SSR marker primer developed based on morus root transcriptome sequence and application thereof

Abstract

This invention discloses SSR marker primers developed based on the transcriptome sequence of banana roots and their applications, belonging to the field of molecular marker technology. The SSR marker primers include 10 pairs of primers: P15, P17, P33, P37, P49, P57, P62, P68, P78, and P92. These 10 pairs of marker primers exhibit good polymorphism, effectively reflecting the genetic diversity of banana root materials. They demonstrate rich polymorphism among different banana root germplasms, clear banding patterns, good repeatability of characteristic bands, and a high amplification success rate. This fills the gap in the development of SSR primers based on the transcriptome of banana roots. They can be used for interspecific identification and genetic diversity analysis of banana roots, providing a certain reference for the identification and quality evaluation of banana root germplasm resources.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, specifically to SSR marker primers developed based on banana root transcriptome sequences and their applications. Background Technology

[0002] Banana root (Rhizoma Musae) is the underground part of the banana plant (Musa basjoo Sied. et Zucc.) belonging to the genus Musa in the family Musaceae. With the development of modern science and technology, the rich chemical components and diverse pharmacological activities of banana root have been revealed, such as anti-inflammatory, analgesic, and antibacterial properties. Banana root contains various chemical components, including sugars, amino acids, organic acids, flavonoids, steroids, and volatile oils. Studies have shown that banana root can stimulate pancreatic β-cells to secrete insulin, thereby increasing the body's uptake and utilization of glucose and lowering blood glucose levels. Furthermore, 7-beta-hydroxyrutaecarpine, 7,8-dihydroxycoumarin, and pinocembrin diacetate are among the important active ingredients of banana root, which promote osteoblast proliferation and anti-inflammatory effects through signaling pathways such as the MAPK signaling pathway, Lipid and Atherosclerosis, PI3K-Akt, and IL-17. Currently, a bone-strengthening capsule has been developed using banana root as the main medicinal material, showing significant clinical efficacy in treating osteoarthritis, fractures, and other symptoms.

[0003] Simple repeat sequences (SSRs), also known as microsatellites, are primarily tandem repeat sequences of 2 to 5 nucleotides as basic repeat units. They have attracted attention due to their widespread distribution in the genome, high polymorphism, and co-dominant inheritance. With decreasing sequencing costs and increasing transcriptome data, their application in molecular biology research on medicinal plants lacking reference genome information is becoming increasingly widespread, such as in the use of Amomum villosum and Atractylodes lancea. Currently, banana root medicinal materials are mainly obtained from wild harvesting, but the biological characteristics of different Musa species are quite similar, making accurate identification through morphological methods difficult. Furthermore, artificial cultivation of banana roots is still in its early stages, and the genetic background and phylogenetic relationships among germplasm resources from different origins remain unclear, severely restricting the analysis and utilization of banana root germplasm resources.

[0004] This invention utilizes transcriptomic data from banana roots to analyze the composition, distribution, and characteristics of EST-SSR loci in banana roots, designs potential EST-SSR markers, and preliminarily verifies the polymorphism levels of these markers in different banana roots. These molecular markers may provide powerful tools for interspecific identification, genetic diversity analysis, and genetic mapping of banana roots. Summary of the Invention

[0005] In view of this, one objective of the present invention is to provide SSR marker primers developed based on the banana root transcriptome sequence; another objective of the present invention is to provide the application of SSR marker primers developed based on the banana root transcriptome sequence in the genetic diversity analysis of banana root germplasm resources; and a third objective of the present invention is to provide a kit containing a combination of SSR marker primers developed based on the banana root transcriptome sequence.

[0006] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0007] The SSR marker primers developed based on banana root transcriptome sequences according to this invention consist of the following 10 pairs of EST-SSR primers:

[0008]

[0009] The kit described in this invention contains SSR marker primers P15, P17, P33, P37, P49, P57, P62, P68, P78, and P92 developed based on banana root transcriptome sequences.

[0010] The application of the SSR marker primers developed based on the banana root transcriptome sequence described in this invention in the genetic diversity analysis of banana root germplasm resources.

[0011] The method for analyzing the genetic diversity of Musa rhizogenes germplasm resources described in this invention includes the following steps:

[0012] S1, banana root transcriptome gene acquisition:

[0013] Fresh young leaves of banana root samples were used for RNA extraction and cDNA library construction. The mRNA of banana root samples was sequenced using the Illumina Novaseq 6000 sequencing platform and assembled into independent gene sets using Trinity.

[0014] S2, Banana root DNA extraction:

[0015] Total DNA was extracted from the roots and leaves of the banana plant using a plant genomic DNA extraction kit. The total DNA obtained was subjected to quality testing by 2.0% agarose gel electrophoresis. After passing the test, the samples were stored at -20℃ for later use.

[0016] S3, Primer Design and Synthesis:

[0017] MISA was used to identify EST-SSR loci in banana roots; primers were designed using Primer 3, and 100 primer pairs were selected for screening experiments. The primer length was 18-25 bases, and the expected PCR amplification product length was 100-500 bp; the PCR amplification products were first detected by 1.5% agarose gel electrophoresis to identify bands without diffusion, and then 10% polyacrylamide gel electrophoresis was used to screen for polymorphic bands. Ten primer pairs with high polymorphism were selected from the amplification products.

[0018] S4, Identification of banana root resources:

[0019] Ten pairs of primers with high polymorphism were selected and fluorescently labeled with 6-carboxyfluorescein. The DNA of banana root samples was then amplified by PCR. The amplified PCR products were detected by capillary electrophoresis on an ABI-3730XL gene analyzer to detect fluorescence signals and site peaks.

[0020] S5, Genetic Diversity Analysis:

[0021] The raw data obtained from capillary electrophoresis were analyzed using Genemarker V2.2.0 software. The fragment size was obtained by comparing the position of the molecular weight internal standard in each lane with the position of the peak value of each sample. The genetic distance matrix of banana root samples was calculated using POPGENE32 software. Based on the GS value matrix, the results of the banana root sample data were clustered using the UPGMA method to obtain a circular cluster diagram.

[0022] In the method for analyzing the genetic diversity of Banana rhizogenes germplasm resources of the present invention, the primer synthesis system is as follows: 2 μL DNA template, 2×Rapid Taq Master Mix, 0.6 μL upstream and downstream primers, 10 μmol / L, 7.4 μL ddH2O.

[0023] In the method for analyzing the genetic diversity of Banana rhizogenes germplasm resources of the present invention, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 10 cycles; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 27 cycles; 72℃ extension for 5 min, and storage at 4℃.

[0024] In the method for analyzing the genetic diversity of Banana rhizogenes germplasm resources of the present invention, the EST-SSR locus retrieval parameters are set as follows: the number of single to hexanucleotide repeats are 10, 6, 5, 5, 5 and 5 times, respectively.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] 1. The 10 pairs of EST-SSR primers screened in this invention all had PIC values ​​greater than 0.5 in the 45 banana root germplasms tested, with an average PIC value of 0.759, showing good polymorphism and effectively reflecting the genetic diversity of the materials. The polymorphism was rich among different banana root germplasms, with clear banding patterns and good repeatability of characteristic bands, and the amplification success rate reached 60%, which is high.

[0027] 2. The 10 pairs of EST-SSR primers screened in this invention are new, stable markers that fill the gap in the development of SSR primers based on transcriptomes for the Musa rhizogenes. They can be used for intermediate identification and genetic diversity analysis of Musa rhizogenes germplasm resources, and provide a certain reference for germplasm resource identification and quality evaluation of Musa rhizogenes. Attached Figure Description

[0028] Figure 1 Partial electrophoresis images of EST-SSR primers screened by 1.5% agarose gel electrophoresis (lanes 1-4 are GZ-1, JS-1, WM-1, and WM-19, respectively);

[0029] Figure 2 Image showing the results of EST-SSR primer screening by 10% polyacrylamide gel electrophoresis;

[0030] Figure 3 Capillary electrophoresis image of P15 primer on some samples.

[0031] Figure 4 Cluster analysis diagram of banana roots Detailed Implementation

[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0033] Example 1

[0034] 1. Materials

[0035] Forty-five banana root samples were collected from seven counties in Guizhou, Guangxi Zhuang Autonomous Region, Jiangxi, Jiangsu, and Fujian provinces. Fresh, healthy leaves were collected and placed in paper molecular sample collection bags, then placed in a sealed box containing desiccant silica gel for subsequent experiments. Specific sampling information is shown in Table 1.

[0036] Table 1. Location information for 45 banana root samples

[0037]

[0038] 2 methods

[0039] 1.2 EST sequence origin

[0040] Fresh young leaves from the WM-1 sample were used for RNA extraction and cDNA library construction. The mRNA from the samples was sequenced using the Illumina Novaseq 6000 sequencing platform and assembled into an independent gene set, i.e., a transcriptome composed of EST sequences, using Trinity (https: / / github.com / trinityrnaseq / trinityrnaseq / wiki).

[0041] 1.3 DNA Extraction

[0042] Total DNA was extracted from the above experimental materials using a plant genomic DNA extraction kit (Beijing Tiangen). The obtained total DNA was subjected to quality testing by 2.0% agarose gel electrophoresis. After passing the test, the samples were stored at -20℃ for later use.

[0043] 1.4 Primer Design and Synthesis

[0044] MISA (http: / / pgrc.ipk-gatersleben.de / misa / misa.html, default parameters) was used to search for EST-SSR loci in banana roots. SSR locus search parameters were set to 10, 6, 5, 5, 5, and 5 repeats of single to hexagonal nucleotides, respectively. Primers were designed using Primer 3 (version 2.3.4), and 100 primer pairs were selected for screening experiments. Primer lengths were 18-25 bases, with an expected PCR product length of 100-500 bp.

[0045] 20 μL primer synthesis system: 2 μL DNA template, 2×Rapid Taq Master Mix, 0.6 μL forward and reverse primers (10 μmol / L), 7.4 μL ddH2O. PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 10 cycles; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 27 cycles; 72℃ extension for 5 min, then store at 4℃.

[0046] The PCR amplification products were first detected by 1.5% agarose gel electrophoresis to identify bands without diffusion. Then, 10% polyacrylamide gel electrophoresis (PAGE) was performed to screen for polymorphic bands. Finally, 10 pairs of primers with high polymorphism were selected from the amplification products of 100 pairs of primers.

[0047] 1.5 Identification of Banana Root Resources

[0048] DNA from 45 banana root samples was amplified by PCR after fluorescent labeling with 6-carboxyfluorescein (FAM). The amplified PCR products were then subjected to capillary electrophoresis on an ABI-3730XL gene analyzer (Applied Biosystems, Foster City, CA) to detect fluorescence signals and elution sites.

[0049] 1.6 Genetic diversity analysis

[0050] The raw data obtained from capillary electrophoresis were analyzed using Genemarker V2.2.0 software. Fragment sizes were determined by comparing the positions of molecular weight internal standards within each lane with the peak positions of each sample. Genetic distance matrices for the 45 tested materials were calculated using POPGENE32 software. Based on the GS value matrix, UPGMA was used to perform cluster analysis on the data of the tested materials, resulting in a circular cluster diagram.

[0051] 2 Results

[0052] 2.1 SSR locus information of banana root transcriptome

[0053] High-throughput transcriptome sequencing was used to obtain 7.65 Gb of high-quality sequences, with Q20 and Q30 values ​​of 99.07% and 96.83%, respectively, and a GC content of 51.21%. This indicates good sequencing assembly quality, suitable for subsequent analysis. The sequences were assembled using Trinity software, yielding 38,806 Unigenes with an average length of 993.00 bp.

[0054] SSR loci were analyzed in the Unigene of the banana root transcriptome using MISA software. SSR locus information is shown in Table 2. A total of 7501 SSR loci were retrieved, with a distribution frequency of 19.33%. SSRs were classified into six types based on repeat type, with trinucleotide repeats being the most common (44.03%), followed by dinucleotides (43.87%), mononucleotide glutamate (24.73%), tetranucleotides (1.64%), hexanucleotides (0.52%), and pentanucleotides (0.51%). The most prevalent repeat units were AG / CT, A / T, and ACC / GGT, accounting for 32.78%, 20.20%, and 2.41%, respectively. These results provide a basis for developing molecular markers for banana roots.

[0055] Table 2. Distribution of SSR site repeat numbers in the banana root transcriptome.

[0056]

[0057]

[0058] 2.2 EST-SSR primer screening

[0059] Four banana root germplasms with significant phenotypic differences (GZ-1, JS-1, WM-1, and WM-19) were selected for amplification using 100 pairs of random primers. Preliminary screening results showed that 60 pairs of primers successfully amplified clear bands with good repeatability, achieving a success rate of 60%. Figure 1 The 60 primer pairs obtained from the initial screening were subjected to 10% polyacrylamide gel electrophoresis, and the results are shown in the figure. Figure 2 Based on the above results, 10 pairs of EST-SSR primers with rich polymorphism, clear banding patterns, and stable reproducibility of characteristic bands among different banana root germplasms were selected (see Table 3). The primer efficiency rate was 16.67%. Capillary electrophoresis images of some samples amplified using primer P15 are shown in Table 3. Figure 3 .

[0060] Table 3.10 Information on EST-SSR primers

[0061]

[0062]

[0063] 2.3 Genetic diversity analysis

[0064] See Table 4. A total of 104 alleles (Na) were detected in 45 banana root germplasm accessions, with an average of 10.4 alleles per primer pair. The effective alleles (Ne) ranged from 3.164 to 8.691, with an average of 5.195. The proportion of effective allelic variation (effective allele Ne / allele Na) was 49.95%. The Shannon's index (I) ranged from 1.459 to 2.339, with an average of 1.835. The observed heterozygosity (Ho) ranged from 0.222 to 0.733, with an average of 0.576. The expected heterozygosity (He) ranged from 0.692 to 0.895, with an average of 0.795. The polymorphism information content (PIC) ranged from 0.639 to 0.874, with an average of 0.759. The fixed index variation (Fis) ranged from 0.112 to 0.698, with an average of 0.270. In this study, the PIC values ​​of the 10 EST-SSR primer pairs selected in the 45 tested banana root germplasms were all greater than 0.5, with an average PIC value of 0.759, showing good polymorphism and effectively reflecting the genetic diversity of the materials.

[0065] Table 4. Genetic diversity analysis of 10 primer pairs for banana root

[0066]

[0067]

[0068] 2.4 Cluster analysis of 45 banana root germplasm accessions

[0069] The UPGMA tree constructed based on the genetic distance coefficient shows that ( Figure 4 The 45 banana root germplasm resources were divided into three groups. Group A consisted of 36 individuals from the GZ, JS, GX and some WM groups; Group B consisted of the remaining 12 individuals from the WM group; and Group C consisted of 9 individuals from the FJ and JX groups.

[0070] Example 2

[0071] Ten pairs of EST-SSR primers selected in Example 1 were combined to prepare a kit for identification, polymorphism analysis, or genetic diversity analysis of banana root species. The specific primer names and sequences are as follows:

[0072]

[0073]

[0074] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. SSR marker primers developed based on banana root transcriptome sequences, characterized in that, The composition of the SSR-labeled primers consists of the following 10 pairs of EST-SSR primers: Primer Name Primer Sequence (5'-3') P15 F: GTCATCTCGGTGTGCTGTGT R: TTGGTCTTGCAAGTGTCGAG; P17 F: CTTATCCGCTCCTTTTGTCG R: TTCCGATCGAGCAACTTCTT; P33 F: CAGGAAGGCAAATTCCAATC R: TCCTTCAAGATCTATGCCCG; P37 F: CAAGTCCCTTCGTAGCTCCA R: TGAGTTGTCGATCCTTGTCG; P49 F: TGGGTTGCATGAGCATTTTA R: GAGGAGCATTTATGCCCAAG; P57 F: GTCCCTCGTACCATCTCTCG R: TCCCCTCCCTTCTTTTTCTC; P62 F: ACTGATTTCGTCTCCATCGG R: AGGGATAAGCATCAAGCACG; P68 F: ACCAGCGCACAAGCAATACT R: CAAAGTGGTGGGAGACTGGT; P78 F: AAATTGCTAGTCCCACACGG R: ATACGCAACTGCTGCACATC; P92 F: TACAAATTCCGTTGGTCGGT R: GATGGCATGAAAACGATGTG .

2. A reagent kit, characterized in that, The kit contains the P15, P17, P33, P37, P49, P57, P62, P68, P78, and P92 SSR marker primers developed based on the banana root transcriptome sequence as described in claim 1.

3. The application of an SSR marker primer developed based on banana root transcriptome sequences as described in claim 1 in the analysis of genetic diversity of banana root germplasm resources.

Images