents a 3'-thiophosphate.

34. A polynucleotide conjugate for regulating the expression of the angiopoietin-like protein 3 (ANGPTL3) gene, wherein the polynucleotide conjugate comprises a polynucleotide molecule as described in any one of claims 1-33 and a desialylate glycoprotein receptor targeting moiety.

35. The polynucleotide conjugate of claim 34, wherein the polynucleotide molecule and the desialylate glycoprotein receptor targeting moiety are coupled via a linker.

36. The polynucleic acid conjugate of claim 35, wherein the linker comprises the following formula (IV), At least one of Y1 and Y2 is a nucleotide in the polynucleotide molecule.

37. The polynucleotide conjugate of claim 36, wherein Y1 is the last nucleotide at the 3' end of the transient chain of the polynucleotide molecule.

38. The polynucleotide conjugate of claim 36, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleotide molecule.

39. The polynucleotide conjugate according to any one of claims 34-38, wherein the desialylate glycoprotein receptor targeting portion comprises N-acetylgalactosamine (GalNAc).

40. The polynucleotide conjugate of any one of claims 34-39, wherein the linker of the last nucleotide at the 3' end of the transient chain of the polynucleotide molecule and the desialylate glycoprotein receptor targeting portion are as follows: In formula (V'), (V””), (V””’) or (V”””), Z is -H, -OH, -O-methyl, -F or -O-methoxyethyl, and R in formula (V'), (V””), (V””’) or (V”””) is adenine, uracil, guanine, cytosine, thymine, debasement or other.

41. A pharmaceutical composition comprising a polynucleotide molecule as described in any one of claims 1-33 or a polynucleotide molecule conjugate as described in any one of claims 34-40, and a pharmaceutically acceptable excipient.

42. The pharmaceutical composition of claim 41, wherein the pharmaceutical composition is formulated as a nanoparticle formulation.

43. The pharmaceutical composition of any one of claims 41 or 42, wherein the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

44. A method for regulating the expression of angiopoietin-like protein 3 (ANGPTL3) gene mRNA in a target, comprising: The mRNA expression of the ANGPTL3 gene in the subject is regulated by administering the polynucleotide molecule as described in any one of claims 1-33, or the polynucleotide molecule conjugate as described in any one of claims 34-40, or the pharmaceutical composition as described in any one of claims 41-43.

45. A method for preventing, alleviating, or treating ANGPTL3-associated diseases or their symptoms in individuals of need, comprising: Applying a polynucleotide molecule as described in any one of claims 1-33, a polynucleotide molecule conjugate as described in any one of claims 34-40, or a pharmaceutical composition as described in any one of claims 41-43 to the subject to prevent, alleviate, or treat ANGPTL3-related disease or its symptoms in the subject.

46. ​​The method of claim 45, wherein the ANGPTL3-associated disease or its symptoms include hyperlipidemia.

47. The method of claim 45, wherein the ANGPTL3-associated disease or its symptoms include atherosclerosis, coronary heart disease, or vascular disease.

Images