Application of RAB6B as target spot in prevention and / or treatment of metabolic dysfunction related steatohepatitis

By targeting the RAB6B gene, drugs have been developed to address the treatment challenges of metabolic dysfunction-related steatohepatitis, improve lipid metabolism in the liver and related systems, reduce lipids in serum and liver, decrease fat accumulation, and provide an effective treatment approach.

CN120960431APending Publication Date: 2025-11-18NANJING DRUM TOWER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511097536.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-06
Publication Date
2025-11-18

Smart Images

  • Figure HDA0005535856700000011
    Figure HDA0005535856700000011
  • Figure HDA0005535856700000012
    Figure HDA0005535856700000012
  • Figure HDA0005535856700000021
    Figure HDA0005535856700000021
Patent Text Reader

Abstract

The invention discloses application of RAB6B as a target spot in prevention and / or treatment of metabolic dysfunction related steatohepatitis. Specifically, the invention discloses the change and the effect of the Ras-related protein RAB6B (Ras-related protein Rab-6B, RAB6B) in the morbidity process of the metabolic dysfunction related fatty liver disease (MASLD) for the first time, and clarifies the influence of the RAB6B on liver lipid metabolism, so as to explore a potential target spot for the treatment of the MASLD. Experiments prove that knock-down of RAB6B can effectively improve the liver and system lipid metabolism disorder condition induced by high fat diet.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the application of RAB6B as a target point in the prevention and / or treatment of metabolic dysfunction-associated steatohepatitis, belonging to the field of biological medicine. BACKGROUND

[0002] Metabolic dysfunction-associated fatty liver disease (MAFLD) and its more severe form, metabolic dysfunction-associated steatohepatitis (MASH), is the most common chronic liver disease worldwide, with a global prevalence of about 38%. With the prevalence of obesity and type 2 diabetes worldwide, it is expected that the global prevalence of MASLD will continue to rise in the next decade. As a more severe pathological subtype of MASLD inflammation, MASH is accompanied by liver steatosis, inflammation and hepatocyte swelling (ballooning), with or without fibrosis, and is becoming one of the main factors leading to cirrhosis, cirrhosis complications, hepatocellular carcinoma and liver-related deaths. However, its underlying molecular mechanisms have not been fully elucidated, and there is currently no specific treatment drug approved for the disease. The U.S. FDA approved the first drug, Resmetirom, to treat MASH fibrosis in March 2024. Given the heavy epidemiological burden of MASH, existing clinical treatment methods are still difficult to meet the actual needs. In addition, the high price of Resmetirom limits its clinical application, and its long-term efficacy also needs to be further clarified. Therefore, the clinical treatment needs of MASH are far from being met, and it is urgent to further analyze its pathogenesis to improve prevention and treatment strategies.

[0003] The RAB protein family is a small GTPase belonging to the Ras superfamily, which functions as a molecular switch through the conversion between GTP and GDP binding forms, and precisely regulates the budding, formation, transport, anchoring and fusion of vesicles, and is involved in the occurrence and development of various human diseases, such as Marfan syndrome and Parkinson's disease. Studies have reported that RAB8A can regulate the fusion and growth of lipid droplets in adipocytes. In addition, there are also various RAB proteins in the lipid droplets of adipocytes, such as RAB1A. Based on these findings, it is speculated that more RAB proteins may be involved in the formation and regulation of lipid droplets in adipocytes. At the same time, RAB8A also plays an important role in skeletal muscle cells, which regulates the fusion of lipid droplets in skeletal muscle cells and the uptake process of long-chain fatty acids. In skeletal muscle, RAB8A acts as a mitochondrial receptor and can form a tethering complex with perilipin (PLIN) 5, which can recruit adipose triglyceride lipase (ATGL), thereby promoting lipid degradation. The above studies show that RAB proteins play an important regulatory role in the uptake of fatty acids and the maintenance of lipid droplet homeostasis in adipose tissue and skeletal muscle. In addition, another study shows that selective inhibition of RAB24 in the liver can improve liver steatosis by increasing autophagic flux and mitochondrial fusion, and reduce serum glucose and cholesterol levels. Nutritional excess can up-regulate RAB2A protein expression by inhibiting the AMPK-TBC1D1 functional axis, increase PPARγ protein stability, and thus promote the pathological progression of MAFLD. In particular, the Liang Chen group has also confirmed that RAB6B participates in the MAFLD process by mediating lipid droplet-Golgi interaction, thereby promoting the lipidation and secretion of very low density lipoprotein (VLDL) in hepatocytes. These studies suggest that Rab proteins may have a function of regulating hepatic glucose and lipid metabolism. SUMMARY

[0004] The purpose of the present application is to provide the application of RAB6B as a target in preventing and / or treating metabolic dysfunction-related steatohepatitis and a drug for preventing and / or treating metabolic dysfunction-related steatohepatitis.

[0005] Technical scheme: The application of RAB6B as a target in preventing and / or treating metabolic dysfunction-related steatohepatitis.

[0006] Further, the application specifically refers to the application of a reagent for knocking out, silencing or inhibiting RAB6B gene expression in the preparation of a drug for preventing and / or treating metabolic dysfunction-related steatohepatitis.

[0007] Further, the drug further comprises a pharmaceutically acceptable excipient.

[0008] Further, the drug can improve the liver and systemic lipid metabolism disorder.

[0009] Further, the drug can reduce TG and TC in serum, and TG in liver.

[0010] Further, the drug can reduce the volume of eWAT fat and iWAT fat.

[0011] Further, the reagent includes a carrier for knocking out, silencing or inhibiting the RAB6B gene.

[0012] The drug for preventing and / or treating metabolic dysfunction-associated steatohepatitis can reduce the expression level of the RAB6B gene.

[0013] Further, the drug includes a carrier for knocking out, silencing or inhibiting the RAB6B gene.

[0014] Beneficial effects: Compared with the prior art, the present application has the following obvious advantages: the present application first discloses the change and role of Ras-related protein RAB6B (Ras-related protein Rab-6B, RAB6B) in the pathogenesis of metabolic dysfunction-associated steatotic liver disease (MASLD), and clarifies the influence of RAB6B on liver lipid metabolism, so as to explore potential targets for the treatment of MASLD. And it is verified through experiments that knocking down RAB6B can effectively improve the liver and systemic lipid metabolism disorder induced by high-fat diet. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 is that the expression of Rab6B in the lipid accumulation cell model is increased.

[0016] Figure 2 is that the expression of RAB6B in the liver tissue of high-fat-induced mice is increased.

[0017] Figure 3 is that the expression of RAB6B in the liver tissue of human MSAH is increased.

[0018] Figure 4 is that knocking down RAB6B can reduce lipid accumulation in the lipid accumulation cell model.

[0019] Figure 5 is that knocking down Rab6b can improve the liver lipid accumulation of MASH mice. DETAILED DESCRIPTION

[0020] The technical solutions of the present application will be further described below in combination with the drawings.

[0021] The experimental methods described in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions, unless otherwise specified. The materials, reagents, etc. described in the following examples can be obtained commercially, unless otherwise specified. In the following examples, the experimental methods of Western blotting, hematoxylin-eosin staining, and immunohistochemical analysis are all conventional experimental methods known to those skilled in the art, and the experimental methods are generally performed according to conventional conditions, unless otherwise specified.

[0022] Experimental drugs and reagents:

[0023] DMEM medium (Kaiji Biological), DMEM / F-12 medium (Thermo, USA), Opti-MEM medium (Thermo, USA), fetal bovine serum (FBS, Thermo, USA), bovine insulin-transferrin-selenium mixed solution cell supplement (ITS supplement, Biyun Tian), dexamethasone (Biyun Tian), fat-free bovine serum albumin (BSA, Biyun Tian), sodium oleate (OA, merck, Germany), sodium palmitate (PA, merck, Germany), Trizol lysis solution (Nanjing Novozyme), RIPA lysis solution (Biyun Tian), phenylmethylsulfonyl fluoride (PMSF, Biyun Tian), HiScript III RT SuperMix for qPCR kit (Nanjing Novozyme), SYBR qPCR Master Mix kit (Nanjing Novozyme), BCA protein quantification kit (Jiangsu Kaiji Biological), triglyceride (TG) detection kit (Nanjing Jiancheng), total cholesterol (TC) detection kit (Nanjing Jiancheng), oil red O staining solution (Solabio), hematoxylin staining solution (Solabio), RAB6B antibody (Proteintech), β-ACTIN antibody (Proteintech), siRAB6B, Lipo3000 (Thermo, USA), AAV8-Rab6b virus (Jimabio), high-fat feed (Beijing Boaigang)

[0024] Primer:

[0025] RAB6B(Human) Forward: CTCTTTCGACGTGTAGCAGCAG (SEQ ID NO. 1)

[0026] RAB6B(Human) Reverse: AGGAACAGCCTCCTTCACTGAC (SEQ ID NO. 2)

[0027] RAB6B (Human) Forward: AGACGGACCTGGCTGATAA (SEQ ID NO. 9)

[0028] RAB6B (Human) Reverse: GCTGTAACAGGAGGAGGAGG (SEQ ID NO. 10)

[0029] β-ACTIN (Human) Forward: CACCATTGGCAATGAGCGGTTC (SEQ ID NO. 5)

[0030] β-ACTIN (Human) Reverse: AGGTCTTTGCGGATGTCCACGT (SEQ ID NO. 6)

[0031] β-Actin (Mouse) Forward: CATTGCTGACAGGATGCAGAAGG (SEQ ID NO. 7)

[0032] β-Actin (Mouse) Reverse: TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO. 8)

[0033] siRNA sequence: RAB6B (Human): AGACGGACCTGGCTGATAA (SEQ ID NO. 9)

[0034] shRNA sequence: RAB6B (mouse): CGGGATTGACTTCTTGTCAAA (SEQ ID NO. 10)

[0035] Experimental cells:

[0036] Human hepatoma cell line HepG2 cells, human normal liver cell line L02 cells, and murine normal liver cell line AML-12 cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0037] HepG2 and L02 culture conditions: DMEM medium + double antibody + 10% FBS.

[0038] AML-12 culture conditions: 44.5 ml DMEM / F12 medium + 5 mL serum + 0.5 mL ITS supplement + 50 μL dexamethasone (1 mg dexamethasone dissolved in 25 mL anhydrous ethanol to obtain a 1000 x 40 μg / mL stock solution).

[0039] Experimental animals:

[0040] C57BL / 6J mice: 6-7 weeks old, provided by Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. The animal feeding conditions: room temperature 18-20℃, humidity 50-60%, light and dark alternation (12h), moderate light, good ventilation and cleanliness. All experiments were approved and conducted in accordance with the guidelines of the Ethics Committee of the Dermatology Hospital of the Chinese Academy of Medical Sciences (Dermatology Research Institute of the Chinese Academy of Medical Sciences).

[0041] Experimental human liver tissue samples:

[0042] Surgical resection samples: Human liver tissue was obtained from the Department of General Surgery of Nanjing Drum Tower Hospital. The human liver tissue samples were obtained in accordance with the relevant regulations of the National Ethics Committee, with informed consent procedures, and were approved by the Medical Ethics Committee of Drum Tower Hospital Affiliated to Medical College of Nanjing University (Approval No.: 2024-111-02). All samples were anonymized and could not be traced back to the donor's identity information.

[0043] Example 1: Expression of Rab6B in lipid accumulation cell model.

[0044] 1. Preparation of FFA: (1) 5% BSA DMEM solution: weigh 1500 mg of BSA into a 50 mL centrifuge tube, add appropriate amount of DMEM medium, vortex to mix, centrifuge at 4000 rpm at room temperature for 5 min, remove the foam, and add DMEM to 30 mL to obtain 5% BSA. Place at 55°C for 30 min. (2) OA stock solution (50 mM): weigh 152.22 mg of OA into a 15 mL centrifuge tube, add 10 mL of ultrapure water, vortex to mix, and place in a 37°C water bath for 30 min to dissolve and obtain 50 mM OA stock solution. (3) Palmitic acid (PA) stock solution (50 mM): weigh 139.205 mg of PA into a 15 mL centrifuge tube, add 10 mL of ultrapure water, vortex to mix, and place in a 70°C water bath for 30 min to dissolve and obtain 50 mM PA stock solution. (4) FFA stock solution (5 mM, OA: PA = 2:1): quickly add 2 mL of OA (50 mM) and 1 mL of PA (50 mM) stock solution into 27 mL of DMEM medium containing 5% BSA (without free fatty acids), shake well to prepare the FFA (5 mM) stock solution, filter sterilize with a 0.22 μm filter, and store at 4°C for future use.

[0045] 2. Cell FFA modeling: Use complete medium to dilute 5 mM FFA to 1 mM FFA working solution for cell modeling. Dilute 5 mL of 5 mM FFA stock solution to 50 mL with complete medium to obtain 1 mM FFA working solution. The final concentration of FFA in the medium is 1 mM. 5cells / mL density inoculation, inoculation into the well plate, and FFA modeling was performed after the cells grew to 40%-50% density. The old culture medium was discarded, washed with sterile PBS for 2-3 times, and an appropriate amount of 1 mM FFA was added, and transferred to CO 2 Incubate in the incubator for 12h, 24h, 36h respectively to establish the lipid accumulation cell model. Human hepatoma cell line HepG2 cells, human normal liver cell line L02 cells, and murine normal liver cell line AML-12 were subjected to FFA modeling.

[0046] 3. RT-qPCR:

[0047] Extraction of total RNA: (1) Wash the cells with PBS for 2 times, add an appropriate amount of Trizol to lyse the cells for 5 min, and then transfer to a 1.5 mL enzyme-free EP tube. (2) Add 200 μL chloroform to the EP tube, shake well, and then place on ice for 10 min. Centrifuge at 4°C, 13000 rpm for 15 min. (3) After centrifugation, carefully transfer 500 μL supernatant to a new enzyme-free 1.5 mL EP tube, add 500 μL isopropanol, mix well, and then place on ice for 10 min. Then centrifuge at 4°C, 13000 rpm for 15 min. (4) Discard the upper liquid, and the RNA precipitate remains at the bottom of the tube. At this time, add 1 mL of prepared 75% ethanol (absolute ethanol: enzyme-free water = 3:1) to the tube, gently invert the EP tube to resuspend the RNA, and then centrifuge at 4°C, 13000 rpm for 15 min. (5) After centrifugation, try to discard the supernatant as much as possible, leaving only the white precipitate at the bottom. Dry at room temperature until the white precipitate turns transparent. Then dissolve the RNA precipitate with an appropriate amount of enzyme-free water. (6) Measure the concentration of the dissolved RNA solution using a ultramicro spectrophotometer, and then perform reverse transcription.

[0048] In this study, HiScript III RT SuperMix for qPCR kit (Nanjing Novozyme) was used for reverse transcription. Then SYBR qPCR Master Mix kit (Nanjing Novozyme) was used for real-time fluorescent quantitative PCR (RT-qPCR) of Rab6b.

[0049] 4. Western-Blot:

[0050] Protein extraction: (1) Take the cells out of the incubator, wash twice with PBS, then add RIPA lysis buffer (PMSF is added in RIPA in advance at a ratio of 1:100), 600 μL is added to a 60 mm dish, so that the RIPA fully covers the surface of the cells, and the cells are lysed on ice for 10 min. Scrape the cells with a cell scraper, transfer to a 1.5 mL enzyme-free EP tube, and vortex thoroughly on a vortexer. Then, centrifuge at 12000 rpm for 15 min at 4°C, and the supernatant is the total protein of the cells. The extracted protein is quantified using the BCA method (BCA protein quantification kit, Biyun Tian). Add one-fourth volume of 5x Loading Buffer to the obtained total protein, mix well, and boil the protein on a metal bath at 100°C for 5-10 min to denature the protein for subsequent SDS-PAGE electrophoresis.

[0051] The treated sample is subjected to electrophoresis in an 8% SDS-PAGE separation gel. The program is set as follows: constant voltage 80V for about 30 min; adjust the voltage to 120V for 60 min until the indicator approaches the edge of the gel bottom. After electrophoresis, the protein is transferred to a membrane. Finally, develop by ECL luminescence.

[0052] The results, as shown in Figure 1 , the gene and protein expression of RAB6B in the FFA-treated lipid accumulation cell model are increased.

[0053] Example 2: Expression of RAB6B in mouse liver tissue induced by high fat

[0054] Take 6-7 week old C57BL / 6J male mice, and randomly divide them into a control group and an experimental group according to body weight, with 6 mice in each group. The control group is given ordinary feed, and the experimental group is given high-fat feed HFD. After 4 weeks and 8 weeks of feeding, the mice are euthanized, and the mouse liver tissue is taken for liver RAB6B immunohistochemistry.

[0055] Western blot analysis: weigh about 20 mg of liver tissue into a grinding tube, add two grinding steel balls, and add 1 mL of RIPA (containing PMSF). Transfer to a grinder and grind. After grinding, centrifuge at 12000 rpm for 15 min at 4°C, and the supernatant is the total protein of the liver tissue. Then perform Western blot analysis.

[0056] The results, as shown in Figure 2 , the expression of RAB6B in the liver of HFD-fed mice is significantly increased compared to wild-type mice.

[0057] Example 3: Expression of RAB6B in human MSAH liver tissue

[0058] Take human liver tissue for immunohistochemical analysis. (1) Antigen repair: transfer the section to 0.01M sodium citrate buffer solution (pH 6.0), heat repair antigen in microwave oven (avoid over drying). After cooling, place in PBS, wash on a shaker 3 times, 5 min each time. (2) Block endogenous peroxidase: add 3% hydrogen peroxide to it, room temperature, avoid light for 25 min, add PBS to wash on a shaker 3 times, 5 min each time. (3) Serum blocking: add 3% BSA in the group analysis ring, block for 30 min. (The first antibody is rabbit serum of goat origin, and others are blocked with BSA) (4) Add primary antibody: remove the blocking solution, add the prepared primary antibody to the section, and place it in a wet box for incubation at 4°C overnight. (5) Add secondary antibody: add PBS to the slide, wash 3 times, 5 min each time. After shaking the section, add the corresponding species of secondary antibody (HRP labeled) in the ring, incubate for about 1 h. (6) DAB color development: wash the slide on a shaker 3 times, 5 min each time. After shaking the section, add DAB color developing solution in the ring, after a period of time, use tap water to terminate the color development. (7) Stain the cell nucleus: after staining with hematoxylin for 3 min, wash with water, differentiate with hematoxylin differentiation solution for a few seconds, then wash with water, and return to blue with hematoxylin return to blue solution, then wash with water. (8) Dehydration and mounting: place the section in 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, xylene I for 5 min, and then dehydrate and clear. Take the section out of xylene and dry slightly, mount with mounting medium. (9) Microscopy: place under a microscope for result interpretation.

[0059] The results are shown in Figure 3 Compared with normal human liver tissue, the expression of RAB6B in human MASH liver tissue was significantly increased.

[0060] Example 4: Investigation of the effect of intracellular knockdown of RAB6B on lipid accumulation

[0061] HepG2 cells and L02 cells were inoculated in 12-well plates at about 20-70 million cells per well, and when the cells grew to about 30-50%, the old DMEM culture medium was discarded, the cells were washed with sterile PBS for 3 times, and 1 mL of fresh culture medium was added to each well. Solution A: 5 μL siRNA (10 μM) + 100 μL Opti-MEM medium, and gently blow mixed with a gun. Solution B: 2 μL Lipo3000 + 100 μL Opti-MEM medium, and gently blow mixed with a gun. Solution A+B (siRNA-Lipo3000): After the A solution and the B solution were respectively room temperature for 5 min, the A solution was gently added to the B solution, and the centrifuge tube was gently inverted or gently blow mixed with a gun, and room temperature was allowed to stand for 10-20 min. Then the prepared siRNA-Lipo3000 complex was added to the cell culture medium, and the cross shaking was performed. After being transferred to the cell culture box and cultured for 4-6 h, the culture medium was discarded, and the complete culture medium was added for continuous culture for 48 h. The old culture medium was discarded, washed with PBS for 2-3 times, and then 1 mM of FFA was added for continuous culture for 24 h. The cells were stained with oil red O staining solution (cell special) kit (Biyun Tian), and observed under a microscope.

[0062] The experimental results are shown in Figure 4 RAB6B knockdown can reduce lipid accumulation in a lipid accumulation cell model.

[0063] Example 5: Effect of RAB6B knockdown on liver lipid accumulation in MASH mice

[0064] 6-7 week-old C57BL / 6J male mice were randomly divided into 2 groups according to body weight after adaptive feeding for one week: control group (n=7), Rab6b knockdown group KD (n=8). The tail vein injection method was used to give the Rab6b knockdown group AAV8-Rab6b virus (1.5×10 11 vg per mouse), and each group was given free drinking water and high-fat feed. After 26 weeks of feeding, the mice were euthanized. The whole blood of the mice was taken by periorbital blood sampling method into an EP tube, and was allowed to stand at room temperature for 2 h, and was centrifuged at 8000 rpm for 15 min. The supernatant was taken, and the content of TG and TC in the serum was determined according to the method in the kit.

[0065] The liver tissue of the mice was taken after euthanasia.

[0066] The liver tissue of the mice was taken for western-blot analysis.

[0067] Take the mouse liver tissue to determine the content of TG and TC: take about 20g, according to the weight(g): volume(mL) = 1:9 ratio of 9 times the volume of anhydrous ethanol, mechanical homogenate 2500rpm centrifugation 10min, take supernatant, according to the method of kit to determine the content of TG and TC in mouse liver tissue.

[0068] Take the mouse liver tissue to H&E staining.

[0069] Take the mouse liver tissue to oil red O staining: take the mouse liver tissue block with OCT embedding, using a freezing microtome to slice, use the adhesion glass slide to paste the slice, room temperature drying 5min. The glass slide pasted frozen section in distilled water, gently rinse, then put into 60% isopropanol immersion wash 20s, then put into oil red O staining solution closed dyeing 15min, 60% isopropanol immersion wash 20s to remove impurities, put into distilled water slightly washed; using hematoxylin staining solution to stain the cell nucleus 2min, with distilled water slightly washed, filter paper to dry the surrounding moisture after using cover glass paste, under the microscope to observe and take pictures.

[0070] Take eWAT tissue and H&E staining of eWAT.

[0071] The experimental results are shown in Figure 5 The Western blot analysis results show that the expression of RAB6B protein in the liver of Rab6b knockdown group KD mice is significantly reduced. The TG and TC in the serum of Rab6b knockdown group KD mice are significantly reduced. The lipid analysis in the liver shows that the TG in the liver of Rab6b knockdown group mice is significantly reduced, while the TC is compensatorily increased. Since the TG level is increased directly indicating the accumulation and esterification storage of fatty acids, it is a typical marker of lipid accumulation, combined with the H&E staining and oil red O staining results of liver tissue, it shows that Rab6b knockdown can reduce the TG in the liver to reduce lipid accumulation. In addition, the volume of eWAT and iWAT of Rab6b knockdown group mice is significantly reduced. The H&E staining results of eWAT show that the fat cell area of Rab6b knockdown group mice is significantly reduced. This finding further reveals the improvement effect of liver Rab6b knockdown on the metabolic regulation of white adipose tissue.

Claims

1. Application of RAB6B as a target in the prevention and / or treatment of metabolic dysfunction-related steatohepatitis.

2. The application according to claim 1, characterized in that, The specific application is the use of reagents that knock out, silence, or inhibit RAB6B gene expression in the preparation of drugs for the prevention and / or treatment of metabolic dysfunction-related steatohepatitis.

3. The application according to claim 2, characterized in that, The drug also includes pharmaceutically acceptable excipients.

4. The application according to claim 2, characterized in that, The drug can improve liver and systemic lipid metabolism disorders.

5. The application according to claim 2, characterized in that, The drug can reduce serum TG and TC, as well as liver TG.

6. The application according to claim 2, characterized in that, The drug can reduce the volume of eWAT fat and iWAT fat.

7. The application according to claim 2, characterized in that, The reagents include vectors for knocking out, silencing, or suppressing the RAB6B gene.

8. A drug for the prevention and / or treatment of metabolic dysfunction-related steatohepatitis, characterized in that, The drug can reduce the expression level of the RAB6B gene.

9. The medicament according to claim 8, characterized in that, The drug includes vectors that knock out, silence, or suppress the RAB6B gene.