An engineered exosome overexpressing egf and fgf, and a preparation method, product and application thereof

CN120966763BActive Publication Date: 2026-09-04SUZHOU EV MEDICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511511269.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2026-09-04
Estimated Expiration
2045-10-22

AI Technical Summary

Technical Problem

解决现有外泌体疗法中“生长因子负载效率低、易降解、无法协同激活毛囊再生通路”的问题

Benefits of technology

(1)精准修复毛囊病理:细胞层面可逆转DHT对毛囊毛乳头细胞的增殖抑制,使S期细胞占比升15.3%、Ki67荧光强度增16.6倍,还提升细胞迁移能力(48小时闭合率从35.8%升至65.6%);动物模型中让AGA小鼠毛囊从休止期恢复为生长期,毛发覆盖率从21.5%提至58.4%,阻断毛囊微型化。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966763B_ABST
    Figure CN120966763B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of exosomes, and particularly relates to engineered exosomes overexpressing EGF and FGF, a preparation method, products and applications thereof. The present application uses LAMP2B fusion expression technology to anchor EGF and FGF on the surface of 293T cell-derived exosome membranes, avoids degradation of free factors, and makes up for the problem of insufficient carrying capacity of natural exosomes. The exosomes can reverse the proliferation inhibition of hair follicle bulge cells by DHT, improve the cell migration ability, promote the AGA mouse hair follicle from the resting phase to the growth phase, and block the miniaturization of the hair follicle, ultimately reconstruct the AGA hair follicle microenvironment to achieve functional hair growth. Cell experiments confirm that the exosomes can repair DHT-damaged hair follicle cells, animal experiments improve the hair coverage rate of AGA mice, and the safety is good and the initial clinical effect is good, which provides an efficient, safe and flexible new solution for AGA treatment, and has good clinical transformation potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of exosome technology, specifically relating to an engineered exosome overexpressing EGF and FGF, its preparation method, product, and application. Background Technology

[0002] The incidence of androgenetic alopecia (AGA) increases significantly with age. From a pathological perspective, the core pathological features of AGA are mainly reflected in three key aspects: First, hair follicle miniaturization. Due to the imbalance in the differentiation of hair follicle stem cells, the diameter of the hair follicle progressively shrinks, and normal terminal hair (diameter >60μm) gradually transforms into vellus hair (diameter <30μm), eventually leading to the complete loss of hair follicle function. Second, disordered hair follicle growth cycle. The hair follicle growth cycle, including the anagen (growth) phase, catagen (transitional) phase, and telogen (resting) phase, becomes unbalanced, with a significantly shortened anagen phase and a correspondingly prolonged telogen phase, resulting in hair loss far exceeding regeneration. Third, growth factor deficiency. Clinical sample analysis confirms that the expression levels of epidermal growth factor (EGF) and fibroblast growth factor (FGF) in human follicular papillary cells (HFDPCs) of AGA patients are significantly downregulated. The lack of growth factors directly leads to the inhibition of the Wnt / β-linked protein pathway, which promotes hair follicle proliferation, while the BMP pathway, which inhibits hair follicle regeneration, is overactivated, thus forming a vicious cycle of "hair follicle atrophy - reduced growth factors," further aggravating hair loss symptoms. Furthermore, single-cell RNA sequencing (scRNA-seq) studies have found that the expression of NOTCH pathway genes (such as NOTCH1, NOTCH2, and NOTCH3) in the medulla, cortex, and inner root sheath cells of hair follicles from AGA patients is significantly downregulated (P<0.05). Since NOTCH signaling is a key effector downstream of EGF / FGF regulating the fate of hair follicle stem cells, its reduced expression further confirms the central role of growth factor cascade dysfunction in the pathogenesis of AGA.

[0003] In the clinical treatment of AGA, the commonly used first-line treatments mainly include minoxidil, finasteride, low-energy laser therapy, and hair transplantation. However, these treatments all have significant limitations and are difficult to meet clinical needs. Minoxidil, due to its low transdermal absorption efficiency, requires long-term and frequent use, and hair loss symptoms are highly likely to recur once discontinued. While finasteride can exert a certain therapeutic effect by inhibiting androgen conversion, it may be accompanied by sexual dysfunction-related side effects. More importantly, it cannot reverse the already atrophied hair follicle structure. Low-energy laser therapy stimulates hair follicles with specific wavelengths (600-950nm), which can only increase hair diameter and density to a certain extent, and also cannot reverse the atrophied hair follicle structure. Hair transplantation can only transplant hair follicles from non-androgen-sensitive areas such as the occipital region, and cannot improve the microenvironment of the balding area. Furthermore, the number of donor hair follicles is limited, making it difficult to meet the treatment needs of patients with severe AGA. It is evident that current treatment options for AGA have many limitations. Developing potential therapeutic drugs with the ability to comprehensively regulate the multi-pathway networks required for hair follicle regeneration, such as Wnt / β-linked proteins and BMP, has become a key direction for overcoming the treatment dilemma of AGA.

[0004] Exosomes, acting as nanomessengers for intercellular communication, have become a research hotspot in regenerative medicine due to their natural drug-carrying capacity, low immunogenicity, and ability to regulate the microenvironment. Various exosome therapies have shown therapeutic potential in treating AGA (adrenal alopecia areata). For example, naturally derived exosomes, such as platelet-rich plasma-derived exosomes, garlic exosomes, and mesenchymal stem cell exosomes, have been shown to promote hair follicle development and increase hair density by upregulating the VEGF pathway. Engineered exosomes, such as fisetin-treated human keratinocyte (HaCaT) exosomes, can prolong the hair follicle growth phase through antioxidant stress. However, the efficacy of these exosome therapies is limited by insufficient growth factor content in the exosomes. Furthermore, most existing engineered exosomes passively load growth factors, resulting in low loading efficiency, poor synergy between growth factors, and susceptibility to protease degradation (half-life <2 hours). These limitations prevent the sustained activation of hair follicle regeneration pathways, hindering effective and long-lasting treatment of AGA.

[0005] Given the high incidence of AGA and its serious impact on patients' quality of life, as well as the many shortcomings of existing treatment options and exosome therapy, developing a technical solution that can effectively solve the above problems and achieve efficient and lasting treatment for AGA has important clinical value and social significance. It can not only bring new treatment hope to the majority of AGA patients, but also promote the further development of regenerative medicine in the field of hair loss treatment. Summary of the Invention

[0006] To address the aforementioned shortcomings, this invention utilizes genetic engineering to directionally express the LAMP2B-EGF / FGF fusion protein onto the membrane surface of exosomes derived from 293T cells, thereby preparing engineered dual-factor exosomes overexpressing EGF and FGF. These dual-factor exosomes can efficiently deliver EGF and FGF and continuously repair the hair follicle microenvironment. This solves the problems of "low growth factor loading efficiency, easy degradation, and inability to synergistically activate hair follicle regeneration pathways" in existing exosome therapies.

[0007] The technical solution of this invention is as follows: On one hand, the present invention provides an engineered exosome, wherein the membrane surface of the engineered exosome is anchored with a LAMP2B-EGF / FGF fusion protein; the LAMP2B-EGF / FGF fusion protein comprises, from the N-terminus to the C-terminus, a signal peptide sequence, an EGF functional domain, an FGF functional domain and a LAMP2B transmembrane domain.

[0008] Specifically, the nucleic acid sequence of the signal peptide is shown in SEQ ID NO.2; the nucleic acid sequence of the EGF functional domain is shown in SEQ ID NO.3; the nucleic acid sequence of the FGF functional domain is shown in SEQ ID NO.5; and the nucleic acid sequence of the LAMP2B transmembrane domain is shown in SEQ ID NO.6.

[0009] Specifically, the EGF functional structural domain and the FGF functional structural domain are connected in series via a flexible connector.

[0010] Preferably, the nucleic acid sequence of the flexible connector is shown in SEQ ID NO.4.

[0011] In another aspect, the present invention provides a method for preparing the aforementioned engineered exosomes, comprising the following steps: S1. Construction of recombinant plasmid: Synthesize the recombinant gene of the aforementioned LAMP2B-EGF / FGF fusion protein, insert the recombinant gene into the vector through enzyme digestion and ligation reactions, and obtain the recombinant plasmid after transformation, screening and sequencing verification. S2. Cell transfection: The recombinant plasmid is transfected into cells and cultured. S3. Exosome purification: Collect the supernatant of transfected cells and obtain engineered exosomes by gradient centrifugation.

[0012] Specifically, the enzymes used for enzymatic digestion in step S1 are BamHI and EcoRI.

[0013] Specifically, the vectors described in step S1 include, but are not limited to: pcDNA3.1, pCMV-Myc, pCMV-HA, pEGFP-N1 / pDsRed-N1, pLVX-Puro, pAd-CMV, or pCEP4.

[0014] Preferably, the vector in step S1 is pcDNA3.1.

[0015] Specifically, step S2 also includes helper plasmids and liposomes.

[0016] Preferably, the auxiliary plasmid can be psPAX and pMD; the mass ratio of psPAX to pMD can be (7-9):(5-7):(3-5), preferably 8:6:4.

[0017] Preferably, the volume-to-mass ratio of liposomes to DNA can be (2-4):1, and more preferably 3:1.

[0018] Specifically, the cells mentioned in step S2 include, but are not limited to: 293T cells, HEK293 cells, mesenchymal stem cells, or HUVEC cells.

[0019] Preferably, the cells mentioned in step S2 are 293T cells.

[0020] Preferably, the specific process of cell transfection in step S2 is as follows: when the 293T cells are cultured to a confluence of 70%-90%, the culture medium is replaced with serum-free DMEM medium, preferably 80%.

[0021] Specifically, the centrifugation operation in step S3 is as follows: centrifuge at 200-400g for 5-15 min to remove cell debris, centrifuge at 1500-2500g for 15-25 min to remove apoptotic bodies, centrifuge at 8000-12000g for 20-40 min to remove microvesicles, and centrifuge at 90000-110000g for 60-80 min to precipitate exosomes.

[0022] Preferably, the centrifugation operation in step S3 is as follows: centrifugation at 300g for 10 min to remove cell debris, centrifugation at 2000g for 20 min to remove apoptotic bodies, centrifugation at 10000g for 30 min to remove microvesicles, and centrifugation at 100000g for 70 min to precipitate exosomes.

[0023] In another aspect, the present invention provides a drug comprising the aforementioned engineered exosomes.

[0024] Specifically, the drug also includes pharmaceutically acceptable excipients.

[0025] Preferably, the pharmaceutically acceptable excipients are selected from solvents, excipients, stabilizers, preservatives, suspending agents, emulsifiers, solubilizers, osmotic pressure regulators, pH regulators, antioxidants, fillers, binders, disintegrants, or lubricants.

[0026] Preferably, the solvent is selected from one or more of water for injection, physiological saline, phosphate buffer, glucose solution, or glycerol; the excipient is selected from starch, lactose, sucrose, mannitol, microcrystalline cellulose, calcium phosphate, calcium sulfate, kaolin, talc, sodium carboxymethyl cellulose, povidone (PVP), polyethylene glycol, gelatin, gum arabic, or mixtures thereof; the stabilizer is selected from benzyl alcohol, methylparaben, ethylparaben, propylparaben, chlorocresol, phenol, benzalkonium chloride, benzalkonium bromide, thimerosal, phenylmercuric nitrate, sorbic acid, potassium sorbate, or mixtures thereof; and the preservative is selected from benzyl alcohol and methylparaben. The suspending agent is selected from sodium carboxymethyl cellulose (CMC-Na), hydroxypropyl methylcellulose (HPMC), hydroxyethyl cellulose, methylcellulose, xanthan gum, gum arabic, tragacanth gum, agar, sodium alginate, polyvinylpyrrolidone (PVP), povidone K30, or mixtures thereof; the emulsifier is selected from polysorbates (Tween 20, Tween 80), sorbitan esters (Span 40, Span 60), polyoxyethylene castor oil, lecithin (soybean lecithin, egg white lecithin, etc.). The solubilizer is selected from polysorbates (Tween 80, Tween 20), polyoxyethylene castor oil, poloxamer (F68, F127), magnesium stearate, glyceryl monostearate, sodium lauryl sulfate (SDS), or mixtures thereof; the solubilizer is selected from polysorbates (Tween 80, Tween 20), polyoxyethylene castor oil, poloxamer, polyethylene glycol 400, glycerol, ethanol, propylene glycol, lecithin, cholic acid, sodium deoxycholate, cyclodextrin (β-cyclodextrin, hydroxypropyl-β-cyclodextrin), or mixtures thereof; the osmotic pressure regulator is selected from sodium chloride, potassium chloride, glucose, mannitol, sorbitol, glycerol, phosphates (disodium hydrogen phosphate, sodium dihydrogen phosphate), sodium citrate, or mixtures thereof; the pH regulator is selected from hydrochloric acid, sulfuric acid, nitric acid, sodium hydroxide, potassium hydroxide, phosphoric acid, etc. (Disodium hydrogen phosphate, sodium dihydrogen phosphate), citric acid (citric acid, sodium citrate), acetic acid (acetic acid, sodium acetate), sodium bicarbonate, sodium carbonate, tris(hydroxymethyl)aminomethane (Tris), or mixtures thereof; the antioxidant is selected from sodium sulfite, sodium bisulfite, sodium metabisulfite, sodium thiosulfate, vitamin C (ascorbic acid), vitamin E (tocopherol), propyl gallate, tert-butyl-p-hydroxyanisole (BHA), di-tert-butyl-p-cresol (BHT), glutathione, cysteine, or mixtures thereof; the filler is selected from lactose, sucrose, mannitol, sorbitol, microcrystalline cellulose, pregelatinized starch, starch, dicalcium phosphate, calcium carbonate, calcium sulfate, dextrin, cyclodextrin, polyethylene glycol, or mixtures thereof;The adhesive is selected from povidone (PVP K30, PVP K90), hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose (HPC), methylcellulose (MC), sodium carboxymethyl cellulose (CMC-Na), gelatin, gum arabic, starch paste, syrup, polyethylene glycol, or mixtures thereof; the disintegrant is selected from croscarmellose sodium (CCMC-Na), croscarmellose (PVPP), sodium carboxymethyl starch (CMS-Na), low-substituted hydroxypropyl cellulose (L-HPC), starch, microcrystalline cellulose, sodium alginate, or mixtures thereof; the lubricant is selected from magnesium stearate, calcium stearate, zinc stearate, talc, micronized silica (silica), polyethylene glycol (PEG4000, PEG6000), sodium dodecyl sulfate (SDS), hydrogenated vegetable oil, or mixtures thereof.

[0027] Specifically, the dosage forms of the drug include, but are not limited to: injections, lyophilized powder injections, gels, ointments, patches, or sprays.

[0028] In another aspect, the present invention provides the use of the aforementioned engineered exosomes or drugs in the preparation of products for the prevention and / or treatment of hair loss.

[0029] Specifically, the hair loss may be androgenetic alopecia.

[0030] The beneficial effects of this invention are as follows: (1) Precise repair of hair follicle pathology: At the cellular level, DHT can reverse the inhibition of hair follicle dermal papilla cell proliferation, increase the proportion of S phase cells by 15.3%, increase Ki67 fluorescence intensity by 16.6 times, and also enhance cell migration ability (the closure rate increased from 35.8% to 65.6% after 48 hours); in animal models, it can restore the hair follicles of AGA mice from the resting phase to the growth phase, and increase the hair coverage from 21.5% to 58.4%, thus blocking hair follicle miniaturization.

[0031] (2) Safety was verified in all dimensions: After treatment, the mice had no pathological damage to the major organs, and the blood and liver and kidney function indicators were normal; in the preliminary clinical trial, 3 patients had no adverse reactions such as scalp redness and swelling, and the tolerance was good.

[0032] (3) Clear clinical efficacy: In the preliminary clinical trial, the hair density of patients increased by 48.7% compared with the baseline, providing a new path for AGA treatment. Attached Figure Description

[0033] Figure 1The construction and characterization of EXO-EGF / FGF are shown below. A is a schematic diagram of the EGF-FGF-LAMP2B fusion protein design; B is a TEM image of EXO-EGF / FGF (left scale bar = 500 nm, right scale bar = 50 nm); C is the NTA size distribution of EXO-EGF / FGF; D is the Zeta potential of EXO-EGF / FGF; E is the Western blot of exosomal EGF and FGF; F is the CCK-8 activity assay of HFDPCs after 72 hours of treatment with EXO-EGF / FGF (n = 7). *** indicates p < 0.001.

[0034] Figure 2 Effects of EXO-EGF / FGF on the regenerative function of HFDPCs: Cell cycle distribution was analyzed by flow cytometry. *** indicates p<0.001.

[0035] Figure 3 The effect of EXO-EGF / FGF on the regenerative function of HFDPCs is shown in Figure A, where Ki67 immunofluorescence (scale bar = 50 μm) represents the results. Red: Ki67; Blue: DAPI; B shows the results of the scratch assay at 12, 24, and 48 hours. * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, and ns indicates p ≥ 0.05.

[0036] Figure 4 To demonstrate the effect of EXO-EGF / FGF on promoting hair regeneration in a model of androgenetic alopecia (mice were approximately 10 cm in length), A shows the AGA modeling and treatment regimen in vivo; B shows the quantified hair coverage area; and C shows the H&E staining of the AGA-treated skin region. *** indicates p < 0.001.

[0037] Figure 5 Representative images of the back on days 0, 5, 9, and 12 of the effect of EXO-EGF / FGF on promoting hair regeneration in an androgenic alopecia model.

[0038] Figure 6 Protein expression levels of Ki67, EGF, and FGF in the AGA skin region (quantitative immunohistochemical analysis); left scale bar = 100 μm, right scale bar = 100 μm. *** indicates p < 0.001.

[0039] Figure 7 Representative H&E stained sections of major organs in the systemic safety assessment of EXO-EGF / FGF (scale bar = 200 μm).

[0040] Figure 8 Blood cell count parameters used in the systemic safety assessment of EXO-EGF / FGF. ns indicates p≥0.05.

[0041] Figure 9 Serum biochemical indicators of liver / kidney function in the systemic safety assessment of EXO-EGF / FGF. * indicates p<0.05, ns indicates p≥0.05.

[0042] Figure 10 The hair regrowth in the temporal region of three patients after treatment.

[0043] Figure 11 This is a viability graph of human dermal papillary cells in Comparative Example 1. *** indicates p<0.001.

[0044] Figure 12 This is a viability graph of human dermal papillary cells in Comparative Example 2. *** indicates p<0.001. Detailed Implementation

[0045] The present invention will be further clearly and completely illustrated below through embodiments. These embodiments are only some examples of the present invention and are not intended to limit the present invention, but are only for illustrating the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional experiments, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0046] Basic Implementation Molecular design of engineered exosomes: A LAMP2B-EGF / FGF fusion protein was constructed through genetic engineering to achieve targeted anchoring of growth factors on the exosome membrane surface. Specifically, this involved: first, inserting a specific signal peptide sequence MVCFRLFPVPGSGLVLVCLVLGAVRSYA (SEQ ID NO.1) at the N-terminus to guide the fusion protein to the exosome membrane; second, tandemly linking growth factors EGF (UniProt ID: P01133) and FGF (UniProt ID: P05230) via a flexible linker (GSGGSG) to form an EGF-FGF bifunctional domain. The linker design avoided steric hindrance, ensuring exposure of the active sites of both factors; finally, fusing the LAMP2B transmembrane domain (UniProt ID: P13473-2) at the C-terminus to immobilize the fusion protein in the exosome lipid bilayer.

[0047] Plasmid construction process: Using pcDNA3.1(+) as the backbone vector, a strong CMV promoter was inserted; the following were cloned sequentially: signal peptide → EGF gene → GSGGSG (glycine, serine) linker → FGF gene → LAMP2B transmembrane domain; directional ligation was completed by double restriction enzyme sites of BamHI / EcoRI; the correctness of the plasmid sequence and reading frame was verified by Sanger sequencing performed by Shanghai Sangon Biotech Co., Ltd.

[0048] During transfection, 293T cells were transfected at a rate of 2 × 10⁻⁶. 6 Exosomes were inoculated at a density of 8 μg / plate into serum-free medium and co-transfected using Lipofectamine 2000 transfection reagent at a ratio of 8 μg target plasmid + 6 μg psPAX + 4 μg pMD. The culture supernatant was collected 72 hours after transfection for exosome isolation.

[0049] Exosome purification: Exosomes were purified by differential centrifugation. First, centrifugation at 300g for 10 min was used to remove cell debris, followed by centrifugation at 2,000g for 20 min to remove apoptotic bodies, then centrifugation at 10,000g for 30 min to remove microvesicles, and finally centrifugation at 100,000g for 70 min to precipitate the exosomes. The exosome precipitate was resuspended in PBS, sterilized by a 0.22 μm filter membrane, quantitatively aliquoted using the BCA method, and stored at -80℃.

[0050] Example 1: Preparation and Characterization of Engineered Exosomes (Exo-EGF / FGF) Plasmid construction and synthesis of the target gene fragment: 5′-signal peptide (SEQ ID NO.1: MVCFRLFPVPGSGLVLVCLVLGAVRSYA)-EGF-GSGGSG-FGF-LAMP2B-3′ (full length 1872 bp) (see...) Figure 1 (A) The pcDNA3.1 vector (Invitrogen™, catalog number V79020) and the target fragment were digested with BamHI (5′ end) and EcoRI (3′ end), and ligated overnight at 16°C with T4 DNA ligase; transformed into DH5α competent cells (Invitrogen™, catalog number 18258012), single clones were picked, plasmids were extracted and verified by Sanger sequencing (sequence accuracy 100%).

[0051] Signal peptide (SEQ ID NO.2): ATGGTGTGCTTCAGACTGTTCCCAGTGCCAGGGAGCGGACTCGTGCTGGTGTGCCTCGTGCTCGGCGCCGTGAGATCCTACGCT; EGF (SEQ ID NO.3): CCCTCTGCCCGTGTCTAGCGACAACAGCGACTCCGAGTGCCCTCTCAGCCACGACGGATACTGCCTCCACGACGGGGTGTGCATGTACATTGAGGCTCTGGACAAGTACGCTTGCAACTGCGTGGTGGGCTACATCGGCGAGAGATGCCAGTACCGCGACCTGAAGTGGTGGGAGCTGCGC; Flexible linker (SEQ ID NO. 4): GGTAGCGGCGGTTCTGGC; FGF (SEQ ID NO. 5): ATGGCTGAGGGCGAGATTACAACCTTCACCGCTCTCACAGAGAAGTTCAACCTGCCTCCAGGAAACTACAAGAAGCCTAAGCTCCTGTACTGCTCTAACGGCGGGCACTTCCTGCGCATTCTCCCTGACGGAACAGTGGACGGGACCCGCGACAGGTCTGACCAGCACATCCAGCTACAGCTGTCCGCCGAGTCCGTGGGGGAGGTGTACATTAAGTCCACAGAGACCGGCCAGTACCTCGCTATGGACACCGACGGACTGCTCTACGGATCTCAGACACCAAACGAGGAGTGCCTGTTCTTAGAACGGCTGGAGGAGAACCACTACAACACATACATTTCTAAGAAGCACGCCGAGAAGAACTGGTTCGTGGGACTCAAGAAGAACGGGTCTTGCAAGCGCGGCCCACGCACCCACTACGGGCAGAAGGCTATTCTGTTCCT; LAMP2B-3' (SEQ ID NO. 6):

[0052] Cell transfection and exosome collection: 293T cells (Beyotime, catalog number C6008) were cultured to 80% confluence, and the medium was replaced with serum-free DMEM. A complex was prepared using liposomes (Beyotime, catalog number C0520) 2000:DNA at a ratio of 3:1 (volume:mass), and added to cell culture dishes. After incubation at 37°C for 6 hours, the medium was replaced with fresh medium. The supernatant was collected 72 hours after transfection and stored at 4°C for later use. The supernatant was centrifuged at differential speed, and the exosomes were resuspended in PBS. Protein concentration (target concentration 160 μg / mL) was determined using the BCA method (ThermoScientific, A65453), and the protein was aliquoted and frozen at -80°C.

[0053] Subsequent systematic characterization confirmed the successful preparation of functional exosomes (EXO-EGF / FGF). Transmission electron microscopy (TEM) revealed a typical cup-shaped, double-membrane vesicle structure. Figure 1 B in the text). Nanoparticle tracking analysis (NTA) showed a uniform size distribution (peak diameter: 98 nm), consistent with the characteristic range of exosomes (B). Figure 1 C in the middle). Zeta potential detection indicates moderate stability ( Figure 1 (D in the text). Western blot analysis was used to verify the difference in EGF and FGF expression between 293T exosomes and EXO-EGF / FGF. The results showed that EGF and FGF were specifically enriched in EXO-EGF / FGF, with expression levels 1.8 times higher than in 293T exosomes. Figure 1 (E in the text).

[0054] Human dermal papillary cells (HFDPCs) were purchased from Merck. Cell culture was performed in high-glucose DMEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) at 37°C and 5% CO2. HFDPCs were cultured at a rate of 5 × 10⁶ cells / year. 3 HFDPCs were seeded at a density of cells / well in 96-well plates. After 24 hours of culture, to assess potential cytotoxicity, HFDPCs were treated with gradient concentrations of EXO-EGF / FGF (0 μg / mL, 20 μg / mL, 40 μg / mL, 80 μg / mL, 160 μg / mL, 320 μg / mL) for 72 hours. Then, 10 μL of CCK-8 solution was added to each well and reacted for 20 minutes. The absorbance at 450 nm was measured using a microplate reader (VA000010D, Thermo Fisher Scientific). The percentage of cell viability was calculated with the untreated group as a control. The CCK-8 assay (reagent manufacturer: Beyotime, catalog number C0038) showed that cell viability was significantly improved at all tested concentrations (P<0.001 compared to the untreated control group), confirming that EXO-EGF / FGF did not exhibit cytotoxicity and could promote cell proliferation. Figure 1(F in the text). Furthermore, because the EXO-EGF / FGF concentration of 160 μg / mL exhibited the best cell proliferation-promoting effect, this concentration was selected for subsequent experiments.

[0055] In this invention, all experimental data are presented as mean ± standard deviation (Mean ± SD). Unless otherwise specified, all experiments were performed in triplicate. One-way ANOVA was used to analyze differences between groups, Tukey's post-hoc test was used for multiple comparisons, and Student's t-test was used for comparisons between two groups. Significance thresholds were set at p < 0.05, p < 0.01, and p < 0.001. All statistical analyses were performed using GraphPad Prism 8.0 software.

[0056] Example 2: In vitro functional verification of EXO-EGF / FGF A human follicular dermal papilla cells (HFDPCs) model of androgenetic alopecia (AGA cell model) was constructed by pretreating them with dihydrotestosterone (DHT, 50 μM) for 12 hours. The effect of EXO-EGF / FGF on HFDPC proliferation was assessed using a cell cycle assay kit (Beyotime, catalog number C1052). HFDPCs treated with 160 μg / mL EXO-EGF / FGF for 48 hours were collected, trypsinized, centrifuged, washed, and fixed with 70% ethanol at 4°C for 24 hours. Propidium iodide (PI) staining solution (containing RNase A) was prepared according to the kit (Beyotime, catalog number C1052). After staining in the dark for 30 minutes, fluorescence signals were detected by flow cytometry (BD FACSCantoII) to analyze cell cycle distribution (G0 / G1, S, G2 / M phases). Flow cytometry analysis showed that EXO-EGF / FGF (160 μg / mL, 48 hours) induced significant cell cycle redistribution. Specifically, after treatment of androgenetic alopecia cell models with EXO-EGF / FGF, the percentage of cells in the G0 / G1 phase decreased from 69.5% to 53.2% (P<0.001), the percentage in the S phase increased from 18.9% to 34.2% (P<0.001), and the percentage in the G2 / M phase increased from 11.1% to 12.0%. Figure 2 This shift confirms that EXO-EGF / FGF drives cell proliferation by promoting the G1 / S phase transition.

[0057] Ki67 is a protein found in the nucleus of proliferating cells, and its expression level directly reflects the cell's proliferative state. Ki67 immunofluorescence showed that EXO-EGF / FGF could enhance the proliferative activity of HFDPCs. HFDPCs treated with EXO-EGF / FGF (160 μg / mL) exhibited a strong nuclear Ki67 signal, with a fluorescence intensity of 56.4%. In contrast, the fluorescence intensity in the healthy HFDPC control group (without dihydrotestosterone treatment) was 16.7%, and in the androgenic alopecia cell model, it was 3.4%. Compared to the androgenic alopecia cell model, EXO-EGF / FGF treatment increased Ki67 intensity by 16.6 times (P<0.001). Figure 3 (A in the middle).

[0058] Scratch assays quantified the migration ability of HFDPCs to the damaged area. The closure rate was measured after 12, 24, and 48 hours of treatment with EXO-EGF / FGF (160 μg / mL). Results showed that after 48 hours of EXO-EGF / FGF treatment, the closure rate in the healthy HFDPCs control group (without dihydrotestosterone treatment) reached 38.7%, while the closure rate in the androgen-induced alopecia cell model group reached 35.8%. After treatment with EXO-EGF / FGF in the androgen-induced alopecia cell model, the closure rate reached 65.6%, which was significantly different from the androgen-induced alopecia cell model group (P<0.001). Figure 3 (B in the middle).

[0059] Example 3 Functional Validation of EXO-EGF / FGF in Animal Models To evaluate the therapeutic effect of EXO-EGF / FGF, an androgenetic alopecia model was established using 18 seven-week-old male C57BL / 6J mice (provided by SPF Biotechnology Co., Ltd.). After removing hair from the back with depilatory cream, the mice were randomly divided into three groups: control group (EXO-NC), model group (EXO-NC + DHT), and treatment group (EXO-EGF / FGF + DHT). The normal hair loss control group underwent mechanical hair removal, followed by injection of 100 μL EXO-NC on days 1 and 6. The androgenetic alopecia (AGA) model group underwent mechanical hair removal followed by subcutaneous injection of 5 mg / mL testosterone propionate to induce the AGA model, and then injection of 100 μL EXO-NC on days 1 and 6. The EXO-EGF / FGF treatment group underwent subcutaneous injection of 5 mg / mL testosterone propionate to induce the AGA model, followed by injection of 100 μL EXO-EGF / FGF on days 1 and 6. Figure 4 (A) On day 12, hair growth was assessed in all three groups of mice, and the animal experiment was terminated. All animal experimental protocols were approved by the Experimental Animal Ethics Committee of Shanghai Skin Disease Hospital (No. 2024-21).

[0060] The results showed that mice with normal hair loss exhibited strong spontaneous hair regeneration, with a hair coverage rate of 82.7%. In contrast, AGA animals maintained bald patches with a hair coverage rate of 21.5%, compared to the control group (P<0.05). However, after EXO-EGF / FGF treatment in AGA animals, androgen-induced hair loss was reversed, restoring hair density to near-normal levels, with a hair coverage rate of 58.4%. Figure 4 B in Figure 5 Pathological analysis of skin tissue using H&E staining revealed that the skin of the control group of mice with normal hair loss contained a large number of anagen-phase hair follicles, while AGA tissue was mainly composed of miniaturized telogen-phase hair follicles. After treatment with EXO-EGF / FGF, some AGA telogen-phase hair follicles returned to the anagen phase and exhibited characteristic elongation and melanin deposition. Figure 4 (C in the middle).

[0061] Skin samples and liver, spleen, and kidney samples from all mice were collected on day 12 of treatment and fixed in 4% paraformaldehyde solution. The fixed tissues and organs were then subjected to graded ethanol dehydration, xylene clearing, and paraffin embedding before being embedded. Hematoxylin-eosin (HE) staining and immunochemical analysis were then performed on the embedded tissues. HE staining required hematoxylin staining and eosin counterstaining of 5 μm sections, followed by mounting. Immunohistochemistry required antigen retrieval and blocking of 5 μm sections, followed by incubation with target antibodies EGF, FGF, and Ki67. Finally, secondary antibody labeling was performed before mounting. All images were observed and acquired using a fluorescence inverted microscope. Compared with the control group, the expression levels of Ki67, EGF, and FGF proteins in the hairball region of AGA mice were significantly downregulated (P<0.001). Treatment with EXO-EGF / FGF improved the expression of three proteins in AGA mice, with significant increases in the expression levels of Ki67, EGF, and FGF proteins, showing statistically significant differences compared to the AGA group (P<0.001). Figure 6 The results showed that EXO-EGF / FGF can treat AGA by upregulating Ki67, EGF and FGF, and promote the recovery of abnormal hair follicle cycles caused by AGA.

[0062] Example 4: EXO-EGF / FGF Security Verification The biosafety of EXO-EGF / FGF was verified after subcutaneous injection into AGA mice for 12 days (mouse information and treatment protocol were the same as in Example 3). Skin samples and liver, spleen, and kidney samples from all mice were collected on day 12 of treatment and fixed in 4% paraformaldehyde solution. The fixed tissues and organs were sequentially dehydrated with graded ethanol, cleared with xylene, and impregnated with paraffin before tissue embedding. The embedded tissues were then subjected to hematoxylin-eosin (HE) staining and immunochemical analysis. HE staining required hematoxylin staining and eosin counterstaining of 5 μm sections before mounting.

[0063] Visual observations showed that the major organs (liver, kidney, heart, lung, and spleen) of mice in the EXO-EGF / FGF treatment group maintained their intact structure. Histopathological assessment of the major organs using H&E staining revealed no pathological damage, necrosis, inflammatory infiltration, or fibrotic lesions. Figure 7 Complete blood cell counts were performed using a Beckman Coulter blood analyzer and its reagents. The analysis further confirmed physiological homeostasis: key indicators, including hemoglobin, white blood cells, and platelets, were all maintained within the normal range. Figure 8 Liver function indicators (alanine aminotransferase (ALT) and aspartate aminotransferase (AST)) and kidney function indicators (blood urea nitrogen (BUN) and creatinine (Cr)) were measured using a Roche Diagnostics kit on a Roche cobas series fully automated biochemical analyzer using a rate method. Liver and kidney function indicators, serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and creatinine levels were all maintained within the normal range. Figure 9 This indicates that EXO-EGF / FGF has excellent biocompatibility and translational potential for the treatment of AGA.

[0064] Example 5: Preliminary Clinical Efficacy of EXO-EGF / FGF Scalp samples (n=3) from patients with confirmed androgenetic alopecia (AGA) treated at the Department of Dermatology, Shanghai Skin Disease Hospital were collected. All participants in the clinical sample collection signed written informed consent forms, and the study protocol was approved by the Ethics Committee of Shanghai Skin Disease Hospital (No. 2023-45). Inclusion criteria: No other hair loss treatment received in the past 3 months, and normal liver and kidney function. Exclusion criteria: Androgen-dependent diseases, autoimmune diseases, and keloid scarring. Treatment regimen: Temporal alopecia area (approximately 5 cm²). 2Subcutaneous injection of EXO-EGF / FGF (160μg / mL) at multiple points, 0.1mL at each point, with a needle spacing of 1cm; twice a week for 5.5 weeks (11 treatments in total).

[0065] See real photos of hair regrowth in the temporal region during the treatment process. Figure 10 Preliminary clinical results showed that the patient's hair density increased by 48.7% compared to baseline (from 85±12 hairs / cm²). 2 Increased to 126±15 roots / cm 2 Data are expressed as mean ± standard deviation. No significance test was performed due to the small sample size. During treatment, no adverse reactions such as localized redness, swelling, or itching occurred on the scalp of the subjects.

[0066] The therapeutic formulation of this invention can be extended to transdermal delivery systems such as microneedle patches, using microneedle arrays to achieve painless delivery of exosomes through the stratum corneum, thereby improving patient compliance.

[0067] Comparative Example 1 Dual-factor exosomes were prepared according to the preparation method in patent CN119925573A (Example 1). Specifically, the iPS-clone 12c cells in the CN119925573A example were replaced with the 293T cells of this invention. After collecting and purifying the 293T cell exosomes, recombinant human EGF (PeproTech, AF-100-15) and recombinant human FGF (PeproTech, AF-100-18B) were loaded into the 293T cell exosomes using the passive loading method in the CN119925573A example via ultrasound. Then, the effects of various exosomes on the proliferation of human dermal papillary cells (HFDPCs) were detected using the CCK8 method in Example 1 of this invention. The exosome treatment concentration was 160 μg / mL, and the treatment time was 72 hours. The group without exosomes was named the control group; the group with untreated 293T cell exosomes was named EXO-NC; the group with passively transferred exosomes prepared according to the method in patent CN119925573A was named EXO-EGF-FGF; and the group with engineered dual-factor exosomes prepared by the method of this invention was named EXO-EGF / FGF.

[0068] The results are as follows: Compared with the control group, the EXO-EGF-FGF group showed an increase in cell viability of approximately 40%, while the EXO-EGF / FGF group showed a 98% increase in cell viability compared with the control group (see...). Figure 11The cell viability of the EXO-EGF / FGF group was 1.42 times that of the passively loaded EXO-EGF-FGF group, showing a significant improvement (P<0.001). These results indicate that the active anchoring strategy employed in this invention is significantly superior to the traditional passive loading method in promoting cell proliferation.

[0069] Comparative Example 2 Exosomes containing only EGF and FGF were prepared according to the preparation method of the present invention (basic embodiment and embodiment 1). Then, the effects of various exosomes on the proliferation of human dermal papillary cells (HFDPCs) were detected using the CCK8 method described in embodiment 1 of the present invention. The exosome treatment concentration was 160 μg / mL, and the treatment time was 72 hours. The group without exosomes was named the control group; the group with untreated 293T cell exosomes was named EXO-NC; the group with engineered exosomes containing EGF was named EXO-EGF; the group with engineered exosomes containing FGF was named EXO-FGF; and the group with engineered dual-factor exosomes prepared by the method of the present invention was named EXO-EGF / FGF.

[0070] The results are as follows: Compared with the control group, cell viability increased by 38% in the EXO-EGF group, by 52% in the EXO-FGF group, and by 98% in the EXO-EGF / FGF group. Cell viability in the EXO-EGF / FGF group was 1.43 times and 1.3 times that of the EXO-EGF group and the EXO-EG group, respectively. Compared with the single-factor groups, cell viability in the EXO-EGF / FGF treatment group was significantly increased (P<0.001) (see...). Figure 12 This result confirms that EGF and FGF have a significant synergistic effect in the engineered exosomes constructed in this invention.

[0071] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. An engineered exosome, characterized in that, The engineered exosomes have a LAMP2B-EGF / FGF fusion protein anchored on their membrane surface; the LAMP2B-EGF / FGF fusion protein includes, from N-terminus to C-terminus, a signal peptide sequence, an EGF functional domain, an FGF functional domain, and a LAMP2B transmembrane domain; the EGF functional domain and the FGF functional domain are connected in series via a flexible linker. The nucleic acid sequence of the signal peptide is shown in SEQ ID NO.2; the nucleic acid sequence of the EGF functional domain is shown in SEQ ID NO.3; the nucleic acid sequence of the FGF functional domain is shown in SEQ ID NO.5; the nucleic acid sequence of the LAMP2B transmembrane domain is shown in SEQ ID NO.6; and the nucleic acid sequence of the flexible linker is shown in SEQ ID NO.

4.

2. The method for preparing engineered exosomes according to claim 1, characterized in that, Includes the following steps: S1. Constructing recombinant plasmids: Synthesize the recombinant gene of the LAMP2B-EGF / FGF fusion protein as described in claim 1, insert the recombinant gene into the vector through enzyme digestion and ligation reactions, and obtain the recombinant plasmid after transformation, screening and sequencing verification. S2. Cell transfection: The recombinant plasmid is transfected into cells and cultured. S3. Exosome purification: Collect the supernatant of transfected cells and obtain engineered exosomes by gradient centrifugation.

3. The preparation method according to claim 2, characterized in that, The enzymes used for enzymatic digestion in step S1 are BamHI and EcoRI.

4. The preparation method according to claim 2, characterized in that, The vector in step S1 is pcDNA3.1, pCMV-Myc, pCMV-HA, pEGFP-N1 / pDsRed-N1, pLVX-Puro, pAd-CMV, or pCEP4.

5. The preparation method according to claim 4, characterized in that, The vector described in step S1 is pcDNA3.

1.

6. The preparation method according to claim 2, characterized in that, The cells mentioned in step S2 are 293T cells.

7. A drug, characterized in that, The drug comprises the engineered exosomes as described in claim 1.

8. The medicament according to claim 7, characterized in that, The drug also includes pharmaceutically acceptable excipients.

9. The use of the engineered exosomes of claim 1 or the drug of any one of claims 7-8 in the preparation of products for the prevention and / or treatment of androgenetic alopecia.

Citation Information

Patent Citations

  • EGF mesenchymal stem cell exosome as well as preparation method and application thereof

    CN113088496A

  • Application and preparation method of exosome EGF-FGF-EXO containing double growth factors

    CN119925573A

  • Engineered exosomes for skin rejuvenation

    TW202528538A

  • Pharmaceutical or cosmetic composition for preventing or treating hair loss or promoting hair growth

    US20210015840A1